ID: 958867979

View in Genome Browser
Species Human (GRCh38)
Location 3:99523493-99523515
Sequence ACATTTTGGGAAAACGTCAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958867975_958867979 -2 Left 958867975 3:99523472-99523494 CCCTAACATATGGAAGAGGGAAC No data
Right 958867979 3:99523493-99523515 ACATTTTGGGAAAACGTCAATGG No data
958867971_958867979 25 Left 958867971 3:99523445-99523467 CCTCATTACTCGCTCTTAAATGT No data
Right 958867979 3:99523493-99523515 ACATTTTGGGAAAACGTCAATGG No data
958867976_958867979 -3 Left 958867976 3:99523473-99523495 CCTAACATATGGAAGAGGGAACA No data
Right 958867979 3:99523493-99523515 ACATTTTGGGAAAACGTCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958867979 Original CRISPR ACATTTTGGGAAAACGTCAA TGG Intergenic
No off target data available for this crispr