ID: 958867976

View in Genome Browser
Species Human (GRCh38)
Location 3:99523473-99523495
Sequence TGTTCCCTCTTCCATATGTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958867976_958867981 12 Left 958867976 3:99523473-99523495 CCTAACATATGGAAGAGGGAACA No data
Right 958867981 3:99523508-99523530 GTCAATGGGTCTGAAGTATCAGG No data
958867976_958867980 -2 Left 958867976 3:99523473-99523495 CCTAACATATGGAAGAGGGAACA No data
Right 958867980 3:99523494-99523516 CATTTTGGGAAAACGTCAATGGG No data
958867976_958867979 -3 Left 958867976 3:99523473-99523495 CCTAACATATGGAAGAGGGAACA No data
Right 958867979 3:99523493-99523515 ACATTTTGGGAAAACGTCAATGG No data
958867976_958867982 13 Left 958867976 3:99523473-99523495 CCTAACATATGGAAGAGGGAACA No data
Right 958867982 3:99523509-99523531 TCAATGGGTCTGAAGTATCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958867976 Original CRISPR TGTTCCCTCTTCCATATGTT AGG (reversed) Intergenic
No off target data available for this crispr