ID: 958877735

View in Genome Browser
Species Human (GRCh38)
Location 3:99635039-99635061
Sequence ATGGAGAGGAGGGATGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958877735_958877742 5 Left 958877735 3:99635039-99635061 CCCTCCTCATCCCTCCTCTCCAT No data
Right 958877742 3:99635067-99635089 AGCCTCATTGTTCTACCACATGG No data
958877735_958877745 28 Left 958877735 3:99635039-99635061 CCCTCCTCATCCCTCCTCTCCAT No data
Right 958877745 3:99635090-99635112 ACCTTTCTATACAGTCATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958877735 Original CRISPR ATGGAGAGGAGGGATGAGGA GGG (reversed) Intergenic
No off target data available for this crispr