ID: 958880831

View in Genome Browser
Species Human (GRCh38)
Location 3:99667052-99667074
Sequence ATGAAGAAACAGATTCAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 942
Summary {0: 1, 1: 3, 2: 26, 3: 135, 4: 777}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958880831 Original CRISPR ATGAAGAAACAGATTCAGGA AGG Intronic
900467230 1:2831689-2831711 AGGAAGCATCAGCTTCAGGAAGG + Intergenic
900864864 1:5261039-5261061 ATGAAGAAACTGACGCAGGGTGG + Intergenic
901624002 1:10613254-10613276 ATAAAGAAACAGAGTCATGTTGG + Intronic
901859781 1:12066947-12066969 ATGAAAAAAGAACTTCAGGATGG - Intronic
902083740 1:13840237-13840259 ATGAGGAAACAGTTTCAATATGG + Intergenic
902405179 1:16178918-16178940 TTGAAGAAACAGGCTCAGGGAGG - Intergenic
902767088 1:18624343-18624365 AGGAAGAAATAGACTCAGGGAGG - Intergenic
902914842 1:19631033-19631055 ATGAAGAAACAGTTTTTGGAAGG + Intronic
903091877 1:20927617-20927639 AAGAAGAGACAGATCCAGAAGGG + Intronic
903259465 1:22123464-22123486 CTGAAGGAAGAGATTCTGGAAGG + Intronic
903289439 1:22298665-22298687 GTGAAGAAACAGGTTCAGACAGG + Intergenic
903423169 1:23233290-23233312 ATGAGGAAACAGATTTAGAGAGG + Intergenic
903558625 1:24211388-24211410 ATGAAGAAAGTGAGTCCGGAGGG + Intergenic
903610728 1:24610082-24610104 ATCAGGAAACAGGTTCAGCAAGG + Intergenic
904473590 1:30750748-30750770 ATGAGGAAACAGGCTCAGGAGGG - Intronic
904534707 1:31191502-31191524 TTGAAGAAATAGATTCAGAGAGG - Intronic
904698819 1:32346203-32346225 GGGAAGAAACAGCTTCCGGAAGG + Intergenic
904804816 1:33123487-33123509 ATGAGTAAACAGATTCAGACAGG - Intergenic
904940091 1:34159623-34159645 ATGAAGAAACAGGTTCAGAGAGG - Intronic
905291177 1:36922731-36922753 ATGAGGAAACAGGTTCCGGGAGG + Intronic
905295536 1:36952055-36952077 ATGCAGAAACAGGGTCAGCAAGG + Intronic
905986028 1:42283272-42283294 ATGAAGAAAAAAATTCTGTATGG - Intronic
906383171 1:45345676-45345698 ATGAAGAAACAGACTCAGAGAGG + Intronic
906750564 1:48255345-48255367 ATGAAGAAACAAACTCAGAGAGG + Intergenic
906754826 1:48301165-48301187 ATGAATAAACACATTTAGTAAGG + Intronic
907000032 1:50843239-50843261 ATGAAGAAAAAGAATTAGGTCGG - Intronic
907071085 1:51535508-51535530 ATGAAGAAATAGAAACAGTATGG - Intergenic
907076998 1:51587998-51588020 ATGAGGAAACAGGTTCAGAGAGG - Intronic
907355381 1:53868385-53868407 ATGAGGAAACTGAGACAGGAAGG - Intronic
907399708 1:54217375-54217397 CTGAAGACACAGAGTCAGGAGGG - Intronic
908136342 1:61137326-61137348 AGGAAAAAAGAGATTCAGAAAGG + Intronic
908576224 1:65462647-65462669 AGGAAGCAACAGATGCTGGAAGG - Intronic
908585654 1:65564572-65564594 ATTAAGAAACGGATTCACGGAGG - Intronic
908600598 1:65735061-65735083 GTGAAGAAAGTGATACAGGAAGG - Intergenic
908775358 1:67634343-67634365 ATAAAGAAACAGATTCAGAGAGG - Intergenic
908918260 1:69158043-69158065 CAGAAGAAACAGCTTCAGGAAGG - Intergenic
909661016 1:78082150-78082172 ATGTGGAAACAGGCTCAGGAAGG + Intronic
910265089 1:85330144-85330166 ATGCAGAGAAAGATGCAGGAAGG + Intronic
911052693 1:93684595-93684617 GGGAGGAAACAGACTCAGGAAGG + Intronic
911185775 1:94903369-94903391 GAGCAGAAACAGATTCTGGAGGG + Intronic
911261579 1:95692991-95693013 ATGAAGAAACAGCTCTAGAATGG - Intergenic
911573927 1:99551613-99551635 TTAAGGAAACAGATTCAGAAAGG + Intergenic
911947401 1:104129788-104129810 AAGAAAAAAAAAATTCAGGATGG - Intergenic
912107927 1:106304067-106304089 ATGAAAAAGCAGGTTCAGGAAGG - Intergenic
912125630 1:106533940-106533962 ATGAATAAACAGATCCAGAGAGG + Intergenic
912219095 1:107651523-107651545 AGGAAGAAACAAAGTAAGGAAGG + Intronic
912310664 1:108617796-108617818 ATGAAGAAACGGCCTCAGAAAGG + Intronic
912448045 1:109752193-109752215 CCTAAGAAACAGAGTCAGGATGG + Exonic
912603115 1:110959298-110959320 ATGAAGAAACAGATTCAAAGAGG - Intronic
912937420 1:114015735-114015757 ATGAGGAAGCAGATTCTGGGAGG + Intergenic
913539462 1:119804975-119804997 GTGAGGAAACAGGCTCAGGATGG + Intronic
914447147 1:147759727-147759749 ATGAAGAAACAGACTCAGTGAGG - Intronic
914864459 1:151414910-151414932 ATACAGAAAAAGATTCAAGAGGG + Intronic
914965016 1:152248630-152248652 ATGAGGAAACAGACTCAGAAAGG - Intergenic
914973441 1:152333211-152333233 ATGAGGAAACAGACCCAGAAAGG - Intergenic
915676777 1:157539240-157539262 ATGATGAAACTGGTACAGGATGG + Exonic
915703308 1:157818892-157818914 ATGAAGAAACATATTGATGATGG + Intronic
915704222 1:157828311-157828333 ATGAAGAAAGTGTTTCAAGAAGG - Intergenic
916211877 1:162366369-162366391 ATGAGGTAACAGACTCAGGGAGG + Intronic
916295333 1:163212909-163212931 ATAAAGACACAGATATAGGAGGG - Intronic
917013349 1:170500696-170500718 ATACAGAAACAGGTTCAGAAAGG - Intergenic
918163009 1:181918946-181918968 ATCAAAAAAGACATTCAGGATGG + Intergenic
918256174 1:182749953-182749975 ATGAAGAAACAGACTAAGAGAGG - Intergenic
918346571 1:183612633-183612655 ACGAAGAAACAGGCTCAGAAAGG + Intergenic
918362694 1:183775011-183775033 ATGAGAAAACAAAGTCAGGAGGG - Intronic
918602792 1:186383322-186383344 AGGAAGAAACAGATTTGGGATGG + Intronic
918610097 1:186479745-186479767 ATGAAGAAACAGATTAAGAGAGG + Intergenic
918922949 1:190738558-190738580 ATGAGGCAAGAGATTCAAGAAGG - Intergenic
919046002 1:192452943-192452965 ATGAGGAAACAGATCCAGAGAGG - Intergenic
919138989 1:193546375-193546397 ATTAAGACACAGATTCATAAAGG - Intergenic
919321134 1:196039885-196039907 ATGAAGGAATACATTCAGCAAGG - Intergenic
919588229 1:199465551-199465573 ATGAAGGAAGAGAGACAGGAGGG + Intergenic
919641889 1:200053430-200053452 ATGAAGAAACTGAGGCAGAAGGG + Intronic
920039946 1:203089074-203089096 ATGAATAAACACATTCGGGGTGG - Intergenic
920087174 1:203426112-203426134 GTGAAGAAACAGATTCAGAGAGG - Intergenic
920124840 1:203685737-203685759 AAGAAGAAACAGACTCAGGGAGG - Intronic
920545181 1:206810505-206810527 ATTAAGAAACACATTGACGAAGG + Intronic
920729394 1:208468634-208468656 ATGAGGAAACAGATTCAGAATGG + Intergenic
920749767 1:208662679-208662701 ATGAAGAATCAGATTGTGCAGGG - Intergenic
920822862 1:209397808-209397830 ATTAAGAAACAGTTGAAGGATGG - Intergenic
921418584 1:214919808-214919830 ATGGAGAAGGAGAATCAGGAAGG - Intergenic
922873364 1:228920801-228920823 GTGAAGAAAGAGTTTCAGAATGG - Intergenic
923090348 1:230735767-230735789 AAGGAGAAGCAGTTTCAGGAAGG - Intergenic
923374117 1:233342903-233342925 ATGAAGAATCCGATTTAGGATGG - Intronic
923566502 1:235080387-235080409 ATGAAGAAAGAGAGAAAGGAAGG + Intergenic
923666566 1:236003519-236003541 ATGAAGAAAGTGTTTCAGGAAGG + Intronic
1063518824 10:6722543-6722565 AGGAAGGAACACATTCAGTAGGG + Intergenic
1063974135 10:11401878-11401900 ATTAAGAAAAGGAATCAGGACGG + Intergenic
1064944264 10:20770680-20770702 ATGAAGAAACAGAACAAGGAAGG - Intergenic
1064966312 10:21018732-21018754 ATTAAGAAAGAGCTTCAGGCCGG + Intronic
1065523117 10:26591048-26591070 ATTCAGCAAAAGATTCAGGAAGG - Intergenic
1065529042 10:26650298-26650320 ATTCAGCAAAAGATTCAGGAAGG - Intergenic
1065557878 10:26934755-26934777 ATTCAGCAAAAGATTCAGGAAGG + Intergenic
1066534703 10:36379033-36379055 ATGAATATACAGTTTCAGGAAGG - Intergenic
1066707583 10:38198184-38198206 ATGAAAATACAAACTCAGGAAGG - Intergenic
1066820319 10:39478842-39478864 ATGCAAAAATAAATTCAGGATGG - Intergenic
1066982116 10:42426545-42426567 ATGAAAATACAGACTCAGGCTGG + Intergenic
1067509322 10:46882336-46882358 TTGGAGCAACAGATTCAGCATGG + Intergenic
1067510972 10:46894874-46894896 ATAAAGAAAGGGCTTCAGGAAGG - Intergenic
1067651279 10:48156988-48157010 ATAAAGAAAGGGCTTCAGGAAGG + Exonic
1067652931 10:48169519-48169541 TTGGAGCAACAGATTCAGCATGG - Intronic
1067661558 10:48239818-48239840 ATGAGGAAACAGATTCAGAGAGG - Intronic
1068100848 10:52550902-52550924 ATGAGCAAACCGATCCAGGAAGG - Intergenic
1068434129 10:56968901-56968923 GTGAAGAAGCAGATTGAGTAGGG + Intergenic
1068610876 10:59058562-59058584 CTGAAGAATCAGTTTTAGGACGG + Intergenic
1068885339 10:62091867-62091889 CTGAAGCAAGAAATTCAGGAGGG + Exonic
1069078270 10:64061581-64061603 ATGAAGAATTAGGTTCAAGAAGG + Intergenic
1069155223 10:65021214-65021236 ATGAAAAAACTGACTCAAGATGG + Intergenic
1069385892 10:67883406-67883428 ATGAAGAAACAGCTTTAAGTTGG + Intergenic
1069836463 10:71311620-71311642 AGGAAGAAGCAAATGCAGGAAGG + Intergenic
1069866852 10:71509437-71509459 ATGGAGAGACAGATTCCTGATGG - Intronic
1070219873 10:74430044-74430066 ATGAAGAAACAGAGGCACGGAGG + Intronic
1070376953 10:75841923-75841945 ATGAAGAAACAGAGACAGAGGGG - Intronic
1071355910 10:84794878-84794900 ATTAAGAAACACATTCAGCAAGG - Intergenic
1071801624 10:89069666-89069688 ATGAAAAAATGGATTCAGAATGG - Intergenic
1072197794 10:93131525-93131547 ACAAAGAAACAGATTCAGAATGG - Intergenic
1072798879 10:98377964-98377986 ATGAAGAAAGAGGGTAAGGAAGG - Intergenic
1073793857 10:106966704-106966726 GTGGAGAAACAGAGTCAGGAGGG - Intronic
1073937037 10:108645317-108645339 AGGAAGAAAAATATTCAAGAAGG + Intergenic
1074336741 10:112584118-112584140 ATAAGTAAACAGATTCAGAAGGG + Intronic
1074340138 10:112620432-112620454 AGGAAGAAACAGATTCAAGTGGG + Intronic
1074438623 10:113455622-113455644 ATGGGGAAACAGACTCAGGATGG - Intergenic
1074540150 10:114358428-114358450 ATGAAGAAACAGACTCAGGGAGG + Intronic
1074541635 10:114370040-114370062 ATGGGGAAACAGAGTCAGGGAGG - Intronic
1074811241 10:117107238-117107260 ATGAGGAAACAGTTTTGGGACGG + Intronic
1074813863 10:117130510-117130532 AAGGAGAAACAGCTGCAGGAGGG - Intronic
1075444188 10:122502489-122502511 ATGTAGAAACAGATCCAGTGAGG - Intronic
1076018439 10:127049082-127049104 ATTATAAAATAGATTCAGGAGGG - Intronic
1076034392 10:127186863-127186885 ATGCACACACAGATACAGGAGGG + Intronic
1077506370 11:2931635-2931657 AAGAGGAAACTGGTTCAGGATGG + Intergenic
1077803128 11:5561855-5561877 AAGACTAAACAGATTCAGAAAGG + Intronic
1077826986 11:5821227-5821249 AAGACCAAGCAGATTCAGGAAGG + Exonic
1078034829 11:7792730-7792752 ATAGAGCTACAGATTCAGGAAGG - Intergenic
1078125741 11:8561144-8561166 ATGAAGAAGCAGAGATAGGAAGG - Intronic
1078707441 11:13758758-13758780 ATGAAGAAACAGAATCAAAGAGG + Intergenic
1078851025 11:15163886-15163908 ATGAAGAAAGAGATTAAAGGAGG - Intronic
1080113397 11:28595168-28595190 ATGAGGAGACAGAATCAGAATGG - Intergenic
1080185323 11:29476536-29476558 ATGAATAAACAGATTCATAGTGG - Intergenic
1080340070 11:31251941-31251963 ATGAAGAAACCAAATCATGAAGG + Intronic
1080436597 11:32250366-32250388 ATGGAGAAGCAGGTTCAGGGAGG - Intergenic
1080463646 11:32477126-32477148 TTGAAGAAGCAGAGTCAGGCCGG + Intergenic
1080691296 11:34560757-34560779 ATGAGGAAACAGACTCAGGCAGG + Intergenic
1081025928 11:38015304-38015326 TTGAAAAAACATATTCAGGCCGG + Intergenic
1081346927 11:41999365-41999387 CTGAAGAAGCAGCTTCAGTATGG + Intergenic
1081451730 11:43177342-43177364 AGGAAGGAACAGATATAGGATGG - Intergenic
1081722877 11:45302958-45302980 AGGAAGAAACAGATGGAGAAAGG + Intergenic
1082604064 11:55201654-55201676 ATCAAAAGAAAGATTCAGGAAGG + Intergenic
1082695968 11:56364944-56364966 ATTAAGAAAAATATTCAGGCTGG - Intergenic
1082740065 11:56901008-56901030 ATGAAGAAACAGACTCACAAAGG + Intergenic
1082857692 11:57823628-57823650 ATGGAGAATCAGATGCAAGAAGG + Intergenic
1082892901 11:58159192-58159214 ACCAAGAGACAGTTTCAGGACGG - Intronic
1082997358 11:59264572-59264594 ATGAAGAAACAGGCTCAGGTGGG - Intergenic
1083233598 11:61338297-61338319 ATGTAGAAACAGATTCAGAGAGG - Intronic
1083336566 11:61925148-61925170 ATGAGGAAACAGATTTGGAAAGG + Intergenic
1083562673 11:63685556-63685578 ATGAAGAAAAACATCCAGCAAGG - Intronic
1084057235 11:66643426-66643448 TTGAAGAAACAGACGCAAGAAGG - Intronic
1084079962 11:66815901-66815923 ATAGAGAAACAGGTTCAGGAGGG + Intronic
1084112389 11:67022698-67022720 ATGAAGAAACAGGCTCAGAGAGG - Intronic
1084344758 11:68539278-68539300 ATGAGGAAACAGACCCAAGAAGG - Intronic
1085056001 11:73404306-73404328 ATGAGGAAACAGGTTATGGAAGG - Intronic
1085075871 11:73591504-73591526 ATGAATAAAAAGATTCAAGAGGG - Intronic
1085101712 11:73806260-73806282 ATGAGGATACAGATTATGGAAGG - Intronic
1085218154 11:74850182-74850204 ATGAAGCAACAGACTCAGAGAGG - Intronic
1085520117 11:77132816-77132838 ATGATGAAACAGGCTCAGGAAGG + Intronic
1085925752 11:81018546-81018568 TTGAAGAAAGGGATTAAGGAAGG + Intergenic
1086212304 11:84335247-84335269 ATGAAGGAACAGAGGGAGGAAGG + Intronic
1086253872 11:84850674-84850696 TAGAATAAACAGATTCAGCAAGG + Intronic
1086363515 11:86084518-86084540 AGGAATAAACAGATCCAGCAGGG - Intergenic
1086378996 11:86232195-86232217 AGGAAGAAACAGATTTAATAAGG - Intergenic
1086534269 11:87825244-87825266 ATGAAGGAACAAATTAAGAAAGG + Intergenic
1086537886 11:87870546-87870568 ATAAAGAAACAAATTTAGTATGG - Intergenic
1087104552 11:94396843-94396865 ATGAGGAAACAGATTCAGAGAGG - Intronic
1087321132 11:96660235-96660257 TTAAAGAAACAGACTCAGCAAGG - Intergenic
1088026593 11:105192088-105192110 ACGAAGGAATAGATTTAGGAAGG + Intergenic
1088120539 11:106363783-106363805 ATGAAGAAACTGAGGCAGGGAGG - Intergenic
1088181648 11:107120127-107120149 GAGAGGAAACAGATTGAGGAAGG + Intergenic
1088392162 11:109326492-109326514 ATGAAGAAACAGTCCCAGAAAGG - Intergenic
1089465242 11:118680733-118680755 CTTAAGAAGCAGATTCAGGCTGG + Intergenic
1089524403 11:119087501-119087523 ATGAACAAACAGATCCTGGTGGG + Intronic
1089643032 11:119860108-119860130 AGGAGGAAACAGATTCAGAGAGG + Intergenic
1089929512 11:122296105-122296127 ATGAAGAAATAGGTTCAGAGAGG - Intergenic
1089956343 11:122574691-122574713 ACGAAGACACAGATTCTGAAAGG - Intergenic
1090432314 11:126656281-126656303 ATGAAGAAACTGAATCATGGAGG - Intronic
1091064123 11:132492555-132492577 AGGAAGAAACAGGTTGAGAAGGG + Intronic
1091075903 11:132616498-132616520 ATTAAGAAACAGATCCTAGAAGG - Intronic
1091095339 11:132815816-132815838 AAGAAGAAAGAGATACTGGATGG + Intronic
1091284097 11:134398564-134398586 ATGAAGAAACTGAGGCATGAGGG + Intronic
1091443661 12:530643-530665 ATGAAGAAACAGAAACAGAAAGG - Intronic
1092014541 12:5147375-5147397 ATGAAGAGACAGTTACAGGTTGG - Intergenic
1092059754 12:5538761-5538783 ATGAAGAAAGTGTATCAGGAAGG + Intronic
1092766686 12:11859435-11859457 ATTAAGAAGCAGATTCAGGCCGG - Intronic
1092986511 12:13850880-13850902 ATGAAGAAAGAGAATCAGAAAGG - Intronic
1093051094 12:14505934-14505956 ATGAGGAAACAGAAACATGACGG + Intronic
1093478149 12:19577799-19577821 ATCAGGAAACACATTCAAGAGGG - Intronic
1093483635 12:19629778-19629800 ATGAAGAAACAATCTCAGGGAGG + Intronic
1093859826 12:24150959-24150981 ATTTAAAAACAGAATCAGGAAGG + Intergenic
1093936900 12:25011111-25011133 ATAAAGAAACAGGTTCAGAGAGG + Intergenic
1094381217 12:29845297-29845319 ATGAAGAAACTGAAACAGAAAGG + Intergenic
1094728615 12:33148541-33148563 ATGAAGAAACAGATAGAGAAAGG + Intergenic
1095062354 12:37713064-37713086 ATGAAAAGAAAGGTTCAGGATGG - Intergenic
1095174136 12:39071264-39071286 CTGAAAAGACAGATCCAGGATGG - Intergenic
1095474015 12:42566567-42566589 ATGAAGAAACAGGTTCCAAATGG - Intronic
1095664902 12:44786368-44786390 AGGAAACAACAGATTCTGGAGGG + Intronic
1095824075 12:46513619-46513641 ATTAACAAAGACATTCAGGATGG - Intergenic
1095900724 12:47325398-47325420 ATGAAGAAAAATGTTCAGAAAGG + Intergenic
1096000307 12:48124199-48124221 ATGAAGAAACTGAGGAAGGAGGG + Intronic
1096194198 12:49638770-49638792 ATGAGGAAACAGGGTCAGAAAGG - Exonic
1096410839 12:51376180-51376202 AAGAGGAAACAGGTTCAGGGAGG + Intronic
1096828409 12:54296550-54296572 ATGAAGATACAGGGGCAGGAGGG - Intronic
1097653569 12:62333661-62333683 ATTAAGAAACAGATGTAGAATGG + Intronic
1097892317 12:64789956-64789978 ATTAGGAAACTGATTCAGAAAGG + Intronic
1098847262 12:75552961-75552983 ATGAAAAAACAGAATCAATATGG - Intergenic
1098860800 12:75707835-75707857 ATGAAGAACAAGTTTCAGGAAGG - Intergenic
1099134086 12:78872377-78872399 ATGATGAAACAGATTCTCAAAGG - Intronic
1099147088 12:79059878-79059900 ATGAGGAGACAGATTCTGAAAGG + Intronic
1099363395 12:81736406-81736428 ATGAATAAACCAATTCAGCAAGG - Intronic
1099821675 12:87719329-87719351 ATGAAGAAACAGACTCAGAAAGG - Intergenic
1100023867 12:90103932-90103954 ATGAAGAAAAAAAATCAAGAAGG - Intergenic
1100150959 12:91737057-91737079 ATGAGGAAACAGGTTTAGGGAGG - Intergenic
1100208716 12:92378996-92379018 ATGAAGAAAAATATTCAGGAAGG + Intergenic
1100467486 12:94859712-94859734 AGGAAGAAAGAGGGTCAGGAAGG - Intergenic
1100657167 12:96659592-96659614 ATGGAGAAATAGACTCATGAAGG + Intronic
1100774237 12:97956752-97956774 AAGAAGAATCAGATTCTGAAAGG + Intergenic
1101109080 12:101468191-101468213 ATGAAGAAACAGGCTCAGGGAGG - Intergenic
1101439692 12:104694289-104694311 ATCAGGAAACAGATTCAGAGAGG - Intronic
1101823235 12:108200308-108200330 ATGAAGAAACAGGCTCAGAGAGG + Intronic
1101923944 12:108955884-108955906 ATGAGAAAACAGATGCAGGAAGG + Intronic
1102127698 12:110498270-110498292 ATGAAGAAACTGATTCTGTTGGG - Intronic
1102195717 12:111023877-111023899 CTGAAGAAACAGGTTCAGGCAGG + Intergenic
1102487307 12:113266940-113266962 ATGAAGAAGGAGAAACAGGAAGG - Intronic
1102564187 12:113784026-113784048 ATGAGGAAGCAGATTCAGAGAGG - Intergenic
1102956243 12:117060938-117060960 ACGAGAAAACAGACTCAGGAAGG - Intronic
1103538382 12:121649347-121649369 AGGAGGAAACAGGTTCAGGGAGG - Intergenic
1104189823 12:126469595-126469617 ATGTTGAACAAGATTCAGGAAGG + Intergenic
1104769105 12:131349571-131349593 AGGAAGAAACAGAGACAGGTAGG - Intergenic
1104793043 12:131495878-131495900 GAGAAGAAATAGACTCAGGAGGG - Intergenic
1104915031 12:132260167-132260189 ATGGAGAAACAGACACAGGGAGG + Intronic
1105260432 13:18775247-18775269 ATGTAGAAGCAGGTTCAGAAGGG - Intergenic
1105262637 13:18791101-18791123 ATGTAGAAGCAGGTTCAGAAGGG - Intergenic
1105420347 13:20246793-20246815 AAGAAGCCACAGGTTCAGGATGG + Intergenic
1105590672 13:21790379-21790401 AACAAGAAACAGAATCAGGCTGG + Intergenic
1105603100 13:21904459-21904481 ATGGAGAAACAGAGTCCTGAAGG - Intergenic
1106182290 13:27380189-27380211 ACAAAGAAAAAGATGCAGGAAGG - Intergenic
1106200454 13:27532418-27532440 ATGAAGAAACAGAATTAGCGAGG - Intergenic
1106301246 13:28468156-28468178 ATGAGGAAACTGGTTCAGAAAGG - Intronic
1106373044 13:29155544-29155566 ATGAAGAGGCAGGCTCAGGATGG + Intronic
1107382012 13:39866911-39866933 ATGAAGAAATAGTTTCCAGAAGG - Intergenic
1107515964 13:41129959-41129981 ATGAAGAAAAAAATGCAGGCTGG - Exonic
1107736549 13:43405141-43405163 CTGAAGAGACAGTTTCAGGCAGG + Intronic
1108025828 13:46176354-46176376 CTGAAAAAACATTTTCAGGATGG + Intronic
1108101790 13:46964814-46964836 ATGAAGACACAGAATAAAGAGGG - Intergenic
1108749233 13:53430350-53430372 ATGAAGATTCAGATTCAGTAGGG + Intergenic
1109313642 13:60724472-60724494 TGGAAGAAACAGCCTCAGGAGGG + Intergenic
1109371911 13:61433137-61433159 ATGAAGAAAAAAATGAAGGAAGG - Intergenic
1109650507 13:65319013-65319035 TTGTAGAAACAAATACAGGAAGG - Intergenic
1109752880 13:66719419-66719441 ATTATGAAAGAGATTGAGGAGGG + Intronic
1111140406 13:84111034-84111056 ATGAAGAAACTGAGCCAGGTGGG + Intergenic
1111616087 13:90663424-90663446 ATGAAGTAACCGAAGCAGGAAGG - Intergenic
1111808971 13:93074063-93074085 ATTTTGACACAGATTCAGGAGGG - Intergenic
1112150656 13:96758251-96758273 ATAAATAAATAGATTCAGTATGG - Intronic
1112202006 13:97285867-97285889 AGAAGGAAAAAGATTCAGGAAGG - Intronic
1112461594 13:99607633-99607655 ATGAAAAAACAGGGTCAGAAAGG + Intronic
1114196535 14:20482078-20482100 ATGAACAAACAAACTCAGAATGG - Intergenic
1115956554 14:38787269-38787291 ATGATCAAAGAGATTCTGGATGG + Intergenic
1115989253 14:39135043-39135065 ATAATGACACAGATTCAGAAAGG + Intronic
1117878364 14:60280332-60280354 ATGGAGAAAGAGATTCGGAAAGG + Intronic
1118668423 14:68095992-68096014 AAAAAGAAACAGACTCAGAAAGG + Intronic
1118815980 14:69314296-69314318 AAGAAGAAACATGTTCAGAAAGG + Intronic
1119473602 14:74914069-74914091 ATGGAGAAACAGGCTCAGGAGGG - Intronic
1119613807 14:76085132-76085154 ATGAGGAAACAGACTCAGAGAGG + Intergenic
1119726605 14:76925212-76925234 ATGAAGACACAGCCTCAGAAAGG - Intergenic
1119742384 14:77022591-77022613 ATGAAGAGACAGTTGCAGGCCGG + Intergenic
1119836781 14:77757404-77757426 ATGAGAAAACAGATTCAGAGAGG - Intronic
1119964749 14:78901861-78901883 ATGAAGCAACAGAGTAAGAAAGG - Intronic
1120486558 14:85121532-85121554 ATGAAGAAACACATTCTAGAGGG - Intergenic
1120785905 14:88535485-88535507 ATTAAGAAACAGACTCAGTGAGG - Intronic
1121171097 14:91855084-91855106 ATGAAGAAACAAGTTGAGCAGGG + Intronic
1121293421 14:92795944-92795966 ATGAAGATATAGATACAGAAGGG - Intronic
1121501045 14:94438206-94438228 ATCAAGTCACATATTCAGGAAGG + Intergenic
1121723657 14:96130338-96130360 ATGGGGAACCAGATTCAGAATGG + Intergenic
1122045205 14:99018009-99018031 ATGAGGAAACAGGCTCAGCAAGG - Intergenic
1122101520 14:99414140-99414162 ATGAAGAAGCAGATTTATGGCGG - Intronic
1122436007 14:101699715-101699737 ATGAAGTAACAAAAACAGGATGG + Intergenic
1122666006 14:103330148-103330170 GTGAGGAAAGAGACTCAGGAAGG - Intergenic
1124883782 15:33665274-33665296 CTAAAGAAACAGATACAGAAAGG - Intronic
1125553309 15:40564325-40564347 ATGAAAAAACAAGTTCAGAAGGG + Intronic
1126281095 15:46950095-46950117 ATGAAGAAATTGTTTCAAGAAGG - Intergenic
1126326112 15:47479333-47479355 ATAGAGAAACAGGTTGAGGATGG - Intronic
1126407619 15:48337433-48337455 ATGAGGAAACAGGCTCAGAAAGG - Intronic
1126644868 15:50865437-50865459 ATGAAGAAACAGCCTCATAAAGG + Intergenic
1126711072 15:51456776-51456798 ATGAATAAACAGATACAAAATGG - Intronic
1126835201 15:52655859-52655881 ATAAAGAAATAGATTCAGACAGG - Intronic
1126922022 15:53537540-53537562 ATGAAGAAACAGAGACAGAAAGG - Intronic
1127143910 15:56005604-56005626 GTGAAGAAGCAGCTTAAGGATGG + Intergenic
1127473643 15:59312438-59312460 ATGAAGAAACAGAAGCATAAAGG + Intronic
1127477901 15:59351944-59351966 AGGAAGAAAGAGATCCAGAATGG - Intronic
1127666609 15:61153910-61153932 ATCAAGAAACAGATTTGGTAAGG + Intronic
1127717571 15:61664461-61664483 ATGAGGAAACCAAGTCAGGAAGG + Intergenic
1128451707 15:67809699-67809721 ATGAGGAAACAGACTCAGACAGG - Intergenic
1128576879 15:68782360-68782382 ATGAAGAAATAGGCTCAGAAAGG + Intronic
1130301847 15:82686094-82686116 AAGAAGACACAAAATCAGGAGGG + Intronic
1131337863 15:91567059-91567081 GTGAAAACACAGATTCTGGAAGG + Intergenic
1131779258 15:95838657-95838679 ATGTGAAAACAGATTCAGGCAGG - Intergenic
1131864010 15:96687533-96687555 ATGAGGAAACAGGCTCAGGGAGG + Intergenic
1132153339 15:99477609-99477631 TTGAAGAAACAGGCTCAGGGAGG + Intergenic
1132635275 16:941832-941854 GTGATGTTACAGATTCAGGAAGG + Intronic
1133129637 16:3668878-3668900 CTCAGGAAACACATTCAGGATGG + Intronic
1133737083 16:8624062-8624084 CTGAAGAAACAGATGCAGAGAGG + Intronic
1133962133 16:10503687-10503709 TTGAGGAAACTGATTTAGGAAGG - Intergenic
1133985432 16:10664716-10664738 ATTAGGAAACAGATTCAGAAGGG + Intronic
1134175999 16:12006937-12006959 ATGAGAAAACAGATTCAGAGAGG + Intronic
1134288656 16:12884803-12884825 TTGATGAAACAAATTAAGGAAGG - Intergenic
1134333843 16:13275820-13275842 ACAAAGTAACAGAATCAGGAAGG - Intergenic
1134661506 16:15987945-15987967 ATAAATAAACAAATACAGGATGG - Intronic
1134847800 16:17455245-17455267 ATGAATAAACAGCTCCAGAAAGG - Intronic
1135510063 16:23074939-23074961 ATGCTGGAACAGACTCAGGATGG + Intronic
1135660405 16:24291720-24291742 ATGAGGAAACTGAGGCAGGAGGG - Intronic
1135823817 16:25708421-25708443 ATGAAGAAATTGGTTCAGAATGG - Intronic
1135834724 16:25814854-25814876 ATGGAGCCACAAATTCAGGAAGG + Intronic
1135931629 16:26743014-26743036 AAGAAGAAACAGGTTCTAGAAGG - Intergenic
1136392953 16:29976923-29976945 ATAAAGAAACAGGCTCAGCAAGG - Intronic
1136636256 16:31525420-31525442 ATTAAGGAAAAGTTTCAGGAAGG - Intergenic
1136713510 16:32259033-32259055 ATGAAAAAACAGTTTCAGGAAGG - Intergenic
1136754401 16:32670398-32670420 ATGAAAAAACAGTTTCAGGAAGG + Intergenic
1136813712 16:33199967-33199989 ATGAAAAAACAGTTTCAGGAAGG - Intronic
1136820188 16:33310047-33310069 ATGAAAAAACAGTTTCAGGAAGG - Intergenic
1136826751 16:33366586-33366608 ATGAAAAAACAGTTTCAGGAAGG - Intergenic
1136831817 16:33465357-33465379 ATGAAAAAACAGTTTCAGGAAGG - Intergenic
1137024048 16:35455773-35455795 ATGAGGAAACAGTCTCAGGGAGG + Intergenic
1137491708 16:48938488-48938510 ATGAGGAAACAGGTTCAGAGAGG + Intergenic
1137543192 16:49378472-49378494 CTTAGGAAAGAGATTCAGGAAGG + Exonic
1137812796 16:51368803-51368825 ATGAAGAAACAGATTCAGAGAGG + Intergenic
1137950460 16:52778854-52778876 ATGACAAAACAGACTCAGAAAGG - Intergenic
1138454131 16:57111668-57111690 ATGAGGAGACAGGTTCAGAAAGG - Intronic
1138589032 16:57989632-57989654 ATGATGAAATGGACTCAGGAAGG + Intergenic
1138756340 16:59490654-59490676 CTAAAGACACAGAGTCAGGAAGG + Intergenic
1139144767 16:64310036-64310058 ATGAAGAAAGAGAAGAAGGAAGG + Intergenic
1139193917 16:64896505-64896527 TTTAAGAAACAGTTTCAGGATGG + Intergenic
1140521230 16:75583860-75583882 ATGAAACATCAAATTCAGGATGG + Intergenic
1140525747 16:75621454-75621476 ATGAGGAAACAGACCCAGCAAGG - Intronic
1140567501 16:76061226-76061248 ATGAAGATACAGATACTGGAAGG - Intergenic
1141015800 16:80448215-80448237 GTTAAGAAAAAGATTCAGGCCGG + Intergenic
1202992288 16_KI270728v1_random:22941-22963 ATGAAAAAACAGTTTCAGGAAGG - Intergenic
1203056548 16_KI270728v1_random:930729-930751 ATGAAAAAACAGTTTCAGGAAGG + Intergenic
1142653379 17:1372496-1372518 ATGATGAAGCTGAGTCAGGAAGG - Intronic
1143208983 17:5169220-5169242 ATGAGGAAATAGATTCAGGGAGG - Intronic
1143249427 17:5511811-5511833 ATGAAGAAAAAGAGGAAGGAAGG - Intronic
1143261735 17:5604420-5604442 ATGAAGAAAGTGATTCATTATGG - Intronic
1143434894 17:6916069-6916091 ATTCAGAAGGAGATTCAGGAGGG + Intronic
1143588327 17:7863628-7863650 ATTTAGAAACAGTTTCAGGATGG - Intronic
1143764050 17:9126046-9126068 TTGCAGAAGCAGAGTCAGGATGG + Intronic
1144022673 17:11251025-11251047 ATGAGGAAACCGATTCAGAGAGG + Intronic
1144122713 17:12171548-12171570 ATCTAGAAACAGATGCATGATGG - Intergenic
1144395361 17:14837913-14837935 ATGAAGAAACAGACTAAGTGAGG - Intergenic
1144398340 17:14868699-14868721 ATTAAGAAAGTGATTCAGGCTGG + Intergenic
1144485529 17:15661149-15661171 AGGAGGAAACAGATTCAGAGAGG - Intronic
1144618474 17:16798695-16798717 ATGAGAAAATAGATTCAGGGAGG - Intronic
1144894232 17:18516998-18517020 ATGAGAAAATAGATTCAGGGAGG + Intergenic
1144966324 17:19078936-19078958 TTGAGGAAACAGACTCAGGGAGG + Intergenic
1144981594 17:19173121-19173143 TTGAGGAAACAGACTCAGGGAGG - Intergenic
1144986630 17:19205118-19205140 TTGAGGAAACAGACTCAGGGAGG + Intergenic
1145137999 17:20427242-20427264 ATGAGAAAATAGATTCAGGGAGG - Intergenic
1146373478 17:32279762-32279784 ATGGAGAAACAGAGGCAGGGTGG + Intronic
1146937414 17:36820903-36820925 ATGAAGAAACTGGTGCAGGAGGG - Intergenic
1147000306 17:37358046-37358068 AAGTAGAAACAGAATCAGGAAGG + Intronic
1147112692 17:38275243-38275265 ATGAAGAAACTGAAACAGCAAGG - Intergenic
1147358041 17:39912749-39912771 ATGAAGAAACAGATTCAAAGAGG - Intronic
1147406339 17:40215082-40215104 ATGAAGAAACAGACACAGCAAGG - Intergenic
1147636141 17:41965728-41965750 AAGAAGAAAGGGTTTCAGGAGGG + Intergenic
1147780238 17:42935694-42935716 ATTAAGAAACAGAAACAGGCTGG - Intergenic
1148547351 17:48528501-48528523 ATGGAGAAACAGAAGCAGGCAGG + Intergenic
1148746518 17:49921192-49921214 AAGAAGGTACAAATTCAGGAGGG + Intergenic
1149357875 17:55862452-55862474 ATGAAGAAACTGAGTCAGTTTGG + Intergenic
1149376089 17:56045642-56045664 ATGAAGAAAGAGATTCAGAGAGG + Intergenic
1149817204 17:59737071-59737093 AACAAGAAACAGAATCAGGTTGG + Intronic
1149871146 17:60182978-60183000 ATGAGAAAATAGATTCAGGGAGG + Intronic
1149895937 17:60428363-60428385 AGGAAGAAACAGATGCAGAGAGG - Intronic
1150016998 17:61568086-61568108 AAGAAGAAACACATTTTGGAAGG + Intergenic
1150028095 17:61699697-61699719 ATGAAAACTTAGATTCAGGAGGG + Intronic
1150605807 17:66689865-66689887 AAGAAGAGAAAGATTCACGAAGG - Intronic
1150735434 17:67732955-67732977 ATTAATAAACAAATTCAGCAAGG - Intronic
1151040880 17:70859889-70859911 ATGAAGAAACAGTCTCAAGCAGG - Intergenic
1151209810 17:72536083-72536105 ATGAAGAAACATGTTCAGAGAGG - Intergenic
1151542644 17:74772547-74772569 ATGAAGGAGCAGAAACAGGAGGG + Intronic
1152036213 17:77874712-77874734 AAGAGGAAACAGGCTCAGGATGG - Intergenic
1152057556 17:78042387-78042409 ATGAAGAAACAGGCTCAGAGAGG - Intronic
1153187493 18:2501419-2501441 ATGAAGAAACAGATTCAGGTAGG - Intergenic
1153247711 18:3089737-3089759 ATGAAGAAATAGGCTTAGGAAGG + Intronic
1153273273 18:3344047-3344069 ATGAAGAAACAGATTCAAGAAGG - Intergenic
1153656260 18:7285243-7285265 ATGAAGAAATAGATTGTGGGAGG - Intergenic
1154141306 18:11826664-11826686 ATGAGGAAAGGGATCCAGGAGGG + Intronic
1154285722 18:13054605-13054627 ATGAAGAAACAGGTTGAGGGAGG - Intronic
1154425587 18:14269548-14269570 ATGTAGAAGCAGGTTCAGAAGGG + Intergenic
1154428321 18:14289133-14289155 ATGTAGAAGCAGGTTCAGAAGGG + Intergenic
1154428803 18:14292607-14292629 ATGTAGAAGCAGGTTCAGAAGGG + Intergenic
1154431083 18:14308952-14308974 ATGTAGAAGCAGGTTCAGAAGGG + Intergenic
1154433279 18:14324789-14324811 ATGTAGAAGCAGGTTCAGAAGGG + Intergenic
1154433753 18:14328261-14328283 ATGTAGAAGCAGGTTCAGAAGGG + Intergenic
1154947180 18:21173538-21173560 ATGAAGAAACACCTTAAGGGAGG + Intergenic
1154956379 18:21260372-21260394 AAGAAGATACATATTAAGGAGGG + Intronic
1154982689 18:21516695-21516717 ATGAAGAAACATGTTCAGGTTGG + Exonic
1155530011 18:26757519-26757541 TTGAACAAACAGCTTCAGGGGGG - Intergenic
1156277917 18:35602377-35602399 ATAAATACACAGATACAGGAAGG - Intronic
1156556512 18:38074782-38074804 ATCAAGGAACAGATTCAGTGTGG + Intergenic
1156892807 18:42209347-42209369 ATGAGGAAACAGTTTCAATATGG + Intergenic
1157272199 18:46284430-46284452 ATGAAGAAACTGATTCAGAGAGG - Intergenic
1157655262 18:49380746-49380768 ATGAAGAGACAGGCTCAGAAAGG + Intronic
1158488251 18:57887495-57887517 ATGAAGAAACAAGTCCAGAAAGG + Intergenic
1159274014 18:66192307-66192329 ATGAAGCCACAGATGGAGGAAGG - Intergenic
1159347979 18:67231653-67231675 ATGAAGAAAGATATTAAGGGTGG - Intergenic
1159349283 18:67250756-67250778 AGGAAGACTGAGATTCAGGAAGG + Intergenic
1159448618 18:68571675-68571697 AGGAAGAAATAGAGCCAGGAAGG + Intergenic
1159478744 18:68959861-68959883 CTGAAGAGAGAGACTCAGGATGG - Intronic
1159600824 18:70427196-70427218 AGGAAGAAGCAGATAAAGGAAGG - Intergenic
1159752471 18:72319541-72319563 ATGAAAAAACACAATCAGGTTGG + Intergenic
1160314355 18:77827126-77827148 ATGAAGACAAAGATTCTGAATGG + Intergenic
1161735444 19:5989624-5989646 AGGAAGAAACAGAAGCAGGGGGG - Intergenic
1162034972 19:7933760-7933782 CTCAAGAAACGGACTCAGGAGGG + Intronic
1162095858 19:8309597-8309619 AGGATGAATCAGATTCAGAAAGG - Intronic
1162531590 19:11239352-11239374 ATGGAGAAACAGGCTCAGCATGG + Intronic
1162717110 19:12641165-12641187 ATGAAGAAGAACATTCAAGATGG + Intergenic
1163657953 19:18558641-18558663 TTGAAAAAACTGATTCAGAAGGG + Intronic
1163911412 19:20197622-20197644 GTGAAGAAAGAGTTGCAGGATGG - Exonic
1163912233 19:20206520-20206542 TTGAAGAAGTAGAATCAGGAAGG + Intergenic
1164145331 19:22509435-22509457 ATGAGGACACAGACTCAGAAAGG + Intronic
1165112036 19:33508087-33508109 AAGGAGAAACAGCTTCAGGGAGG - Intronic
1166006255 19:39909297-39909319 AAAAAAAAAAAGATTCAGGATGG - Intronic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1167247296 19:48381330-48381352 ATGAGGAAACAGGTTCAGAGGGG - Intergenic
1167308685 19:48723608-48723630 ATGAGGAAACAGAATCAGGTAGG - Intronic
1167786199 19:51638499-51638521 ATGAGTACACAGATTCAGTATGG - Intronic
1168233359 19:55047030-55047052 ATGAAGAAACAGGCTCAGAGGGG + Intronic
1168292643 19:55364053-55364075 ATGGAGAAACAGGTTCAGTAAGG - Intergenic
1168295520 19:55375721-55375743 ATGGGGAAACAAATCCAGGAGGG + Intergenic
1168488925 19:56791019-56791041 AAGAAAAAACAGATTAATGAAGG - Intronic
925134374 2:1516140-1516162 ATGAAGACACAGGTCCAGGTGGG + Intronic
925611070 2:5703629-5703651 AGGAAGAAACAAATGCAGAAAGG - Intergenic
926388960 2:12367744-12367766 ATGAAGAAAGCATTTCAGGAAGG + Intergenic
928186148 2:29113135-29113157 ATGAAGAAGCAGACTCTGGGAGG - Intronic
928186828 2:29117728-29117750 ATGAAAGCACAGATTCAAGAGGG - Intronic
928435396 2:31251532-31251554 ATGAAGCAACTGAGTCAGGAGGG + Intronic
928564036 2:32524478-32524500 ATGAAGAAACAGCCTTAGAAAGG - Intronic
928589496 2:32799747-32799769 ATTCAGAAACAGATTCAAGTAGG + Intronic
928955940 2:36867411-36867433 AGGATGACACAGATTCACGAAGG - Intronic
929429392 2:41874307-41874329 ATGAAGAAACAAACTCAGAGAGG + Intergenic
929597588 2:43186094-43186116 AAGAAGAAACAAACCCAGGAAGG - Intergenic
929848657 2:45559775-45559797 ATGAAGAAAAAGTTTCAGGCCGG + Intronic
930039691 2:47111359-47111381 ATTTTGAAACACATTCAGGAGGG + Intronic
931173227 2:59827110-59827132 ATGAGGAAACAGGTTCAGAAAGG + Intergenic
931601345 2:64006467-64006489 ATTAGGAAACAGACTTAGGAAGG - Intronic
932626050 2:73296652-73296674 ATGAGGAAACAGATTCAAAAAGG + Intergenic
932688186 2:73891354-73891376 AAGACGAAGCAGAGTCAGGAAGG + Intergenic
932689513 2:73900381-73900403 AAAAAGAAAAAGATACAGGAAGG + Intronic
932737459 2:74264269-74264291 ATTGAGAAGCAGATTGAGGATGG - Exonic
932961644 2:76419292-76419314 AGGAAGAAACAGAGGAAGGAAGG - Intergenic
934492365 2:94770267-94770289 ATGTAGAAGCAGATTCAGAAGGG - Intergenic
934528450 2:95068343-95068365 ATGAAGAAATGGATCCATGAAGG + Intergenic
935046145 2:99484900-99484922 ATAAAGAAACAGATTTAGAGAGG - Intronic
935058984 2:99592088-99592110 ATGAAGATACAGTAACAGGAGGG + Intronic
935129384 2:100249915-100249937 ATGCAGGAAGAAATTCAGGAAGG - Intergenic
935734781 2:106097801-106097823 AGGAACACACAGATTCAGGATGG + Intronic
935763352 2:106341953-106341975 ATGAAGAAACAGACTCCGTCAGG - Intergenic
935871894 2:107459764-107459786 ATGCAGAAATACATTCAGTAGGG + Intergenic
936398847 2:112150692-112150714 AGGAAGAAACTGATTCACAAGGG - Intronic
936500923 2:113065656-113065678 AGGAAGCAACAAATTCAGGCTGG - Intergenic
936717975 2:115212220-115212242 ATGACATAACAGATTCAGGCAGG - Intronic
936920505 2:117684056-117684078 ATAAAGGAACAGGATCAGGATGG - Intergenic
937138359 2:119575357-119575379 GTGAGGAAGGAGATTCAGGAGGG - Intronic
937642698 2:124231362-124231384 ATGGAGAAACAGAGTCAGAGAGG + Intronic
938758405 2:134401397-134401419 ATGATGTAGCAGACTCAGGAAGG - Intronic
939138549 2:138325215-138325237 ATGAAGAACCAGTTACAGAACGG - Intergenic
939345258 2:140957288-140957310 AGAAAGAGACAGATTCATGACGG + Intronic
939396889 2:141642268-141642290 ATGAGGAAACAGATTCAGAGAGG - Intronic
939445349 2:142303135-142303157 CAGAAGAAAGAAATTCAGGAGGG - Intergenic
939459159 2:142476769-142476791 ATGAAGAAGCAGATTTAGGCTGG - Intergenic
939888727 2:147710102-147710124 ATGAACAAACAGATTTATTAGGG - Intergenic
940480645 2:154226122-154226144 ATGAATGAACAGAGACAGGAGGG + Intronic
940492401 2:154380529-154380551 ATGAAGAAAAAAATTCTGGAAGG - Intronic
940647477 2:156406794-156406816 AAGAAGAAAGAGCTTTAGGAAGG - Intergenic
940853239 2:158707784-158707806 TAGAAGTCACAGATTCAGGATGG - Intergenic
941256324 2:163236116-163236138 ATTAATAAACACATTCAGTATGG - Intergenic
941451594 2:165666605-165666627 ATGAAGAAAGAGAGAAAGGAAGG + Intronic
941530845 2:166668889-166668911 ATGAGGAAACAGGTTCAGAAAGG + Intergenic
941803082 2:169682844-169682866 TTAAGGAAACAGATTCAGAAGGG - Intronic
942607693 2:177709756-177709778 AGGAAGAGAGAGTTTCAGGAAGG + Intronic
942818483 2:180081331-180081353 AGGAAAATACAGATGCAGGAGGG - Intergenic
942922240 2:181389577-181389599 CTGAAGAAACAGATGCAGGAAGG - Intergenic
943088164 2:183340592-183340614 ATGGAGAAGAAGGTTCAGGAGGG - Intergenic
944175471 2:196823860-196823882 ATGAAGACACAGACTCAGAGAGG + Intergenic
944328659 2:198438686-198438708 ATGAAGAAAAAGATACTTGAAGG - Intronic
945401639 2:209389439-209389461 ATGAAGAGAAAGCTTCGGGATGG - Intergenic
945464473 2:210151645-210151667 AAGAAGAAACAGACTCAGCATGG - Intronic
945775024 2:214095591-214095613 ATGAAAACACATATTCAGAAAGG - Intronic
945906493 2:215599625-215599647 GTGAAGAAACAGGTTCAGTGGGG - Intergenic
946508367 2:220326137-220326159 AGGAAGAAACAGAGGCAGGGAGG - Intergenic
947277332 2:228407366-228407388 AAGAGGAAACAAATTCAGAAAGG + Intergenic
948027686 2:234790994-234791016 ATGAAGAAAAAGATTCTGCAAGG - Intergenic
1168862430 20:1055352-1055374 AGGAAGAAACAGCTCCAGGCTGG - Intergenic
1168918799 20:1513862-1513884 AGGAAGCAATAGATTGAGGATGG + Intergenic
1169355409 20:4901100-4901122 ATTCTGAACCAGATTCAGGAAGG - Intronic
1169493733 20:6093260-6093282 AAGAAGAAACAAATGAAGGAAGG - Intronic
1170258640 20:14376886-14376908 ATAAGAAAACAGATTCAGGGAGG - Intronic
1170771529 20:19337009-19337031 ATGAAGAAACAGACTCAGAGAGG - Intronic
1170852989 20:20020893-20020915 TTGAAGATGCAGATGCAGGAGGG + Intronic
1172311723 20:33923509-33923531 ACGAAGAAAGAGTTTCAAGAGGG + Intergenic
1172610701 20:36249725-36249747 ATGAGGAAGCAGGCTCAGGAAGG + Intronic
1172963148 20:38812916-38812938 ATGCAGAAACTGACTCAGTAGGG + Intronic
1172969436 20:38862692-38862714 ATGAAGAAGAATGTTCAGGAGGG + Intronic
1173323731 20:42013408-42013430 ATGAGAAAACAGATTCAGAGAGG - Intergenic
1173671186 20:44800006-44800028 ATGAGGAAACAGGCTCAGGGAGG + Intronic
1173684872 20:44916250-44916272 AAGAAAAAACAGATTTAAGAGGG - Intronic
1173879790 20:46403593-46403615 ATGAAGAGCCAGAATCAGTATGG - Intronic
1173894498 20:46540477-46540499 GAGAAGAAACAGATTCAGAGAGG - Intergenic
1173916995 20:46715044-46715066 AGGAAGCAACAGGATCAGGATGG - Intronic
1173943281 20:46930375-46930397 ATGAGGAAACAGGCTCAGAAAGG + Intronic
1174247016 20:49188725-49188747 AGGAAGAAACAACTGCAGGAAGG - Intergenic
1174459968 20:50675618-50675640 TTGAGGAAACAGGTTCAGGCAGG + Intronic
1174466371 20:50720742-50720764 ATGAAGAAACTGAGTCAGGAAGG + Intergenic
1174725341 20:52855838-52855860 ATGAAGAAAAACAATGAGGAAGG - Intergenic
1174983516 20:55423435-55423457 ATGAAGCAACAGTTCCAGGTCGG + Intergenic
1174984925 20:55440372-55440394 GTGAAGAAAGCGTTTCAGGAAGG + Intergenic
1176652463 21:9563459-9563481 AGGAAGAAACAGACACAGGCAGG + Intergenic
1176843280 21:13857483-13857505 ATGTAGAAGCAGGTTCAGAAGGG - Intergenic
1176843768 21:13860968-13860990 ATGTAGAAGCAGGTTCAGAAGGG - Intergenic
1176845966 21:13876817-13876839 ATGTAGAAGCAGATTCAGAAGGG - Intergenic
1176846444 21:13880288-13880310 ATGTAGAAGCAGGTTCAGAAGGG - Intergenic
1176848699 21:13896360-13896382 ATGTAGAAGCAGGTTCAGAAGGG - Intergenic
1177741306 21:25156859-25156881 GAGAAGAAACATATTCAGAAGGG + Intergenic
1178232259 21:30799652-30799674 TTGCAGAGACAGATTCAAGAAGG + Intergenic
1178423632 21:32461461-32461483 ATGCAGAAAAAGAGGCAGGAAGG - Intronic
1178884427 21:36474113-36474135 ATGAGGCAACAGTTTTAGGATGG + Intronic
1178928981 21:36800556-36800578 GTGAGGAAACAGAGGCAGGAAGG + Intronic
1178991125 21:37357644-37357666 ATGAGGAAACAAATTCAGAGAGG + Intergenic
1179480303 21:41672544-41672566 ATGGAGAAACTGAGGCAGGACGG + Intergenic
1180338467 22:11599797-11599819 ATCAAGAAACAGAGAAAGGAAGG - Intergenic
1180595512 22:16970380-16970402 ATGGAGAAACTAATTCAGAAAGG - Intronic
1180761028 22:18207641-18207663 ACTATGAAACAGCTTCAGGAAGG + Intergenic
1180774639 22:18416978-18417000 ACTATGAAACAGCTTCAGGAAGG - Intergenic
1181679990 22:24488236-24488258 AAGAAACAACAGATTCAGGTTGG + Intergenic
1181783701 22:25210469-25210491 ATGAAGAAACAGGCTCAGGGAGG + Intergenic
1181982734 22:26777348-26777370 CTGAAGAAACAGAGTCAGAGAGG - Intergenic
1182078496 22:27511733-27511755 ATGGAGAAACAGGTTCAGGGAGG - Intergenic
1182111857 22:27729396-27729418 ATGGGGAAACAGACTCAGAAAGG - Intergenic
1182483653 22:30626437-30626459 CTGCAGAAACAGATTGAGCAAGG - Intronic
1182787005 22:32916390-32916412 ATGAGGATACAGATCCAGAAAGG + Intronic
1183111770 22:35654825-35654847 AAGAAGCAGCAGATGCAGGAAGG + Intronic
1183730179 22:39614158-39614180 ATGAAGAAACTGAGACAGAAGGG - Intronic
1184064602 22:42110518-42110540 TTGAAGAAACAGAGTCAGGAAGG - Intergenic
1184574703 22:45353736-45353758 ATGAAGAAACAGACCCAGAGAGG + Intronic
949407417 3:3729046-3729068 AAGAAAAAAGAAATTCAGGAAGG - Intronic
949535595 3:4993770-4993792 ATAAGGAAACAGATTCAGGAAGG - Intergenic
950276648 3:11666942-11666964 ATGAGGAAGCGGAGTCAGGAAGG - Intronic
950279943 3:11698201-11698223 ATGAAGAAACAGCTGGAGGCTGG + Intronic
951051159 3:18095710-18095732 ATGAAGAAACAGGCACAGAAAGG - Intronic
952515728 3:34103361-34103383 ATGAGGAAACAGCCTCAGAAAGG - Intergenic
952557345 3:34547839-34547861 AGGAATAAACAGGTTCATGAAGG - Intergenic
953470905 3:43165196-43165218 ATGAAGAAACAGATTTATGAAGG - Intergenic
953598765 3:44343206-44343228 ATGAGGAAACAGACTCCAGAAGG + Intronic
953706125 3:45231875-45231897 ATGAGAAAACAGGTGCAGGAAGG + Intergenic
954460973 3:50626746-50626768 ATGCAGAGACAGGTTCAGAAAGG + Intronic
955008477 3:54991765-54991787 ATGAAGAAACAGGCTCAGAGAGG - Intronic
955614022 3:60786508-60786530 ATGAAGTAACAGACTCAGGTAGG - Intronic
955914844 3:63896550-63896572 CTGAAGAAACAGATTGAGGAAGG - Intronic
955987249 3:64586878-64586900 TTGAAGGAAAAGTTTCAGGAAGG - Intronic
956647436 3:71470230-71470252 ATGAAGAAACAGGCTCAGGAAGG - Intronic
957233315 3:77549870-77549892 ATGGAGAAACAGATCCCAGAGGG + Intronic
957264927 3:77950761-77950783 ATGAAGAAAAAGCATCAGAAAGG - Intergenic
957866490 3:86031086-86031108 ATGAATAAACAGACTTAGGAAGG + Intronic
957940565 3:86997554-86997576 ATAAAGAAACAGATGCAGACAGG - Intergenic
958060654 3:88475744-88475766 ATGAAGAAAATGATTCACCAAGG + Intergenic
958880831 3:99667052-99667074 ATGAAGAAACAGATTCAGGAAGG + Intronic
959552567 3:107679687-107679709 ATGAACAAACAGAACCAGAAAGG + Intronic
959568065 3:107853012-107853034 ATCAAGAGCTAGATTCAGGAGGG + Intergenic
959793260 3:110390602-110390624 AAGAAGAAACAGATTATGAAGGG - Intergenic
959794528 3:110408913-110408935 ATGAATAAACAAATTCAGCAAGG - Intergenic
959861303 3:111218159-111218181 GTGAGGAAACAGATTCAGAGAGG + Intronic
960375007 3:116890076-116890098 GTGCAGAAACGGATCCAGGAAGG - Intronic
961062317 3:123840989-123841011 ACGAAGAAACAGATACATGGTGG + Intronic
961141960 3:124563303-124563325 AAGATGAAACTGACTCAGGAAGG - Intronic
961321490 3:126079494-126079516 ATGGAGAAACTGACACAGGATGG + Intronic
961359571 3:126358333-126358355 ATGAAGAAACCGACTCAGAGAGG + Intergenic
961410259 3:126715289-126715311 ATGAAGAAACTGAGTCAGGGAGG - Intronic
961547119 3:127642382-127642404 ATGAAGCAGCAGATTTATGAAGG + Intronic
961687740 3:128646359-128646381 GTGAAGAAACAGTTTTAGGCTGG - Intronic
961983873 3:131111648-131111670 ATGAGGAAACAGGTTCAGAGAGG - Intronic
962444304 3:135451102-135451124 ACCAAGGAACAGCTTCAGGATGG + Intergenic
962500528 3:135986637-135986659 ACCAAGAAACTGAGTCAGGAAGG + Intronic
963376636 3:144474907-144474929 ATGAAGACAAAGAGTCAAGATGG - Intergenic
964450548 3:156808625-156808647 ATGAAGAAACAAATTCAGACAGG - Intergenic
964592366 3:158378893-158378915 GTGAATAAACAGATTTTGGAGGG - Intronic
964837341 3:160954111-160954133 ATGAAGAAACAGACTCAGAGAGG - Intronic
965815238 3:172629379-172629401 GCGAAGAAACACACTCAGGAAGG + Intergenic
966138667 3:176730174-176730196 ATGAGGAAATAGGTTCAGGAAGG + Intergenic
966158715 3:176945936-176945958 AAGATGAAACAGAATGAGGAAGG + Intergenic
966378054 3:179317188-179317210 ATGAAGAAACAGATTTAGGCTGG - Intergenic
966558882 3:181296205-181296227 ATGAGCAAACAGATTCAAGGGGG + Intergenic
966586265 3:181629025-181629047 ATGAAGAAACAGGCTCAGAGAGG - Intergenic
966706002 3:182914651-182914673 TTCAAGAAACAGATTTAGGAGGG - Intronic
967100020 3:186208674-186208696 AGGAAGGAATAGATTCAGGCTGG - Intronic
967199632 3:187060546-187060568 ATGAAGACACATAGTTAGGAAGG + Intronic
967730307 3:192900985-192901007 TTGAAGAAACTGATGAAGGATGG + Intronic
967993861 3:195152199-195152221 ATGAGGAAACAAATTCAAAATGG + Intronic
968580370 4:1388344-1388366 ATGAATAAACAAGTTCAGCAAGG - Intergenic
968687475 4:1971033-1971055 AGGAACAAAGAGATTCTGGAAGG + Intronic
969304936 4:6320170-6320192 ATGAGGAAACTGATTCAGAGAGG - Intergenic
969380081 4:6789639-6789661 TTGCATAAACAGATTCATGATGG + Intronic
969639255 4:8387270-8387292 ATGAGGAAACCGAGGCAGGAAGG + Intronic
969966699 4:11003864-11003886 ATGGAGAAACAGGCTCAGGGAGG + Intergenic
970138730 4:12956447-12956469 ATGAAGAAACAGGCTCAGCAAGG - Intergenic
970294688 4:14615985-14616007 ATGAAGAAATAGAATCGTGATGG - Intergenic
970419787 4:15894991-15895013 ATGAAGAAACTGATTAAAGCAGG + Intergenic
970672760 4:18415320-18415342 ATGAGGAAACAGATTCAGTGAGG - Intergenic
970943480 4:21662736-21662758 ACCAAGAAAAAGATTCAGGCTGG + Intronic
971761883 4:30776607-30776629 CTGAAGAAACGGTCTCAGGAAGG - Intronic
972343050 4:38169255-38169277 ATAAAGAATCCGATACAGGATGG - Intergenic
972437520 4:39047953-39047975 ATAAGGAAATAGATTCAGGGAGG - Intronic
973746976 4:53973295-53973317 AATAAGAAAAACATTCAGGATGG - Intronic
973876299 4:55223093-55223115 ATGAGGAAACAGGTTCAGAGAGG - Intergenic
973972293 4:56225496-56225518 AAGAAGAAACGGGTTCAGGGAGG - Intronic
973996225 4:56462124-56462146 ATGAAGAATCAAAATGAGGACGG + Intergenic
974685927 4:65229229-65229251 AGGAAGAAACAGAAACAGCAGGG - Intergenic
975237157 4:72012653-72012675 AGGAGGAAAAAGATTCATGAAGG - Intergenic
975611049 4:76203707-76203729 ATGAAGGAACAGATGCAGGCTGG + Intronic
975770791 4:77720325-77720347 CTGAAGAAGCAGCTTAAGGATGG + Exonic
975818947 4:78249618-78249640 ATTAAGAAAAACATTCAGGCTGG - Intronic
976120649 4:81777462-81777484 AGAAAGAAACAGAATCAGAAAGG + Intronic
976335016 4:83875578-83875600 ATGCAGAATTAGATACAGGATGG - Intergenic
976496427 4:85735022-85735044 ATGAAGAACTGGATTTAGGAAGG - Intronic
977831360 4:101597466-101597488 AGGAAGAAACAAACTGAGGATGG - Intronic
978067036 4:104417708-104417730 ATGAAGAAACAGATTCAAAGAGG + Intergenic
978160657 4:105543686-105543708 GTGAAGAAACTGAGTCAGGGAGG + Intergenic
978608322 4:110507480-110507502 AGGCAGAAACAGATACAGGGAGG - Intronic
979121088 4:116902670-116902692 ATAAAGAAACAGGTTCAACAAGG + Intergenic
980204264 4:129697556-129697578 AGGAAGAAAAAGATTCAGGAAGG - Intergenic
980706231 4:136499342-136499364 CTGAAGTAAGAGATTCAAGAAGG - Intergenic
980862544 4:138516990-138517012 ATGAGGAAACAGATACAGAGAGG - Intergenic
981399316 4:144294581-144294603 CTGAAGAAACAGATTTAGACAGG + Intergenic
981688905 4:147484318-147484340 ATGAAGCAATAGACTCAGGAGGG - Intronic
982079731 4:151777687-151777709 ATGAAGAAAGAGATACAGGGAGG - Intergenic
982465271 4:155722780-155722802 ATGAAGAAACAGTTTGGGTAAGG + Intronic
983621510 4:169766158-169766180 CAGAAGAAACAGATTTGGGAAGG + Intergenic
984005387 4:174299879-174299901 ATGAAGAAACAGAATTATGAAGG - Intronic
984736478 4:183113268-183113290 ATGTAGAAACAGAGGGAGGAGGG + Intronic
985008990 4:185563019-185563041 ATGAAGAAAAATATTTAGCAAGG + Intergenic
985246718 4:187986457-187986479 AGGAAGACACAGAGACAGGAAGG + Intergenic
985340091 4:188941622-188941644 ATGAAGAAACAAATTTAGAGAGG - Intergenic
985360609 4:189171739-189171761 CTGAAGAAACAGCTCCAGCATGG - Intergenic
985445764 4:190020671-190020693 AGCAAGAAACAGATAAAGGAAGG - Intergenic
986032423 5:3906599-3906621 ATAAAGAGACAGATTGAGGAGGG + Intergenic
986199230 5:5566485-5566507 ATGAAGAAACGGCATCAGAAAGG + Intergenic
986409743 5:7465308-7465330 ATGAGAAAAAAGACTCAGGAGGG - Intronic
986722873 5:10572499-10572521 ATGAAGTTACAGGTTCAGGGAGG + Intronic
986832657 5:11598124-11598146 ATGAGGAAACAGATTCAGAGAGG + Intronic
987040841 5:14060879-14060901 GGGAAGAGACAGATTCAGAAGGG + Intergenic
987112212 5:14698954-14698976 ATGAAGAAACAGATTTAGGGAGG - Exonic
987172023 5:15269125-15269147 ATGAAGAAACAGGCTAAGCAGGG + Intergenic
987184843 5:15406615-15406637 ATGAGGAAATATAGTCAGGAAGG - Intergenic
987255160 5:16143119-16143141 ATGAAGGAACAGAGAAAGGAGGG - Intronic
987300644 5:16594923-16594945 ATGAAGAAAGAGATGAAGTAAGG + Intronic
987448819 5:18055765-18055787 ATGAAGAAATAGTTTCTGGAAGG - Intergenic
988650497 5:33143899-33143921 ATGAAGAAACAAGTTGAGAAAGG + Intergenic
988919786 5:35929679-35929701 ATGAAGTAAGAGATGCAGGAAGG + Intronic
988968031 5:36439547-36439569 ATGAAGGGACAAATTCAGGAAGG + Intergenic
990810733 5:59720049-59720071 TGGAAGAAACAGCTTCAGAAGGG - Intronic
990941086 5:61203740-61203762 AGGAAGAAACACATGCAAGATGG - Intergenic
991336913 5:65559097-65559119 ATGAATAAAGATATTGAGGAGGG - Intronic
992510241 5:77425633-77425655 ATGAAGAAATAGGCTCAGCAAGG - Intronic
992947758 5:81826100-81826122 ATGAGGACACAGGCTCAGGAGGG + Intergenic
993189349 5:84661525-84661547 ATGTAGAAACAGGCTCAGAAAGG + Intergenic
993198017 5:84775364-84775386 ATGAAGAAACAAGTTTAGAATGG + Intergenic
993491151 5:88551689-88551711 ATGAAGAAACAAATACAAAAGGG - Intergenic
993860714 5:93133535-93133557 TTGAAGAACCAGATTTAGGAAGG - Intergenic
993898328 5:93565526-93565548 ATAAAGAAATATATTCTGGAAGG + Intergenic
994036601 5:95208922-95208944 GAGAAGAAACAGATTAAAGAAGG - Intronic
994437193 5:99752072-99752094 ATGAAGAAAGAAATTGAAGAGGG - Intergenic
994572579 5:101533189-101533211 TTGAAAAAACTGATTCAGGCTGG + Intergenic
995584128 5:113629251-113629273 ATGAATAAAGTGATTCTGGAAGG - Intergenic
995662275 5:114498689-114498711 ATGAAGAAAATTATTGAGGAAGG - Intergenic
995752196 5:115464157-115464179 AGGAAGAAACAGCTGCAGTATGG + Intergenic
995798463 5:115965048-115965070 ATGAGGAAACAGACTCAGAGAGG - Intronic
996207631 5:120761142-120761164 ATGAAGCAATAGATACAGGAGGG - Intergenic
996861665 5:128073966-128073988 AAGAAGAAACAGATGCAGAAAGG + Intergenic
997051183 5:130382510-130382532 AAGAAGGATCAGATGCAGGAAGG + Intergenic
997235307 5:132269072-132269094 ATAAAGAAACAGGTTCAGAGAGG + Intronic
997281209 5:132647277-132647299 ATGAAGAAGCAGATTTTGGATGG - Intergenic
997706047 5:135953493-135953515 ATAAAGAAACACATTCAGCTGGG - Intronic
997787212 5:136724429-136724451 ATGTAGAAACATAGACAGGAAGG - Intergenic
997835257 5:137186960-137186982 AGGGAGTAACACATTCAGGAGGG - Intronic
997851603 5:137337962-137337984 ATAGAGAAACAGACTCAGGGAGG - Intronic
998147740 5:139739843-139739865 ATGAAGAAACAGGTCCTGGGAGG + Intergenic
998422349 5:141999163-141999185 AGGAAAACACAGACTCAGGAAGG + Intronic
998630555 5:143893282-143893304 ATGAGTAAACACAGTCAGGAAGG - Intergenic
998987615 5:147778579-147778601 AAGTGGAAACAGATTCAGGGAGG - Intronic
999139963 5:149353900-149353922 ATAAAGAAACAGGCTCAGAAGGG - Exonic
999441772 5:151606754-151606776 AGCATGAAACAGATTCAGGTAGG - Intergenic
999590141 5:153135995-153136017 ATGAAGAAACTGAGTCCAGAAGG - Intergenic
999630953 5:153570983-153571005 ATGAGGAAAGAAATGCAGGATGG + Intronic
999730445 5:154473345-154473367 ATGGAGAAACAGACTCAGGGAGG - Intergenic
999743049 5:154571467-154571489 ATGCAGATTCTGATTCAGGAAGG + Intergenic
1000040528 5:157481499-157481521 ATGAGGAAACAGACTCAAGAGGG + Intronic
1000116035 5:158154233-158154255 ACAAGGAAACAGATTCAGTATGG + Intergenic
1000380199 5:160622213-160622235 ATGAGGAAACAGACCCAGGGAGG + Intronic
1001066789 5:168541228-168541250 AAAAAAAAAAAGATTCAGGATGG + Intergenic
1001143697 5:169166021-169166043 ATAAAGAAACAGAAACAGGGAGG + Intronic
1001176018 5:169469669-169469691 ATGAGGAAACAGAGTCAGAGAGG + Intergenic
1001492108 5:172163246-172163268 ATGAGGAAAAAGATTCAGAGAGG + Intronic
1001832970 5:174805080-174805102 GTGAAGACACAGATGCAGGAGGG - Intergenic
1001899393 5:175412599-175412621 ATGAAAGAATAAATTCAGGATGG - Intergenic
1002033996 5:176451581-176451603 ATGAAGAAACAGGTTCTGAGAGG + Intronic
1002101741 5:176861321-176861343 GTGAGGAAACAGGTTCAGGATGG + Intronic
1003320553 6:5047142-5047164 ACAAAGTCACAGATTCAGGAAGG + Intergenic
1003549408 6:7089137-7089159 ACAAAGCAACAAATTCAGGAAGG - Intergenic
1004027520 6:11833603-11833625 GTGAAGAATCAGAGTGAGGAAGG + Intergenic
1004444124 6:15682165-15682187 TTGAAGAAACAGGCTCAGAATGG - Intergenic
1004458100 6:15810253-15810275 ATCACTAAACAGATTGAGGAAGG + Intergenic
1004589576 6:17036322-17036344 ATTAAGAAACTCAATCAGGAGGG - Intergenic
1006099578 6:31678087-31678109 ATGAGGAAACAGGTGCAGAAAGG - Intronic
1006525142 6:34597869-34597891 AAGAAGAACCACATGCAGGAAGG - Intronic
1006753408 6:36393992-36394014 TTGAAGAAATGAATTCAGGAAGG + Intronic
1006836917 6:37004610-37004632 AGGAAGAAACAGAATCAGAGAGG - Intergenic
1007148308 6:39660201-39660223 ATGAAGAAATAGATGCTTGAGGG - Intronic
1007166963 6:39835608-39835630 ATGAACAAACATATGGAGGAAGG + Intronic
1007367941 6:41407670-41407692 ATGAAAAGACAGACTCAGTAGGG - Intergenic
1007428679 6:41763778-41763800 ATGAGGAAACAGGTTCAGAGAGG + Intergenic
1007643779 6:43364860-43364882 AGGCTGAAACAGATTCAGAAAGG - Intronic
1007744745 6:44036648-44036670 ATGAAGAAACAGACTCTAGATGG + Intergenic
1007990179 6:46246938-46246960 ATGAAGAAACTTATTCATCATGG + Intronic
1008150092 6:47939650-47939672 ATGAGGAAACAGATACACAAAGG - Intronic
1008549751 6:52616917-52616939 ATAAAGAAATAAATTAAGGAGGG + Intergenic
1008639112 6:53443408-53443430 ATTAAGACACAGATTGAGGCTGG + Intergenic
1008702280 6:54115484-54115506 ATGAAGAAACAAATTACGGAAGG + Intronic
1008725201 6:54409069-54409091 ATGAAGAAACAGGCTCAACATGG + Intergenic
1008726019 6:54420553-54420575 ATGAAGAAAGTTATTGAGGAAGG - Intergenic
1009313701 6:62190403-62190425 ATTTAGAAAAAGGTTCAGGAAGG - Intronic
1009329983 6:62406505-62406527 ATGAGGAAAGAGATTAAGAAAGG - Intergenic
1010290055 6:74125233-74125255 ATGAACAAATGTATTCAGGAAGG + Intergenic
1010292035 6:74148398-74148420 ATAAAGAAACAGAAACAGGGAGG - Intergenic
1010455951 6:76055013-76055035 ATGAACAAATAAATTCAGTAAGG + Intronic
1010472722 6:76248918-76248940 AAGCAGAAACTGATTCAAGAAGG + Intergenic
1011018091 6:82781319-82781341 ATGAAGAAAATGATTAAAGATGG + Intergenic
1012074869 6:94670863-94670885 AAGAACAAACAAATGCAGGAAGG + Intergenic
1012347342 6:98207151-98207173 ATGAGAAAACAGGTTCAGAATGG + Intergenic
1012840636 6:104324994-104325016 ATGTAGAAACAGCCTCTGGATGG - Intergenic
1013364438 6:109425173-109425195 ATTAAGAAACTGATTCAGAGAGG + Intronic
1013722543 6:113048373-113048395 ATGAGGAAACAGCTTACGGAAGG - Intergenic
1014816974 6:125946671-125946693 GTAAAGAAAGAGTTTCAGGAGGG - Intergenic
1015774375 6:136798780-136798802 ATGAAGAAACAGGTCCAGAAAGG - Intergenic
1015954743 6:138587974-138587996 ATGAGGAAACAGAACCAGAAAGG + Intronic
1016422133 6:143896562-143896584 ATAAGGAAACAGGTTCAGCAAGG - Intronic
1016474570 6:144413045-144413067 ACAAAGAAACAGATACAGCAGGG - Intronic
1017055392 6:150431432-150431454 ATGTAGAACCAGAAGCAGGAGGG + Intergenic
1017121701 6:151030176-151030198 ATGAGGAAATAAATTCAGGGAGG + Intronic
1017136227 6:151150005-151150027 ATGATAAAACAGATTCAGAAAGG + Intergenic
1017501201 6:155024890-155024912 ATGAAGTGACAGATCCAGAAGGG + Intronic
1017675533 6:156809986-156810008 CTGAGGAATCAGATTCAGGAGGG + Intronic
1018091528 6:160349653-160349675 ATGCAGAAACAGATTACTGAGGG - Intronic
1018162480 6:161059432-161059454 ATGAAGAGAAAGATTTAGGTCGG - Intronic
1018382606 6:163272362-163272384 ATAAACAAACAAATTCAGTAAGG - Intronic
1018653909 6:166013879-166013901 ATGAAGACAAAGATGCTGGAAGG + Intergenic
1019168286 6:170113705-170113727 ATGAAGATACAGATACAGATAGG + Intergenic
1019318947 7:406144-406166 AGGAAGAAGCAGATCCAGCAAGG + Intergenic
1019668791 7:2267094-2267116 ATGGAGAAACAGGCTCAGGGAGG - Intronic
1019845331 7:3493808-3493830 ATGTAGAGACAGATTCAGACTGG - Intronic
1021514639 7:21470866-21470888 ATGGTGAAACAGACTGAGGATGG - Intronic
1022525791 7:31036347-31036369 ATGAAGAAACAGGCTCAGAAAGG + Intergenic
1022756079 7:33292009-33292031 ATGAAGAAACTGAATAAGGGTGG - Intronic
1022797509 7:33743976-33743998 ATGAAGGGAAAGATTGAGGAAGG - Intergenic
1023026165 7:36052031-36052053 TTTAAGAAACACATTCAGTAAGG + Intergenic
1023132623 7:37017987-37018009 ATGAGGAAACAGGTTCAGGGGGG - Intronic
1023274725 7:38506074-38506096 TTGAAGAAACAAATTCTGTATGG - Intronic
1023339419 7:39204071-39204093 ATGATGAGAGACATTCAGGATGG - Intronic
1024515513 7:50251288-50251310 GTGAAGCAATAGATTCATGAAGG + Intergenic
1026363011 7:69620012-69620034 TTGAAGAAGTAGATTCATGAAGG - Intronic
1028070544 7:86444632-86444654 AGGAAAAAAAAGATTCAGCAGGG + Intergenic
1028102353 7:86836832-86836854 ATTAGGAAACAGAGTCAGAAAGG + Intronic
1028385512 7:90248850-90248872 ATGAGGAAACAGACACAGAAAGG - Intronic
1028390262 7:90308147-90308169 ATGAATAAGCAGGTTCAGAATGG - Intronic
1028426652 7:90696906-90696928 GTGAAGAAAGAGTTTCAGGAAGG + Intronic
1028741931 7:94285315-94285337 ATGAAGAAGGTGTTTCAGGAAGG - Intergenic
1028770449 7:94614482-94614504 ATGGAGAAAGAGATCCAGAAGGG - Intronic
1029137435 7:98383855-98383877 ATGAAGAAAGAGCTCCAGGCCGG + Intronic
1029260355 7:99298109-99298131 ATGAGGAAACATGTTCAGCAAGG - Intergenic
1029414177 7:100432719-100432741 AGGAAGAAGCAGAGGCAGGAAGG + Intronic
1030016777 7:105230516-105230538 ATGAAGAAAGAAAGACAGGAAGG + Intronic
1030160360 7:106502159-106502181 CTGCAGAAGCAGAGTCAGGAGGG - Intergenic
1030901141 7:115125396-115125418 AAGAAGAAATAGAATCAGTAGGG - Intergenic
1030955107 7:115843024-115843046 ATGAAGAACATGAGTCAGGAAGG - Intergenic
1031337993 7:120561486-120561508 GTGAGGAAACAGATTCAGAAAGG + Intronic
1031910961 7:127516264-127516286 ATGAAGAAACAGCCTGAGGAAGG - Intergenic
1032252728 7:130271895-130271917 ATGGAGTAGCAGATGCAGGAAGG - Intronic
1032393528 7:131572591-131572613 ATGAAGCAACAGATTAGCGAAGG + Intergenic
1032836937 7:135683353-135683375 AGGAAGAAAAAGTTTCAGGCTGG - Intronic
1033056594 7:138060554-138060576 AGGAAGAAGCAGCTGCAGGATGG - Intronic
1033179742 7:139164320-139164342 ATGAGGAAACAGGCTCAGAAAGG + Intronic
1033734778 7:144211059-144211081 ACTAAAAAACAGACTCAGGATGG - Intergenic
1034054167 7:148016978-148017000 TTGAAGAGAAATATTCAGGAAGG + Intronic
1035234748 7:157489037-157489059 GTGAAGACACAGACCCAGGAGGG + Intergenic
1035321341 7:158031289-158031311 ATGCAGGAAAAAATTCAGGAAGG - Intronic
1035356924 7:158281523-158281545 ATGAAGACACAGATCCAGACTGG + Intronic
1035705499 8:1671499-1671521 ATGGAGAGACAGCTCCAGGAGGG + Intronic
1035906662 8:3518238-3518260 TTGAAGAAACATATTTATGAAGG - Intronic
1036776574 8:11617101-11617123 ATGAACAAACAGAATCAGAGAGG + Intergenic
1036828140 8:11995611-11995633 ATGAGGAAACAGATTTAGAACGG - Intronic
1037318360 8:17620418-17620440 ATGGAGAAAAAGATACAGGGTGG + Intronic
1037895185 8:22647387-22647409 ATGAGGAAGCAGATCCAGAAAGG + Intronic
1037921465 8:22809244-22809266 ACGAGGAAACAGATTCAGGGAGG + Intronic
1038070299 8:24006032-24006054 ATGAAGTAAAAGTTGCAGGATGG + Intergenic
1038129217 8:24710663-24710685 ATGGAGGAACAGAGTAAGGAGGG + Intergenic
1038179058 8:25209470-25209492 ATGAAGAAGCAACTTCTGGAAGG - Intronic
1038272809 8:26089675-26089697 CTGAAGACGTAGATTCAGGAAGG - Intergenic
1038290415 8:26244273-26244295 GTGAGGAAACAGACTCAGAAAGG - Intergenic
1038592282 8:28850651-28850673 ATGAAAAAACAGATGCAGAGAGG + Intronic
1038606855 8:29015337-29015359 AGAAAGAAAGAGCTTCAGGATGG - Intronic
1038618492 8:29117729-29117751 ATTATGAAATATATTCAGGAAGG - Intronic
1038774190 8:30513245-30513267 ATAAAGAAACAAATTCAGCTGGG - Intronic
1038777121 8:30541207-30541229 ATGAGGAAACAGATGCAGAAAGG - Intronic
1038967047 8:32585978-32586000 ATGAAGAAACAGAAACAGAGAGG - Intronic
1039008605 8:33068716-33068738 AGAAAGAAAAAGTTTCAGGATGG - Intergenic
1039405677 8:37310343-37310365 ATGAAGAAACAAATTCCAAAAGG + Intergenic
1039894711 8:41708601-41708623 ATGAATAAACAGAGTCAGAAAGG - Intronic
1040581436 8:48701797-48701819 ATGAAGATGCAGATTGTGGAGGG + Intergenic
1040657098 8:49523389-49523411 ATCAAGCAACAAATTTAGGAAGG - Intergenic
1040740392 8:50567952-50567974 ATGAATACAGAGATACAGGAAGG - Intronic
1041356744 8:57008484-57008506 TTGAAGAAACAGCTTCAAAATGG - Intergenic
1042187617 8:66152633-66152655 CTGTAGAAAGAGACTCAGGAGGG - Intronic
1042767337 8:72338042-72338064 AAGACGTAACAGAATCAGGAAGG - Intergenic
1044162312 8:88935148-88935170 ATGAACATTGAGATTCAGGAGGG - Intergenic
1044533356 8:93333004-93333026 AGGAAGAAACAAAATGAGGAAGG + Intergenic
1044584577 8:93857582-93857604 ATGAGGAAACAGCTTCAAGAAGG - Intergenic
1044911917 8:97068786-97068808 ATGAAGAAACAGACTCATAAGGG + Intronic
1044912094 8:97070941-97070963 AAGAAGAAATATATTCAAGAAGG - Intronic
1045228051 8:100270650-100270672 AGGAAGGAAGAGATTAAGGAAGG + Intronic
1045845343 8:106628411-106628433 ATGAAGAAACAGATTTTGAGAGG + Intronic
1046136542 8:110034573-110034595 ATGAAGACACATTTTCAGGAGGG + Intergenic
1047274472 8:123395539-123395561 ATGAAGAAACGGATTCAAAAAGG - Intronic
1047332946 8:123908860-123908882 ATGACGAAACACATTTTGGATGG + Intronic
1047701360 8:127452502-127452524 AGGAAGAAACAGATCCAGAAAGG - Intergenic
1047724579 8:127672805-127672827 AGAAAGAAACAGATACAGTAGGG + Intergenic
1048511973 8:135071290-135071312 ATGAAGAAATAGGATCAGAAAGG - Intergenic
1048573437 8:135672999-135673021 CTGGAGAATCAGATTCAGGGCGG - Intergenic
1049125714 8:140785784-140785806 ATGAAGAATTAAATTCAGAAAGG - Intronic
1050515903 9:6444524-6444546 TTTAAGAAACAGATTCCTGAGGG + Intronic
1050710899 9:8462040-8462062 ATGAAGAGACAGATTCTGCATGG - Intronic
1050714946 9:8512993-8513015 ATTAGAAAACACATTCAGGAAGG - Intronic
1050791827 9:9481659-9481681 ATGAAGAAAGAGGTCCATGAAGG + Intronic
1051539113 9:18194608-18194630 AAGAAGAAAAAGATGCTGGAGGG - Intergenic
1052519773 9:29531586-29531608 GTGAAGAAACAAATTTGGGAAGG - Intergenic
1052879869 9:33594927-33594949 ATGTAGAAGCAGTTTCAGAAGGG + Intergenic
1053496110 9:38549293-38549315 ATGTAGAAGCAGGTTCAGAAGGG - Intronic
1053665650 9:40315683-40315705 ATGTAGAAGCAGGTTCAGAAGGG + Intronic
1053915233 9:42940730-42940752 ATGTAGAAGCAGGTTCAGAAGGG + Intergenic
1054376806 9:64455713-64455735 ATGTAGAAGCAGGTTCAGAAGGG + Intergenic
1054518964 9:66060601-66060623 ATGTAGAAGCAGGTTCAGAAGGG - Intergenic
1054519394 9:66063548-66063570 ATGCAGGAACAGGTTCAGAAGGG - Intergenic
1054853986 9:69878440-69878462 ATGCTGAAACAGAATCAGGCAGG - Intronic
1054858847 9:69929302-69929324 TTGAAGAAATAGAGTCAGGAAGG - Intergenic
1055046534 9:71931635-71931657 AGGAAGAAACAAATCCAGGCAGG - Intronic
1055081036 9:72267733-72267755 ATCAGGAAACAGGTTCAGAAAGG + Intergenic
1055261451 9:74439529-74439551 ATGAAGATACTGATTCAGTCTGG + Intergenic
1056070531 9:82982186-82982208 ATGAAGAAACAGATCCGACATGG + Exonic
1056071265 9:82989375-82989397 AAGAGGAAACAGATTCTTGATGG - Intronic
1057023840 9:91721285-91721307 AGGAAGCCACAGAATCAGGAAGG + Intronic
1057676033 9:97136811-97136833 ATGTAGAAGCAGGTTCAGAAGGG - Intergenic
1058038834 9:100282476-100282498 AGGAAGAAAGAGTTTCAGAAGGG + Intronic
1058568008 9:106307715-106307737 TTTCTGAAACAGATTCAGGAAGG - Intergenic
1058570225 9:106333870-106333892 ATGAAGAAACAAATGTAGCAAGG - Intergenic
1058581821 9:106466910-106466932 ATGAAGAAACAGATTAAGTAAGG + Intergenic
1058635444 9:107033867-107033889 ATGAAGAAACAGACTAAGGAAGG - Intergenic
1058637682 9:107052347-107052369 ATGAAGAAACAGAGGCACAATGG + Intergenic
1058665492 9:107310822-107310844 ATGAAGAAACAGGCTTAGAAAGG + Intronic
1059026260 9:110635560-110635582 ATGAAGAAAAAGATTTATCAGGG - Intergenic
1059037937 9:110779268-110779290 ATTGAGAAATAAATTCAGGAGGG - Intronic
1059122938 9:111658919-111658941 ATGAGGAAACAGATCCACTAAGG - Intronic
1059206331 9:112469782-112469804 ATGAGGAAACAGACTCAAAAAGG - Intronic
1059384902 9:113956993-113957015 ATGAAGAAACTGAGTCACAAAGG + Intronic
1059521956 9:114951014-114951036 ATGAAATAACAGATTCAGAGAGG - Intergenic
1059691074 9:116686940-116686962 ATGGAAAAACAGATTCAGTAAGG + Intronic
1059757785 9:117309999-117310021 ATGAAGAAACAGGCTCAGAAAGG - Intronic
1059761680 9:117343891-117343913 AAGAAGAAAGAGATCAAGGAAGG + Intronic
1059825240 9:118020799-118020821 ATGAGGAAACAGGTTCAAAATGG - Intergenic
1060000859 9:119957406-119957428 ATAAGGAAACAGATTCAGAGAGG - Intergenic
1060128862 9:121075674-121075696 ATGAGGAAACATGATCAGGAAGG - Intronic
1060256937 9:122039527-122039549 ATGAGGAAACAGATTCAAACAGG + Intronic
1060575150 9:124685111-124685133 ATGAAGAAACAGATTTAGAAGGG - Intronic
1060872700 9:127055599-127055621 ATGAGGAAACAGACACAGAAAGG + Intronic
1061035208 9:128109739-128109761 ATGAAGAAGCAGATTTTGGGAGG - Intergenic
1061048043 9:128177992-128178014 ATGGGGAAACAGACTCAGGAGGG + Intronic
1061379246 9:130244182-130244204 ATGAGGAAACAGCTTCAGAGAGG + Intergenic
1061490702 9:130942368-130942390 ATGAGGAAACTGATTCAGAAAGG + Intergenic
1061655199 9:132084188-132084210 ACAAGGAAACAGATTCAGGGAGG - Intergenic
1185593066 X:1291427-1291449 ATGAAGAAAAAGAGGAAGGAAGG - Intronic
1185745912 X:2573304-2573326 ATGAAGAAACAGAGAAAGTAAGG - Intergenic
1186554344 X:10541802-10541824 ATTAAGAAACAAATAGAGGAAGG + Intronic
1186769987 X:12808258-12808280 ATGTAAAAACACATGCAGGAAGG - Intronic
1186822281 X:13302813-13302835 ATCAAAACACAGATCCAGGAAGG - Intergenic
1186986842 X:15026242-15026264 CTGAAGAGACATTTTCAGGAGGG + Intergenic
1188618188 X:32185347-32185369 GTGAAGAAACAGATTCAGGAAGG - Intronic
1188700278 X:33251118-33251140 ATGAATAAATACATTCAAGAGGG - Intronic
1189273593 X:39768949-39768971 CTGACCAAGCAGATTCAGGAGGG + Intergenic
1190092707 X:47453448-47453470 CAGAATAAACAGATTCAGGGAGG + Intronic
1190756996 X:53409795-53409817 ATGAGGAAACAGGTACAGAAAGG - Intronic
1190772936 X:53530094-53530116 AAAAAGAAAAAGTTTCAGGAGGG - Intergenic
1190889082 X:54553522-54553544 AAGAGGAAACAAATTCAGAAAGG - Intronic
1191006245 X:55714197-55714219 AGGAAGAAACAGATAAAGAAGGG - Intergenic
1191020383 X:55853444-55853466 AAAAAGAAACAGGTTCAGTAAGG + Intergenic
1191765051 X:64689204-64689226 ATAAAGAATCAGGCTCAGGAGGG + Intergenic
1191887728 X:65906213-65906235 ATGAAGAAAGAAATACAGGAGGG + Intergenic
1191900103 X:66032108-66032130 AAGAGGAAACAGAGTCAGAAAGG - Intronic
1192139396 X:68634666-68634688 AAGATGAAACAGATTCATGAAGG + Intergenic
1192252656 X:69425630-69425652 ATGAAGATACAGATTGGAGAGGG - Intergenic
1192681850 X:73260955-73260977 CTGAAGAAGTAGAATCAGGAAGG - Intergenic
1193811055 X:86051877-86051899 ATGAATAAACACATTCAATAAGG + Intergenic
1193824533 X:86206664-86206686 ATGAGGAAAGAGATTTAGCAAGG - Intronic
1193864558 X:86715175-86715197 TTGAGGAAACATGTTCAGGAGGG - Intronic
1193947906 X:87762036-87762058 ATGAAGAAAAAGATTTAAAAAGG - Intergenic
1194022933 X:88716105-88716127 AAAAAGAAATGGATTCAGGAAGG - Intergenic
1194198146 X:90921753-90921775 AGTAATAAACAGATTCAAGAAGG - Intergenic
1195625383 X:107000750-107000772 ATGTAGAAAAATATTCATGAAGG + Intergenic
1195679548 X:107534073-107534095 ATGATGAAACAGGTCCAGAATGG - Intronic
1195781016 X:108464183-108464205 ATGAAGAAAGGGGATCAGGAAGG - Intronic
1196023016 X:111010099-111010121 AGGAAGAAACAGTTTCAGATGGG - Intronic
1196032889 X:111110276-111110298 ATGAAGAAATAGCTTCAGAGGGG + Intronic
1196410686 X:115414962-115414984 ATGATGAAACAGAATTGGGAAGG - Intergenic
1196991563 X:121334947-121334969 ATGAAAAAGCAGATTCAGGCCGG + Intergenic
1197013304 X:121593621-121593643 ATGAAGGAACAGAGGCAGGGTGG - Intergenic
1197680197 X:129374669-129374691 AAAAAGAAACAGATTCAGCGAGG - Intergenic
1197705134 X:129629501-129629523 ATGAAGAAACAGATGCAGAGAGG + Intergenic
1197731207 X:129811616-129811638 TTGAAGAAACACATGCAGCATGG + Intronic
1197735437 X:129847380-129847402 ATGAAGAAATAGTCTCAGAAAGG - Intergenic
1197971093 X:132115822-132115844 ATGAATAAACAGGTTCACGGTGG + Intronic
1198021428 X:132662230-132662252 ATGAACAAACAGATGAGGGAAGG + Intronic
1198260756 X:134962748-134962770 ATAAAGAAATATATACAGGAGGG - Intergenic
1198522362 X:137465854-137465876 ATGAGGAAACAGAGTCAGAGAGG + Intergenic
1199170166 X:144726198-144726220 ATGAAGAGGCAAAGTCAGGAGGG - Intergenic
1199572873 X:149285880-149285902 AGGAAGAAACCTATTCAGTATGG + Intergenic
1199665835 X:150095719-150095741 ATGAGGAAACAGAGACAGGGAGG - Intergenic
1200266565 X:154649319-154649341 CTGGAGACACAGCTTCAGGAAGG + Intergenic
1200343944 X:155429363-155429385 ATGAGGAAACAGAATCAGGTGGG - Intergenic
1200543594 Y:4491078-4491100 AGTAATAAACAGATTCAAGAAGG + Intergenic
1201259195 Y:12141295-12141317 AAGAAAATACAGATTAAGGATGG + Intergenic
1202342344 Y:23882949-23882971 TTGAAAAAGCAGATTCAAGAAGG + Intergenic
1202528425 Y:25787136-25787158 TTGAAAAAGCAGATTCAAGAAGG - Intergenic