ID: 958880630

View in Genome Browser
Species Human (GRCh38)
Location 3:99665104-99665126
Sequence CTGAGAAATGGCAACATGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 310
Summary {0: 1, 1: 0, 2: 3, 3: 21, 4: 285}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958880630_958880633 -8 Left 958880630 3:99665104-99665126 CCTTCCATGTTGCCATTTCTCAG 0: 1
1: 0
2: 3
3: 21
4: 285
Right 958880633 3:99665119-99665141 TTTCTCAGACTAGAAGTCCAAGG 0: 1
1: 0
2: 3
3: 23
4: 224
958880630_958880634 -2 Left 958880630 3:99665104-99665126 CCTTCCATGTTGCCATTTCTCAG 0: 1
1: 0
2: 3
3: 21
4: 285
Right 958880634 3:99665125-99665147 AGACTAGAAGTCCAAGGAGCAGG 0: 1
1: 0
2: 2
3: 23
4: 340
958880630_958880635 5 Left 958880630 3:99665104-99665126 CCTTCCATGTTGCCATTTCTCAG 0: 1
1: 0
2: 3
3: 21
4: 285
Right 958880635 3:99665132-99665154 AAGTCCAAGGAGCAGGTGCCAGG 0: 1
1: 0
2: 3
3: 38
4: 289

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958880630 Original CRISPR CTGAGAAATGGCAACATGGA AGG (reversed) Intronic
900398166 1:2461814-2461836 TTGGGGAATGGCACCATGGAAGG + Intronic
901194629 1:7433489-7433511 CTGAGAAGTGGGTACCTGGAGGG - Intronic
902606293 1:17571171-17571193 CTGGGAACTGCCAACCTGGAGGG + Intronic
902748376 1:18488845-18488867 CTGAGAAAATGCGAGATGGAGGG + Intergenic
903653028 1:24932534-24932556 CTGAGACCTGGCCGCATGGATGG - Intronic
903945889 1:26962228-26962250 ATGAAAAATAGCAACATGGTTGG + Intergenic
905348606 1:37328688-37328710 CTGAGGAATGGCACCTGGGAGGG - Intergenic
907231427 1:53003034-53003056 CTGGGCAATGGAAACAAGGATGG - Intronic
907754922 1:57302086-57302108 CTGTAAAATGGATACATGGATGG + Intronic
907834082 1:58092818-58092840 CTGAGGAATGGCACGGTGGATGG - Intronic
910207118 1:84759240-84759262 ATAAGAAATGGCAATCTGGACGG + Intergenic
910371584 1:86522483-86522505 CTGAGAAAAGCCAACATTTAAGG + Intergenic
911312698 1:96315253-96315275 CTGAGAAATGCCAACACCTATGG + Intergenic
912721070 1:112020679-112020701 AGGAGAAATGGCAGCATGTATGG - Intergenic
913333735 1:117688515-117688537 CTGAGACATGAAAACATGGATGG - Intergenic
917647247 1:177041268-177041290 CTGAGAGATGACATCATGGATGG + Intronic
918264818 1:182831879-182831901 CTGAGAAATGGCTATCTGGGTGG + Intergenic
919963978 1:202502697-202502719 ATCAGAAGTGCCAACATGGAAGG + Intronic
920755506 1:208727220-208727242 CTGAGATCAGACAACATGGAAGG + Intergenic
920824481 1:209412688-209412710 GTGACAAATAGCAATATGGAGGG + Intergenic
921252715 1:213312426-213312448 CTGAGAAATTGGCACCTGGAAGG + Intergenic
921542518 1:216433581-216433603 CTGAGAAAAAGCCACAAGGATGG + Intergenic
921814691 1:219550186-219550208 CTGAGAAAAGGCCACCTGGAGGG - Intergenic
923925496 1:238622292-238622314 AGCAGAAATGACAACATGGAAGG - Intergenic
1063044679 10:2379661-2379683 CTAGGAAATGGCAACAAGAAGGG + Intergenic
1063995626 10:11615969-11615991 CTAAGAGATGGCCAAATGGATGG - Intergenic
1065421739 10:25552325-25552347 ATAAGAAATGGAAACCTGGAAGG - Intronic
1065719761 10:28615402-28615424 CAGAGCAATGGCAACATTGCTGG - Intronic
1067825831 10:49572260-49572282 CAGAGAACTGGCAGCATGGGTGG - Intergenic
1068063024 10:52093334-52093356 CTGACAAATGGAAAAATGCAAGG - Intronic
1068273382 10:54759076-54759098 CTGAGAAGTAGTAAGATGGAGGG - Intronic
1068517742 10:58044954-58044976 CTGAGAAATGGGGACTAGGAAGG + Intergenic
1068734443 10:60396275-60396297 CTGGGGAATGTAAACATGGAAGG - Intronic
1070131152 10:73656206-73656228 AGGAGAATTGGGAACATGGAGGG - Intronic
1070447720 10:76523800-76523822 TTGGGAAATGGCAGCAGGGAAGG - Intronic
1072543871 10:96419274-96419296 TTGAGAAATTGCAACTTGAAAGG + Intronic
1073596465 10:104805381-104805403 CTCAGAAATGGAAAAATGCAAGG + Intronic
1073847943 10:107580394-107580416 CTGAGAAATGGTAAAATTAATGG - Intergenic
1075566772 10:123510745-123510767 CTAAGCAATGGCAGCAAGGAAGG - Intergenic
1075837114 10:125463363-125463385 CTTCCAAATGGCAACATGGTTGG + Intergenic
1077919004 11:6629578-6629600 CTGAGGAGGGGCAGCATGGAGGG + Intronic
1078156276 11:8802704-8802726 CTGAGAAAAGGAAACAGTGATGG + Intronic
1080196574 11:29616907-29616929 CTGAAAAATGGGAACAGGCAAGG - Intergenic
1081148262 11:39593258-39593280 ATGAGACATGGCAAAATGGTAGG + Intergenic
1083601665 11:63952502-63952524 GTGAGAAAAGGCAACAGGGACGG - Exonic
1083748891 11:64750469-64750491 CTGACCATTGGCACCATGGACGG - Exonic
1084775380 11:71371352-71371374 CAGAGGATTGGAAACATGGACGG - Intergenic
1085310306 11:75512518-75512540 CTGAACAATGGCAACATGGACGG - Intronic
1088086313 11:105984805-105984827 CTGAGTAATAGCAACATGTAAGG - Intergenic
1088299512 11:108341322-108341344 GTGGGTAATGGCAACATGGTCGG - Intronic
1090521209 11:127481376-127481398 CAGAGAAAGGGAAAAATGGAAGG - Intergenic
1091409932 12:232695-232717 CTGAGAAATGGGAGAAGGGAAGG + Intronic
1091676532 12:2494999-2495021 CTGAGTAATGGCAGTATGGCTGG + Intronic
1093031307 12:14291673-14291695 CTGTGAAAGGCCAACATGGGTGG - Intergenic
1093949172 12:25144942-25144964 CTGAGTAATATCAACATTGAAGG - Intronic
1094760622 12:33528351-33528373 CTGAAAAATGGAAACATCTAGGG + Intergenic
1097742336 12:63258117-63258139 CTTAGAAATGTCACCCTGGAAGG + Intergenic
1097840236 12:64314491-64314513 ATGAGAAATGGCAACACTAAAGG - Intronic
1099981055 12:89603349-89603371 ATCTGAAATGGCAGCATGGAAGG + Intronic
1104724336 12:131066734-131066756 CTGAGGAGTGGCCACGTGGATGG + Intronic
1107502855 13:40998181-40998203 ATGAGAAATGAAAATATGGAAGG + Intronic
1107832172 13:44384228-44384250 CAGAGAGGTGGCAACAGGGACGG - Intronic
1108227159 13:48302011-48302033 CTGATAAATTGAAACAGGGATGG - Intergenic
1108973700 13:56409283-56409305 TTCAGTAATTGCAACATGGATGG + Intergenic
1109230202 13:59747606-59747628 CTGAGAAATATCAAGCTGGAAGG + Intronic
1109499889 13:63220488-63220510 CTTAAAAATGGCAAAATTGATGG - Intergenic
1109675278 13:65667125-65667147 CTGAGAAATAGAAACAAGGTTGG - Intergenic
1109741780 13:66563206-66563228 CTGGGAAATGGAAACAGGGCAGG - Intronic
1111589394 13:90324058-90324080 CTAAGAAATAACAACAAGGAAGG - Intergenic
1111607798 13:90563489-90563511 CTTGGAAATGTAAACATGGAAGG - Intergenic
1112655652 13:101450029-101450051 CTGAAAACTGGGAAAATGGAAGG + Intergenic
1114533529 14:23409597-23409619 CTGAGAGATGGCAGCATTGGAGG - Intergenic
1115160705 14:30390331-30390353 CTCGGTAATGGCAACCTGGAAGG - Intergenic
1115342149 14:32304362-32304384 CTGACAAATGTCCACAGGGAAGG + Intergenic
1115391708 14:32861423-32861445 CTGACAAATAGCAAAATAGATGG - Intergenic
1117933713 14:60876725-60876747 TTGACATATGACAACATGGATGG - Intronic
1117999164 14:61506779-61506801 CTGAGAAGAGGCTTCATGGATGG - Intronic
1118651131 14:67895763-67895785 AAGAGAAATGACAACATGGGAGG - Intronic
1120671538 14:87368091-87368113 CTGAGGCATGGCACCAAGGATGG + Intergenic
1121049262 14:90809577-90809599 CTGAGAAATGGCGTCCTGCAAGG - Intronic
1124250631 15:28104606-28104628 CTGAAAAATTGGAACAAGGAAGG - Intergenic
1124356584 15:28999933-28999955 CTGAGAACCAGCAGCATGGAGGG + Intronic
1124927787 15:34088644-34088666 TTCAGAAATGAGAACATGGAAGG + Intronic
1131615118 15:94008101-94008123 CTGAAAATTGGCCACATGGCAGG - Intergenic
1134342678 16:13359536-13359558 CTCAGAACTGGCAGCATGGTAGG + Intergenic
1137915533 16:52425976-52425998 AAGAGAAAAGTCAACATGGAAGG + Intergenic
1137956359 16:52834716-52834738 CTGATCACTGGAAACATGGAAGG + Intergenic
1137973961 16:53014671-53014693 CTGATAAATGAAATCATGGATGG + Intergenic
1139073432 16:63413515-63413537 ATGTGAAATGTCAGCATGGAGGG + Intergenic
1139560626 16:67739449-67739471 CAGAGAAGTGGAAACAGGGAGGG + Intronic
1140019150 16:71220738-71220760 CTTAGAAATGTAAACATGAAAGG - Intronic
1140639629 16:76957097-76957119 CTGGGAAATGTGCACATGGAGGG + Intergenic
1140873130 16:79125110-79125132 CTGAGAAATGGATAGAGGGATGG - Intronic
1140952500 16:79832793-79832815 CTGAGAAATGGGACCCTGGGTGG + Intergenic
1141308987 16:82894880-82894902 CTGAGAAATGCCAAGAAGGAAGG + Intronic
1141492311 16:84382472-84382494 CTGAGAGATGGCAAAAGGCAGGG - Intronic
1141993325 16:87622419-87622441 CTGAGAAATGGGAACACAGCTGG - Intronic
1144183285 17:12772428-12772450 CTGAGGAATGCCAACATTTAAGG + Intergenic
1146207318 17:30915979-30916001 CTGAGATATGGCCACATAGCTGG - Intronic
1147471721 17:40668560-40668582 CTAGGAAATTGCAAGATGGAAGG + Intergenic
1147840555 17:43368775-43368797 TTGAGAAATGGCTAGAGGGACGG - Intergenic
1147955409 17:44131055-44131077 CTGAGAGATGGCAGCATGATTGG + Intergenic
1149679255 17:58493680-58493702 CTGAGTAGTTGCAACATAGACGG + Intronic
1151005012 17:70425027-70425049 CTGGAAAATGTCAACATGCAAGG - Intergenic
1152056991 17:78037121-78037143 CTAAGAAATGGCAAAATGTGTGG - Intronic
1152292427 17:79447729-79447751 CTGAGCAATGCTCACATGGATGG - Intronic
1153992372 18:10411930-10411952 CTGACAAATGGAAATATCGAAGG - Intergenic
1155345613 18:24853741-24853763 CTGAGAAAAGCCAACCTGGGAGG - Intergenic
1156550612 18:38012423-38012445 CTGAGCAAAGGCCACATGGACGG + Intergenic
1156697755 18:39787936-39787958 CTGAGGAAAGGCTACATGAAGGG + Intergenic
1157787933 18:50502805-50502827 CTGTGAGATGGCAGCATGGTTGG - Intergenic
1158235527 18:55308901-55308923 CTGGGAAATGGAAGCATTGAGGG - Intronic
1158337902 18:56433738-56433760 GTGAGAAAATGCAACAGGGAAGG + Intergenic
1159598497 18:70406224-70406246 GTGAGAAATGGGGAGATGGAGGG + Intergenic
1162592618 19:11602529-11602551 ATCAGAAATGGCGAAATGGAAGG - Intronic
1164883880 19:31760522-31760544 CTGAGAGAAAGCCACATGGAAGG - Intergenic
1165286304 19:34845221-34845243 CTGATAACAGGCAACATGGATGG - Intergenic
1167177308 19:47873987-47874009 CTGAGAAATGAGGACAAGGACGG - Intronic
1167979803 19:53265510-53265532 CAGAGAAATGGCTATATTGAGGG - Intergenic
1168193909 19:54759185-54759207 CTGAGCAAAGTCAGCATGGAGGG - Intronic
1168195955 19:54773910-54773932 CTGAGCAAAGTCAGCATGGAGGG - Intronic
1168197852 19:54788773-54788795 CTGAGCAAAGTCAGCATGGAAGG - Intronic
1168201743 19:54820295-54820317 CTGAGCAAAGTCAGCATGGAAGG - Intronic
1168204322 19:54838149-54838171 CTGAGCAAAGTCAGCATGGAAGG - Intronic
1168206549 19:54854329-54854351 CTGAGCAAAGTCAGCATGGAAGG - Intronic
928405125 2:31008931-31008953 ATGAGAAATGGCTCCCTGGAGGG + Intronic
928644111 2:33333896-33333918 CTGAGAAATGCCAACATATAGGG + Intronic
929709577 2:44252623-44252645 CTGAGAAATGGCAAAGGTGATGG + Intergenic
929848132 2:45554489-45554511 CTCAGAAATGGCAAGAGGCAAGG - Intronic
930340284 2:50104576-50104598 CTGACACATGGCAAGAAGGATGG - Intronic
931292775 2:60890455-60890477 CTGAGAAATGGTAACACAGTGGG - Intronic
932443285 2:71752219-71752241 CTGAGAAATGGCACAACAGAGGG + Intergenic
933382223 2:81563412-81563434 GTGACAAATAGCAACATGAATGG - Intergenic
933471584 2:82732755-82732777 CTGAGAAAAGGCAAGATGAGAGG + Intergenic
933840498 2:86282462-86282484 CTGTGGTCTGGCAACATGGAAGG + Intronic
933973635 2:87490406-87490428 ATGAGCACTGGAAACATGGAGGG + Intergenic
934103435 2:88674845-88674867 CTGAGAAATGGAGCCAGGGAAGG - Intergenic
934856177 2:97731785-97731807 CTGAGAATTTGCACCTTGGAGGG + Intronic
935229649 2:101084571-101084593 CTGAGGAACGGCTGCATGGAAGG - Intronic
935373177 2:102368600-102368622 GTGAGAGAGGGCAACACGGAAGG + Intronic
935542064 2:104360541-104360563 TTGAGTAATGGAAACATGGAGGG + Intergenic
935737858 2:106120499-106120521 GTGAGAAATGGCACCGAGGAAGG - Intronic
936320092 2:111459807-111459829 ATGAGCACTGGAAACATGGAGGG - Intergenic
937082845 2:119152712-119152734 CTGGGAAATGGCAAGCTGAAGGG + Intergenic
937091704 2:119210872-119210894 CTGAGAAACAGCCATATGGAGGG + Intergenic
937571040 2:123361966-123361988 CTGAGAAAAGACAGCATGGATGG - Intergenic
938857817 2:135333185-135333207 CAGAGAAATGGAAAAATAGAGGG - Intronic
942239454 2:173946227-173946249 CTGGGAAAGGGGTACATGGAAGG + Intronic
942719228 2:178931434-178931456 CTGAGGAATGGCTAAATGAAAGG + Intronic
943002444 2:182345475-182345497 GTGAGATAGGGAAACATGGATGG - Intronic
943789542 2:191916962-191916984 CATAGAAATGGGAACATAGAAGG + Intergenic
946122294 2:217526653-217526675 ATCAGAAATGGCAAAATGGCAGG - Intronic
946122447 2:217528262-217528284 ATCAGAAATGGCAAAATGGCAGG - Intronic
946729280 2:222692751-222692773 CTAAGAAATAGCAGCATTGAAGG + Intronic
947520201 2:230839697-230839719 CTGGGAGAAGGCAGCATGGATGG + Intergenic
948533180 2:238626523-238626545 CTGAGAAAGGAGAACAAGGAGGG - Intergenic
1169748352 20:8965626-8965648 CAGAGAAATGGCCATATGGAAGG - Intronic
1171088979 20:22266534-22266556 CTGAGAAGTCCCATCATGGAGGG - Intergenic
1172382547 20:34507798-34507820 CTGAGAACTTGCACCATGAATGG + Exonic
1174944452 20:54970045-54970067 CTAAGACATGGCAGCATGGTAGG - Intergenic
1175119593 20:56707847-56707869 CTGAGGAATGCCAGGATGGATGG - Intergenic
1175281198 20:57805145-57805167 GTGTGAAATGGGAACATGGCAGG - Intergenic
1178994651 21:37387722-37387744 CTGAGAAAAGGGTACATGGGAGG + Intronic
1180975541 22:19845885-19845907 TTGAAAAATGGGGACATGGATGG + Intronic
1182083270 22:27543881-27543903 CTGAGAGTTGGCAACAGGGAGGG - Intergenic
1182952927 22:34394614-34394636 GAGAGAAATTTCAACATGGAAGG - Intergenic
1183133073 22:35858505-35858527 GTGAGAAATAGGAAGATGGATGG - Intronic
1183719773 22:39555953-39555975 TAGAGAAATGGCATCAAGGAGGG - Intergenic
1184521623 22:44997893-44997915 CTGAGAGATGGCAATTTGGAAGG - Intronic
949104010 3:181719-181741 CTGGGAAATGGGAACAATGATGG - Intergenic
949263539 3:2130887-2130909 CTAAGAAATGTCAACATGCTTGG - Intronic
950049886 3:9979903-9979925 CTGAGAAAAGGCCACATGACTGG + Intronic
950567887 3:13781952-13781974 CTGAGGCTTGGAAACATGGAAGG + Intergenic
951626161 3:24665474-24665496 CTGAAAAATGGAAATATAGAGGG - Intergenic
952256053 3:31696684-31696706 CTGGGATATTCCAACATGGAGGG - Intronic
953136124 3:40183205-40183227 CGGAGAAATGGCATCCTGGCTGG + Intronic
953459870 3:43073595-43073617 CTGACACATGGACACATGGAGGG - Intergenic
955285416 3:57636494-57636516 CAGAGAAATGACAATATGGAGGG + Intronic
956109530 3:65856624-65856646 CTGAGATATGTCAGAATGGAGGG - Intronic
956617647 3:71188981-71189003 CTGCAAAATGTCCACATGGAAGG + Intronic
956887050 3:73570725-73570747 CTGATACATTGCCACATGGATGG - Intronic
957849828 3:85793117-85793139 ATGACAGATGGCAACATTGAAGG + Intronic
957936576 3:86951647-86951669 AATAGAAATGGCAACATGGTAGG + Intronic
958880630 3:99665104-99665126 CTGAGAAATGGCAACATGGAAGG - Intronic
961015229 3:123463115-123463137 CTGATAAATAACAACATGAATGG + Intergenic
962159392 3:132982868-132982890 CTGAGGCATGGGAAAATGGAAGG + Intergenic
962215592 3:133518351-133518373 GTGAGAACAGGCACCATGGAGGG - Intergenic
963507321 3:146203160-146203182 CTGAGAAATGACACCATCTATGG + Intronic
963642097 3:147873551-147873573 TTGAGATGTGGGAACATGGAGGG - Intergenic
964390051 3:156187204-156187226 CTGAGAAATACCAAGGTGGAGGG - Intronic
967014072 3:185465929-185465951 CTGAGTAGCAGCAACATGGAAGG - Intronic
968639208 4:1702806-1702828 CTCAGAAATGCCAACATACAAGG - Intronic
968856993 4:3133032-3133054 CTGAGAGATGGATACATGGTGGG - Intronic
969253652 4:5988342-5988364 CTGAGCAATGGCCCCATGGTAGG - Exonic
969424850 4:7118194-7118216 CTGAGGAATGGAGAGATGGATGG + Intergenic
970614805 4:17759124-17759146 CTGAGAACCGGCAAGATGTATGG - Intronic
971160079 4:24124937-24124959 CTGAGAAATTGCAAGATCCAGGG - Intergenic
971453664 4:26823360-26823382 CTGAGGAATAGGTACATGGATGG - Intergenic
972240717 4:37188902-37188924 CTGAGAAATAGCTATATGAATGG + Intergenic
973697980 4:53509445-53509467 CATAGAAATGGCAAGATGGAAGG + Intronic
973968330 4:56186133-56186155 CAGAGAAATGGGAAACTGGATGG + Intronic
975972331 4:80055388-80055410 CTGACAGATGGCAAGTTGGACGG - Exonic
976348780 4:84036192-84036214 CTGAGAAATGGCAGCACTTAGGG + Intergenic
977604563 4:98969971-98969993 CTGAGATAAAGCAAAATGGATGG + Intergenic
978020929 4:103810559-103810581 CTGTGAGATGGCAACCTGGCTGG - Intergenic
978502684 4:109425898-109425920 CTGTGAGATAACAACATGGAAGG - Intergenic
978949929 4:114545773-114545795 ATGAGAGATGGCAAGGTGGAAGG + Intergenic
979003902 4:115263911-115263933 CTGAGAAATAGTACAATGGATGG + Intergenic
979178729 4:117698528-117698550 CTGAAAGATGGGAGCATGGAAGG + Intergenic
979809477 4:125017626-125017648 CTGACAATTGGCAATATGAATGG - Intergenic
980437473 4:132796575-132796597 CTGAGAGATGGCAGAGTGGAAGG + Intergenic
982934591 4:161456107-161456129 CTGAACAATAGCAAAATGGAAGG + Intronic
984505955 4:180618961-180618983 CTGAGAATACCCAACATGGAGGG - Intergenic
986123023 5:4860040-4860062 CAGAGAACTAGCAGCATGGAGGG + Intergenic
986210730 5:5668931-5668953 CTGAAATTTGGCAACATGAACGG + Intergenic
986834285 5:11617425-11617447 CTAAAATATGGCAACATAGAAGG - Intronic
988142963 5:27266952-27266974 CTCAGTGATGCCAACATGGAGGG - Intergenic
992142110 5:73808896-73808918 CTGAGACATGGCAATGTGCAAGG - Intronic
992622880 5:78610825-78610847 TTGAAAAATGGCCACATGCATGG + Intronic
994426730 5:99599032-99599054 CTGAAAAATGGCTAAATGTAAGG + Intergenic
994741196 5:103621657-103621679 CTCAGTATTGGCAGCATGGAAGG + Intergenic
998791988 5:145775637-145775659 TTGTGTAATGCCAACATGGAGGG + Intronic
998842976 5:146275977-146275999 CTAATAAAAGGCAACATGGTAGG - Intronic
998975736 5:147644771-147644793 CTGAGAAATGGCAATAAGTCAGG + Intronic
999370130 5:151049894-151049916 ATGAGCAATGGCAACAAAGAGGG - Exonic
1000285929 5:159826236-159826258 CTGAGAAATGGGAGACTGGAGGG - Intergenic
1000477537 5:161729846-161729868 ATGAGAAATGGCAAAGAGGAGGG + Intergenic
1002663957 5:180809714-180809736 CTGAGAAATGGGAACACTGTGGG - Exonic
1002884885 6:1284746-1284768 CTGAGAAAATGCAACATTCATGG + Intergenic
1004071799 6:12305494-12305516 CTGAGAAATGGCTAACTGCAAGG - Intergenic
1009662003 6:66625707-66625729 CAGAGAAATTGCAACTTAGATGG - Intergenic
1010296045 6:74197033-74197055 CTGAGGAATGCCAACATTTAAGG - Intergenic
1011208696 6:84930554-84930576 CTGAGAGATGACAGCAGGGAAGG - Intergenic
1012355360 6:98307708-98307730 CTGCAACATGGAAACATGGATGG - Intergenic
1012603850 6:101132636-101132658 CTTAGAAATGGCAAGAGGTAAGG + Intergenic
1012660837 6:101888696-101888718 CTGAGACAAGAAAACATGGAGGG + Intronic
1012958335 6:105594617-105594639 CTGTGAAATAGCAAAATGGAGGG + Intergenic
1014409184 6:121093183-121093205 CTCCCAAATTGCAACATGGAGGG + Intronic
1014498282 6:122155263-122155285 CTTAGAGATGGAAACATGGTTGG + Intergenic
1016571564 6:145519345-145519367 GTGAGGAGTAGCAACATGGAGGG + Intronic
1016711153 6:147173433-147173455 CTCAGTAATGCCAACATAGATGG + Intergenic
1017210843 6:151854221-151854243 CTGAAAAATAACAACATGTAAGG + Intronic
1017258438 6:152360662-152360684 TTGAGAAATTGCTACATGTAGGG - Intronic
1017898184 6:158699454-158699476 CTGAGAAATGGATGCATAGATGG + Intronic
1018147628 6:160907514-160907536 CTGAGAAAAGGCAATCTGTAAGG + Intergenic
1018342551 6:162867351-162867373 GGGAGAAATGGCAACAGGGATGG - Intronic
1018579760 6:165298333-165298355 CTAAGAAATGGAAAGATGGTAGG + Intronic
1019255119 7:44746-44768 CTGTGAAATGGGAACAGGAATGG - Intergenic
1021315559 7:19144268-19144290 CTGAGGAAAGGAAAAATGGAAGG - Intergenic
1022358474 7:29638052-29638074 CTGAGATCTGGGAACAAGGAGGG + Intergenic
1022660936 7:32365596-32365618 CTGAGAAATAGCCCCATGGGCGG + Intergenic
1023528434 7:41129437-41129459 CTGAGAACAGGCTACAGGGATGG - Intergenic
1026953985 7:74365376-74365398 CTGAGTAAGGGGCACATGGATGG - Intronic
1027359408 7:77392718-77392740 CTGTGAAATGGTGACAAGGATGG + Intronic
1031086352 7:117305192-117305214 CTGAAAAATGGACAAATGGATGG - Intronic
1031522234 7:122780010-122780032 TTAGAAAATGGCAACATGGAAGG - Intronic
1032607030 7:133366895-133366917 CTGGCAAAAGGCAACATGGCCGG + Intronic
1035173406 7:157033504-157033526 CTGAGAAATGACAATGTGGGTGG + Intergenic
1036702618 8:11023179-11023201 CTAGGAAATGGGGACATGGAGGG - Intronic
1039562894 8:38527378-38527400 CTGTGAAATGGCCACCAGGAAGG + Intronic
1039831472 8:41218610-41218632 CTGGGCTAGGGCAACATGGATGG + Intergenic
1040646612 8:49404125-49404147 CTGAGAAATGGTGACACTGAAGG - Intergenic
1041573656 8:59367963-59367985 TTGAGAAAAGCCAAAATGGATGG - Intergenic
1042346279 8:67731354-67731376 CTGAGAAATAGCAAAAAGTAAGG - Intronic
1042848546 8:73192382-73192404 CTGAAAAATGGGAAAATGGCTGG + Intergenic
1043874907 8:85474962-85474984 CTGAGAAACTGCAAAATGTAAGG + Intronic
1044391459 8:91657221-91657243 CTGAGAAATAGCAATATTTAAGG - Intergenic
1044728063 8:95208871-95208893 GTGAGAAAAGGAAAGATGGAGGG - Intergenic
1047006048 8:120621451-120621473 GTGAGAAATGGGAAAGTGGAGGG + Intronic
1047133373 8:122048125-122048147 CTGAGAAATGGTAACTTGATGGG - Intergenic
1047421394 8:124710829-124710851 CAGAGAAAGGGCAACTTGGGAGG + Intronic
1047609277 8:126505157-126505179 ATGTGGAATGGCAACAGGGAAGG + Intergenic
1048726313 8:137388949-137388971 TTGAGAAATGGCAAAAAGGTTGG - Intergenic
1048753015 8:137700682-137700704 CTGAAAAATGGAAGCATGAATGG - Intergenic
1049329098 8:142040307-142040329 CCGAGAAATGGCAAGCTGGAGGG - Intergenic
1050600309 9:7243740-7243762 TTGAGGAATGGCAGCATGGTGGG + Intergenic
1051264921 9:15300919-15300941 CTAAAAAATGGGAACCTGGAAGG - Intronic
1051343865 9:16135183-16135205 CTGAGATATGGAAATATTGAGGG + Intergenic
1051814153 9:21085691-21085713 CTGAGAGATTGCATCATGAATGG + Intergenic
1052530181 9:29673246-29673268 CTGAGATATGGCACCATGGCAGG - Intergenic
1054801465 9:69353931-69353953 CTGGGCAATGGGTACATGGAGGG - Intronic
1054883954 9:70175451-70175473 CTGAAAAATGGCAAAGTGTAAGG + Intronic
1055016093 9:71619673-71619695 CTGATAAATGGCCACAGTGAAGG - Intergenic
1055263451 9:74467191-74467213 CTGAGAAATGGACAAATGGCTGG + Intergenic
1055958343 9:81795285-81795307 TTCAGAAATGGCATCAGGGAAGG + Intergenic
1057092489 9:92271656-92271678 CTGAGAAAAGGCAAAAGAGAGGG + Intronic
1058069327 9:100585628-100585650 CTAAGAAATGGTAACATTTAAGG + Intronic
1058113008 9:101052578-101052600 ATGAAAAAAGGCAACATAGAGGG - Intronic
1058668854 9:107343912-107343934 ATGAGCAATGACAACATGGCGGG - Intergenic
1059700499 9:116771307-116771329 CTGAAAAATGGGAACATGGAGGG - Intronic
1060654450 9:125359708-125359730 TTGAGAAGTGGCATCAAGGAAGG - Intronic
1060693391 9:125684977-125684999 CAGTGAAATGGGCACATGGAGGG - Intronic
1061723817 9:132570496-132570518 CTGAGAAATGCTGCCATGGAGGG + Intronic
1062128607 9:134880483-134880505 CTGAGAACGGGGAACAAGGAAGG - Intergenic
1186014305 X:5173825-5173847 CTGAGTAATGGCTCCTTGGATGG + Intergenic
1186782968 X:12931610-12931632 GTGGGCAATGGGAACATGGAAGG - Intergenic
1189549578 X:42078913-42078935 GTAAGAAATGGGAACATGGTAGG - Intergenic
1193136347 X:77975195-77975217 CTTAGAAATGGCAACTGGTATGG - Intronic
1193240876 X:79167615-79167637 CTGAGAAAAGGCAATATGACTGG + Intergenic
1194248688 X:91545630-91545652 TTGTGAAATGGAAACATAGATGG + Intergenic
1194772402 X:97921439-97921461 CTGCGAGATGGCAACCTGGCTGG + Intergenic
1195488552 X:105439217-105439239 CTCACAAATGGCAACAGGGTAGG - Intronic
1197231197 X:124005627-124005649 CTGAAATATAACAACATGGATGG - Intronic
1197237956 X:124089527-124089549 GTGAGAAATGGCAACAGGGATGG - Intronic
1198952462 X:142087171-142087193 CTGAGAGATGGCATCATGAGAGG - Intergenic
1199673003 X:150162176-150162198 CTGAGGAATGGCAATAGGGAAGG + Intergenic
1200243709 X:154511608-154511630 CTGCAAAAGGGCAACTTGGAAGG - Intronic
1200567694 Y:4787149-4787171 TTGTGAAATGGAAACATAGATGG + Intergenic
1202299625 Y:23398542-23398564 ATCAGAAGTGCCAACATGGAAGG + Intergenic
1202571184 Y:26272056-26272078 ATCAGAAGTGCCAACATGGAAGG - Intergenic