ID: 958868280

View in Genome Browser
Species Human (GRCh38)
Location 3:99526595-99526617
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958868276_958868280 1 Left 958868276 3:99526571-99526593 CCAAAATTTCTTACTGTGAGAAG No data
Right 958868280 3:99526595-99526617 ACTACAAAGTAGAAGGAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr