ID: 958881000

View in Genome Browser
Species Human (GRCh38)
Location 3:99669832-99669854
Sequence AAAGAGCAGGGATCACACCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 525
Summary {0: 1, 1: 0, 2: 3, 3: 54, 4: 467}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958881000_958881010 -4 Left 958881000 3:99669832-99669854 CCATGGTGTGATCCCTGCTCTTT 0: 1
1: 0
2: 3
3: 54
4: 467
Right 958881010 3:99669851-99669873 CTTTGAGGGGTGGGCTTGGGAGG 0: 1
1: 0
2: 0
3: 37
4: 433
958881000_958881009 -7 Left 958881000 3:99669832-99669854 CCATGGTGTGATCCCTGCTCTTT 0: 1
1: 0
2: 3
3: 54
4: 467
Right 958881009 3:99669848-99669870 GCTCTTTGAGGGGTGGGCTTGGG 0: 1
1: 0
2: 1
3: 20
4: 240
958881000_958881008 -8 Left 958881000 3:99669832-99669854 CCATGGTGTGATCCCTGCTCTTT 0: 1
1: 0
2: 3
3: 54
4: 467
Right 958881008 3:99669847-99669869 TGCTCTTTGAGGGGTGGGCTTGG 0: 1
1: 0
2: 1
3: 30
4: 280

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958881000 Original CRISPR AAAGAGCAGGGATCACACCA TGG (reversed) Intronic