ID: 958867978

View in Genome Browser
Species Human (GRCh38)
Location 3:99523480-99523502
Sequence TATGGAAGAGGGAACATTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958867971_958867978 12 Left 958867971 3:99523445-99523467 CCTCATTACTCGCTCTTAAATGT No data
Right 958867978 3:99523480-99523502 TATGGAAGAGGGAACATTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958867978 Original CRISPR TATGGAAGAGGGAACATTTT GGG Intergenic
No off target data available for this crispr