ID: 958867977

View in Genome Browser
Species Human (GRCh38)
Location 3:99523479-99523501
Sequence ATATGGAAGAGGGAACATTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958867971_958867977 11 Left 958867971 3:99523445-99523467 CCTCATTACTCGCTCTTAAATGT No data
Right 958867977 3:99523479-99523501 ATATGGAAGAGGGAACATTTTGG No data
958867970_958867977 30 Left 958867970 3:99523426-99523448 CCAGCACAGACTCAATTATCCTC No data
Right 958867977 3:99523479-99523501 ATATGGAAGAGGGAACATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958867977 Original CRISPR ATATGGAAGAGGGAACATTT TGG Intergenic
No off target data available for this crispr