ID: 958878074

View in Genome Browser
Species Human (GRCh38)
Location 3:99638300-99638322
Sequence TCTTGACCACAGATGGGGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 196}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958878074 Original CRISPR TCTTGACCACAGATGGGGAA AGG (reversed) Intergenic
900312639 1:2041596-2041618 TCCTGACCACAGAGTGGGAAGGG + Intergenic
900792022 1:4687043-4687065 TCCTCACCACGGATGGGGACAGG + Intronic
901148422 1:7084274-7084296 TCTTGAAGACAGATGGAGGACGG + Intronic
901443954 1:9295618-9295640 TCTTCACCAGAGCTGGGGAATGG + Intronic
901687286 1:10949899-10949921 CCTTTTCCACAGGTGGGGAACGG + Intronic
902753039 1:18530743-18530765 CTTTGAACACAGATGGGCAATGG + Intergenic
902994565 1:20213538-20213560 ACTTGAACAGAGATGAGGAAAGG - Intergenic
904934817 1:34122690-34122712 TCCTGAGCACAGATGGGGTATGG - Intronic
906842198 1:49151487-49151509 TCTTCACATCAGATGGGTAATGG - Intronic
908764761 1:67544497-67544519 TCTTGAGCAGAGGTGGGAAAAGG - Intergenic
910170743 1:84374225-84374247 TATAGAACACAAATGGGGAAAGG - Intronic
910689014 1:89947303-89947325 ACCTGACAACAGATGGGGGAAGG - Intergenic
912043617 1:105423788-105423810 TCTTGACCAGAACTGGTGAAAGG + Intergenic
912945370 1:114080002-114080024 TTTTGCCCACAGAAGGAGAAAGG - Intergenic
915205799 1:154269605-154269627 TGTTTTCCACAGCTGGGGAAGGG - Intronic
916443751 1:164853168-164853190 TCTAGCCCACAGAAGGGAAAGGG + Intronic
920056079 1:203192768-203192790 TTATGACCAGAGAAGGGGAAAGG + Intergenic
921037229 1:211392490-211392512 TCTTCAGCACTGATGGTGAAAGG + Intergenic
923339981 1:232998802-232998824 TCTTGCTAACAGATGTGGAATGG + Intronic
1062861936 10:816982-817004 TCTGGGGCACAGCTGGGGAAAGG + Intronic
1064699332 10:18002377-18002399 TCAGGACCACAGATAGGGGATGG - Intronic
1065499760 10:26367970-26367992 TCCTTACCACAGAAGGTGAAGGG + Intergenic
1067267789 10:44761470-44761492 TCTTGACCACAAGGAGGGAAGGG + Intergenic
1067690550 10:48498758-48498780 TCATGACCAAAGCAGGGGAATGG + Intronic
1068878214 10:62020362-62020384 TTTTAAACACAGATGGGGGAGGG - Intronic
1071323992 10:84493718-84493740 ACTTTTCCACAGATGGGGAGAGG + Intronic
1071573213 10:86709280-86709302 CCTGGGCCACACATGGGGAAAGG + Intronic
1072664088 10:97381393-97381415 TCTTGGCAACAGATTGGGCAGGG + Exonic
1074196063 10:111186491-111186513 ACTTGAGCCCAGATGGGTAATGG - Intergenic
1080746530 11:35112905-35112927 TCCTGACCACATAAGGAGAAAGG + Intergenic
1083954168 11:65973961-65973983 TCATGACCATGGATGGGGAGGGG + Intronic
1088926158 11:114305281-114305303 TCTTGACAGCAGGTGGGGCATGG + Intronic
1088933828 11:114378835-114378857 TCTTCACAGAAGATGGGGAAAGG - Intergenic
1089730479 11:120515938-120515960 CCTTTTCCACAGATGAGGAAGGG + Intronic
1091721901 12:2820074-2820096 TCATGCCCACAGATGGAGATGGG + Exonic
1091857002 12:3748229-3748251 TCTTCAGCACAGATGGGGTGGGG + Intronic
1092895302 12:13004569-13004591 TTCTTACCACACATGGGGAAGGG + Intergenic
1093179698 12:15953078-15953100 TGGTCACCACAGATGGGGTAGGG - Intronic
1093421487 12:18979353-18979375 TCTTAAACAGAGATGGGGAAGGG - Intergenic
1093553791 12:20447110-20447132 ACTGGAACACAGATGGGCAAAGG + Intronic
1094284254 12:28774600-28774622 TCTTGATCTCAGATGAGGAGAGG - Intergenic
1095285257 12:40403159-40403181 TATTGTCCAGAAATGGGGAAGGG + Intronic
1096239503 12:49952078-49952100 TCTGTCCCACAGATGAGGAAGGG - Intronic
1097019344 12:56008624-56008646 TCTTGACCTTGGATGGGGATTGG - Intronic
1108030759 13:46226740-46226762 TATAGACAACAGATGGGTAAAGG + Intronic
1108115820 13:47126705-47126727 TCTTGACATCATATGGGCAAAGG + Intergenic
1109706345 13:66097422-66097444 TCTAGAGCACAGATTGGAAAAGG + Intergenic
1113173288 13:107531141-107531163 TCTTGACCACTGATGGAGTCCGG + Intronic
1113448998 13:110392700-110392722 TCTTGACCACAGTTAGATAAGGG - Intronic
1115164433 14:30431598-30431620 TATTGCCCACAGATGGGAGAGGG + Intergenic
1116690253 14:48097162-48097184 TCTTGGCCCCACATGAGGAATGG + Intergenic
1117147435 14:52849245-52849267 TCTGTACCAAAGATGGGGAAAGG - Intergenic
1117152355 14:52902442-52902464 TATTAACAACAGAGGGGGAAGGG + Intronic
1118042538 14:61932744-61932766 TCTGAAGCAAAGATGGGGAAGGG - Intergenic
1122870996 14:104639026-104639048 CCCTGACCACAGATGGAGAGTGG + Intergenic
1123957961 15:25359811-25359833 TATTGAACACAGTTTGGGAAAGG - Intronic
1124002414 15:25770249-25770271 ACTTGACCACAGTTGGGGATCGG + Intronic
1125142561 15:36426233-36426255 TCTTGGCCACAGTTGGGTAGTGG + Intergenic
1125598246 15:40901028-40901050 TCTTGACCCCAGCTGGGAGAGGG + Intronic
1128262882 15:66244751-66244773 TCTTCACCTCAACTGGGGAAAGG - Intronic
1129446270 15:75620751-75620773 TCTTGCCCACAGGTTGGGAGGGG - Intronic
1129532006 15:76274967-76274989 TCTTGACTCCTGCTGGGGAAGGG - Intronic
1130204329 15:81861938-81861960 TCTCCACCACAAATGGGAAAAGG + Intergenic
1130809123 15:87358394-87358416 TCTTGATGACTGGTGGGGAAGGG - Intergenic
1131072282 15:89473374-89473396 CCAGGACCACAGATGGGGCAAGG - Intronic
1131230986 15:90659273-90659295 TCTTCAAGAGAGATGGGGAAAGG - Intergenic
1132645061 16:995180-995202 TCTTCTCCACAGATGGGCACGGG - Intergenic
1135040881 16:19115664-19115686 TCTTGAGCACATATGAGGATAGG - Exonic
1135837560 16:25840869-25840891 ACTTGACCACAGATGGCCCATGG - Intronic
1136219085 16:28816397-28816419 TGTTTACCAGAGATTGGGAAGGG - Intergenic
1138287535 16:55821576-55821598 TCAGGACCACAGATGGGGCTAGG + Intronic
1139642848 16:68305316-68305338 TTTTAACCACAAATTGGGAATGG + Intronic
1143188328 17:5023807-5023829 TCTTGGCCAGGGATGGGGAGCGG + Exonic
1143269980 17:5668256-5668278 TGTGGACCACGGATGGGGGAAGG + Intergenic
1143540232 17:7564041-7564063 TCTTGAGCGCAGATGAGAAAGGG + Intronic
1144512267 17:15887207-15887229 TCTTGCCCACAGAGGAGTAAAGG + Intergenic
1145123644 17:20282317-20282339 TCTTGTCCACAGAGGAGTAAAGG + Intronic
1146555360 17:33818508-33818530 TCTCAACCTCAGATGGGGGAAGG + Intronic
1146650401 17:34602825-34602847 TCCTGGCCACAGATGGGTTAAGG - Intronic
1148057071 17:44805751-44805773 TCTTCCCCACAAATGTGGAATGG + Exonic
1148219579 17:45852024-45852046 TCTCATCCACAGATGAGGAAAGG + Intergenic
1149489084 17:57069041-57069063 TCTTGAAACCATATGGGGAATGG - Intergenic
1150338204 17:64345152-64345174 TCTTGCTCAAAGGTGGGGAAGGG - Intronic
1151350889 17:73531568-73531590 TCTAGATCAGAGATGGGGCAGGG - Intronic
1154050961 18:10957066-10957088 TCAAGAACACAAATGGGGAAAGG + Intronic
1155784256 18:29877406-29877428 TGTTGATTACAGATTGGGAATGG - Intergenic
1155975958 18:32132163-32132185 TTTTGAAAAAAGATGGGGAAGGG + Intronic
1156987186 18:43361990-43362012 GGCTGACCACAGCTGGGGAAAGG + Intergenic
1160675805 19:390684-390706 TCGTGTGCACAGATGAGGAACGG - Intergenic
1161241650 19:3226410-3226432 TTTTGAAAAGAGATGGGGAATGG - Intronic
1161512644 19:4679946-4679968 CCTGGAAAACAGATGGGGAAGGG + Exonic
1163083721 19:14963736-14963758 TTTTGACCACAGATGGTTGAGGG - Intronic
1164701625 19:30288849-30288871 TCTTGAATAAAGATGGAGAAAGG - Intronic
1164971209 19:32534230-32534252 ATTTGACCAAAGATGGAGAATGG + Intergenic
1167718616 19:51161383-51161405 TGATGACCACAGATGAGGTAAGG + Intergenic
1168400101 19:56080708-56080730 TCATGACCACAGATGGGACATGG + Intergenic
926214817 2:10898470-10898492 TCCTGACCAGAGATTAGGAAGGG - Intergenic
927197563 2:20558825-20558847 CCATGACCACAGAGGGGGTAGGG + Intergenic
928227872 2:29469227-29469249 ACATGTCCACAGATGTGGAATGG - Intronic
931176995 2:59864094-59864116 TCTTCAAGACAGATGGGAAAGGG - Intergenic
931310990 2:61080413-61080435 TCTTAAACACAAATGGTGAAGGG - Intronic
931761693 2:65423276-65423298 TCTAGACCACATATCAGGAATGG + Intronic
932709430 2:74051065-74051087 TGGTGAACACAGATGGGGAGAGG + Intronic
932833784 2:75015478-75015500 TCAGGAACACACATGGGGAAAGG + Intergenic
933616138 2:84484110-84484132 TCTAGCCAAAAGATGGGGAAAGG - Intergenic
933733373 2:85475490-85475512 CGTTGTCAACAGATGGGGAAGGG + Intergenic
934501274 2:94861930-94861952 TCTTGGCCTCCGATGGGGAGTGG + Intergenic
934841361 2:97626260-97626282 TCTGGAACTCAGATGGGGGATGG - Intergenic
936815632 2:116456939-116456961 CCTTGGCCACAGCTGGGGAAGGG - Intergenic
937318010 2:120944195-120944217 TCATGGCAGCAGATGGGGAAGGG + Intronic
937410043 2:121667140-121667162 TCTTCCCCACAGTTGGGTAATGG + Intergenic
940998475 2:160176196-160176218 AGTGGACCACAGATGGGGGAGGG - Intronic
941354657 2:164475180-164475202 TCTTTACCAAAAAAGGGGAAAGG - Intergenic
943001839 2:182337656-182337678 TATTGACCATGGATGGGGAAAGG - Intronic
944888466 2:204090096-204090118 ACATGACCAAAGATGGTGAAAGG + Intergenic
946025969 2:216671892-216671914 GCTTTCCAACAGATGGGGAAGGG + Intergenic
946320379 2:218950629-218950651 TCTTGTCCCCACATGGAGAAAGG - Intergenic
948063392 2:235058670-235058692 TCTGGACCACTGATGGGGAAAGG - Intergenic
948420461 2:237857040-237857062 TGCAGACCACAGATGGAGAAAGG - Intergenic
1169329285 20:4704101-4704123 TCTTAGCCCCAGATGGGGAGGGG - Intergenic
1169497007 20:6124550-6124572 TCTTGACCACAGGCTGGGCACGG - Intergenic
1172273769 20:33668800-33668822 TCTTGAACACACAAAGGGAAGGG + Intronic
1172795166 20:37532037-37532059 TCTTGAGGACAGAGGGGAAAGGG - Intergenic
1172940847 20:38653432-38653454 TCTTGACACCAGATGGTGCAAGG + Intergenic
1173153440 20:40587293-40587315 TCTTGGGCTGAGATGGGGAAGGG - Intergenic
1174545166 20:51319661-51319683 CCCTGACCACAGGAGGGGAAGGG - Intergenic
1175093684 20:56524787-56524809 TGGTGAGCAGAGATGGGGAAGGG - Exonic
1175094874 20:56533320-56533342 TGGTGAGCAGAGATGGGGAAGGG - Exonic
1175102960 20:56593192-56593214 TCTCAACCACAGGTGGGGATGGG - Intergenic
1178117994 21:29436890-29436912 TCTTCACTACAGGTGAGGAAGGG + Intronic
1178421266 21:32445315-32445337 GCTTATCCACAGATGTGGAATGG - Intronic
1179156225 21:38853442-38853464 ACTTGCCCACAGGTGGGGATGGG - Intergenic
1180714171 22:17860103-17860125 TCTTGACCAGAGGGTGGGAAAGG - Intronic
1182317065 22:29454666-29454688 CCTTGATTTCAGATGGGGAAGGG - Intergenic
1183284251 22:36952490-36952512 CCCTGGCCACAGATGGGGAGTGG - Intergenic
1183367808 22:37416570-37416592 TCATGACCACAGAAGTGGGAGGG + Intronic
1183716934 22:39538562-39538584 CCTTGTCCACAGATGGAGCAGGG - Intergenic
949522689 3:4871104-4871126 TCTTGACAACAGAGTAGGAAGGG + Intronic
953352882 3:42229483-42229505 TGTGGCCCACAGATGGGGAAAGG - Intergenic
953810517 3:46108736-46108758 TCTTGAGCACAGATATGTAATGG + Intergenic
954703753 3:52467365-52467387 CCTTCAGCACAGATGGGGTAGGG + Intronic
954757716 3:52850690-52850712 GCTTGACTGCAGATGGGGATGGG - Intronic
955955626 3:64286401-64286423 TCTTGGCCAGAGGTGGGGGAGGG + Intronic
957227514 3:77468938-77468960 TCTTCTGCACAGAAGGGGAATGG - Intronic
958265541 3:91433427-91433449 TCCTGACCACAGAAAGGAAAGGG + Intergenic
958878074 3:99638300-99638322 TCTTGACCACAGATGGGGAAAGG - Intergenic
959153603 3:102638899-102638921 GCTTGGCCACAGATGTGCAAAGG - Intergenic
961831505 3:129625349-129625371 ACTGGAAGACAGATGGGGAAGGG - Intergenic
963071207 3:141306854-141306876 TGGAGACCACAGATAGGGAAGGG - Intergenic
969408965 4:7015356-7015378 TCTTGACTGCGGTTGGGGAAGGG + Intronic
969934592 4:10668068-10668090 TCTGGAACACAGTTGGGGAGGGG + Intronic
970491437 4:16579024-16579046 TGGTCACCACAGATTGGGAAGGG + Intronic
972635944 4:40884116-40884138 TCTTGACAAGAGATGGTGAATGG - Intronic
972841823 4:42939872-42939894 TCAGGAACACAGATGGAGAATGG - Intronic
974415092 4:61596013-61596035 TCATGACCACAGCCGGGGAATGG + Intronic
979075428 4:116264106-116264128 TCTGGAGAACAGATGTGGAATGG + Intergenic
981421478 4:144555386-144555408 TCTTGTGGACAGATGGAGAATGG + Intergenic
981650554 4:147052866-147052888 TCTGGCTCACAGATGGGCAAGGG + Intergenic
982074657 4:151726730-151726752 TCCTGACCACCCCTGGGGAATGG - Intronic
985819321 5:2148876-2148898 CGTGGACCACAGATGGGGCAGGG - Intergenic
987770225 5:22293025-22293047 TGTGGACTACAGATTGGGAATGG - Intronic
989507441 5:42243578-42243600 TCTTTCCCAGAGATGGGTAATGG + Intergenic
990488312 5:56280292-56280314 TCTGGAGCACAGAAGGAGAAGGG + Intergenic
991444801 5:66688099-66688121 TCATGACCAGAGATGGAGAGTGG - Intronic
992804416 5:80323079-80323101 TTTTGTCAACAGATGAGGAAAGG + Intergenic
995304402 5:110627404-110627426 TCGTGAGAACGGATGGGGAAGGG + Intronic
995616695 5:113972564-113972586 TCTTGACCACAGAATTGAAATGG + Intergenic
1000437918 5:161235969-161235991 TCTTGAACACAGCTAGGGTAGGG - Intergenic
1001446191 5:171785792-171785814 TGGTGACCACAGGTGGGGGAGGG + Intergenic
1001471962 5:172020817-172020839 CCTTGGCCACAGCTGGAGAAAGG + Intergenic
1004355834 6:14929259-14929281 TTTTGAACACTAATGGGGAAGGG + Intergenic
1008683386 6:53898251-53898273 TCTTGGCTACAGTTGGGAAAAGG + Intronic
1008937973 6:57013034-57013056 GCTTGACCCAGGATGGGGAATGG - Intronic
1008989824 6:57589229-57589251 TCCTGACCACAGAAAGGAAAGGG - Intronic
1009178406 6:60487773-60487795 TCCTGACCACAGAAAGGAAAGGG - Intergenic
1013176936 6:107685903-107685925 TGGTGATCACAGATGGGGAAGGG - Intergenic
1013516744 6:110894338-110894360 TCTATACCCCAGATGGGGAATGG + Exonic
1013630873 6:111984689-111984711 TCTTCACCACAGCTCAGGAAGGG + Intergenic
1017861908 6:158406248-158406270 TCTGGCTCACAGATGAGGAAAGG - Intronic
1022760733 7:33347008-33347030 TCTTAACCACAGTTGGTTAAAGG + Intronic
1023017329 7:35981411-35981433 TCTTGACCAGAGAAGGGAATGGG + Intergenic
1023028892 7:36076210-36076232 CCTTGACGACAGATAGGGAGGGG - Intergenic
1023123416 7:36932173-36932195 TCCTGTCCACACATAGGGAAGGG + Intronic
1023737290 7:43246586-43246608 TCTTATTCACAGATGTGGAAAGG - Intronic
1026223354 7:68419371-68419393 TCTTGTCAAGAGGTGGGGAAGGG - Intergenic
1028709848 7:93894290-93894312 CTATGACCACAGATGGAGAAAGG + Intronic
1030864150 7:114678208-114678230 TATTGAGCAGAGATGAGGAAAGG + Intronic
1032363187 7:131274976-131274998 TCTTGACCAGAGATGGAAAGTGG - Intronic
1032562014 7:132902089-132902111 TTTTGACAAGAAATGGGGAAAGG - Intronic
1034528555 7:151681386-151681408 TCTGGACTACAGAGGGGGAAGGG + Intronic
1034536640 7:151729549-151729571 TCTTGAGCACCGATGGGCTAAGG - Intronic
1035797366 8:2370678-2370700 ACAAGACCACAGATGGAGAAGGG - Intergenic
1036578596 8:10052378-10052400 TTTTTTCCACAGATGGGGAAGGG - Intergenic
1036741252 8:11363757-11363779 TCAGGACCACAGATGTGGGAAGG - Intergenic
1039695211 8:39903225-39903247 TCATTACCACAGATGGCGCAGGG - Intronic
1039709494 8:40041631-40041653 TTTTGTCTAAAGATGGGGAAGGG + Intergenic
1040716346 8:50257396-50257418 TCTGCACCACACATGGGGACAGG - Intronic
1044031064 8:87238209-87238231 TCTTGGCCAGAGTGGGGGAAAGG + Intronic
1046028816 8:108758386-108758408 TCTTGACCTCAGTTGGGTGAAGG + Intronic
1047780297 8:128105588-128105610 TCTTGGGCACATTTGGGGAAAGG - Intergenic
1051372803 9:16372672-16372694 CCTTTTCCTCAGATGGGGAAAGG + Intergenic
1055804486 9:80077210-80077232 TCTTGACCACAGCTTGGAAGAGG - Intergenic
1055912413 9:81367775-81367797 TCTTGAGGACAGAGGGTGAAAGG + Intergenic
1059155247 9:111983597-111983619 ACTTGGCCATAAATGGGGAAAGG - Intergenic
1060424507 9:123493282-123493304 GGTTGCCCACAGATGTGGAATGG - Intronic
1186587782 X:10894743-10894765 TCTTGACCACAGAAAAGGAAGGG + Intergenic
1187549704 X:20289889-20289911 TTGTGACAAAAGATGGGGAATGG + Intergenic
1189222178 X:39381906-39381928 TCTGGAGCACAGAGAGGGAAGGG + Intergenic
1190713150 X:53083535-53083557 ACTGGACCACAGATGGGAAAGGG + Intronic
1192362534 X:70448767-70448789 TCTTGGCCACAGATGAGGACAGG - Intronic
1192496976 X:71622699-71622721 CCTTGACCACAGGTGGGGCCCGG - Intergenic
1192804199 X:74495308-74495330 TCTTGTCCTCAGCAGGGGAAAGG + Intronic
1193105930 X:77671875-77671897 TCTTGACCATAGAAGGACAAAGG + Intronic
1194196886 X:90905011-90905033 TCTTGATCACAGAAGGGGCAAGG + Intergenic
1194679624 X:96836228-96836250 TCTTAACCACAGAGGTGGTAAGG + Intronic
1195428595 X:104762720-104762742 TCTTGACCAGAAATCAGGAAGGG - Intronic
1196160668 X:112479078-112479100 TGTTTACCAGAGATTGGGAAGGG - Intergenic
1199745514 X:150769849-150769871 TGATGACCACAGAAGGGGGAGGG + Intronic
1200542735 Y:4479217-4479239 TCTTGATCACAGAAGGGGCAAGG + Intergenic