ID: 958881009

View in Genome Browser
Species Human (GRCh38)
Location 3:99669848-99669870
Sequence GCTCTTTGAGGGGTGGGCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 262
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 240}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958881000_958881009 -7 Left 958881000 3:99669832-99669854 CCATGGTGTGATCCCTGCTCTTT 0: 1
1: 0
2: 3
3: 54
4: 467
Right 958881009 3:99669848-99669870 GCTCTTTGAGGGGTGGGCTTGGG 0: 1
1: 0
2: 1
3: 20
4: 240

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958881009 Original CRISPR GCTCTTTGAGGGGTGGGCTT GGG Intronic