ID: 958881009

View in Genome Browser
Species Human (GRCh38)
Location 3:99669848-99669870
Sequence GCTCTTTGAGGGGTGGGCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 262
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 240}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958881000_958881009 -7 Left 958881000 3:99669832-99669854 CCATGGTGTGATCCCTGCTCTTT 0: 1
1: 0
2: 3
3: 54
4: 467
Right 958881009 3:99669848-99669870 GCTCTTTGAGGGGTGGGCTTGGG 0: 1
1: 0
2: 1
3: 20
4: 240

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958881009 Original CRISPR GCTCTTTGAGGGGTGGGCTT GGG Intronic
900083218 1:874634-874656 GCTCTAGGAGGGGTCGGCATGGG + Intergenic
900690520 1:3977857-3977879 GCTGTTGGAGGGGTGGGAGTCGG + Intergenic
901229530 1:7634120-7634142 GCTGTTTGAAGGGTGGGTTGGGG + Intronic
901674480 1:10874950-10874972 GCTCCCTGAAGGCTGGGCTTAGG - Intergenic
902362842 1:15951505-15951527 GCCCTGTGAGGGTGGGGCTTCGG - Intronic
902641680 1:17770566-17770588 GCCCTTTTAAGGGTGGGCTTGGG + Intronic
903251417 1:22056074-22056096 GTTCTGTGAGGGCAGGGCTTTGG + Intronic
903655643 1:24947521-24947543 GGTCTTTGAGGGGTTGGAGTGGG + Intronic
903792140 1:25901157-25901179 CCTCTTTGAGGTGGGGGCTGGGG - Intronic
903990051 1:27260877-27260899 GCTGTTTTAGGGGTGGAATTAGG + Intronic
905868818 1:41391479-41391501 GGACTGTGAGGGGTGGGCTTGGG - Intergenic
907367995 1:53978611-53978633 GCTCTGAGTGGGGTGTGCTTTGG + Intergenic
910077910 1:83301912-83301934 GTTATTTGAGGTGTGGCCTTAGG - Intergenic
912471841 1:109911632-109911654 GCTGTTTGGGGGGTGGGGTGGGG + Intronic
912488384 1:110047133-110047155 GCTCTTTGAGGGCAGGGCCTGGG - Intronic
912957262 1:114164299-114164321 TCTCCTTGAGGGCTGGGGTTGGG - Intergenic
916358706 1:163943130-163943152 GCTCTGTGAGGGTCGGGCTAGGG - Intergenic
917534281 1:175863270-175863292 ACTGTGTGAGGGGTGGCCTTGGG - Intergenic
919844271 1:201631238-201631260 GCTCTTTGATGGGTTGGATGGGG + Intronic
921925012 1:220704076-220704098 GCTCCTGGTGGGGTGGGCTGAGG - Intergenic
922568778 1:226619390-226619412 GCTCAGGGAGGGGTGGGCTCTGG - Intergenic
922620560 1:226985649-226985671 GCTCGATGAGGGGAGGGCTGGGG - Intronic
1063464101 10:6232018-6232040 GTTCTGTGTGGGGTGGGCATGGG + Intronic
1063888286 10:10601888-10601910 GCCCGCTGAGGGGTGGGGTTTGG - Intergenic
1064565889 10:16638567-16638589 GCTCTTTGAGAGGTTCGTTTTGG + Intronic
1065796750 10:29315012-29315034 GATCTTTCAGGGGCTGGCTTAGG - Intronic
1065946324 10:30608436-30608458 GATCTTTCAGGGGCTGGCTTAGG + Intergenic
1065964316 10:30758695-30758717 GCTTATTGAGGGCAGGGCTTGGG + Intergenic
1067536591 10:47114949-47114971 TGTCTTTGAGGGGTGTGCTGGGG - Intergenic
1068083326 10:52346718-52346740 GGTCTTCCAGGGGCGGGCTTTGG - Intergenic
1069908911 10:71748203-71748225 GCTCCTCGCGGGGTGGACTTGGG - Exonic
1071160911 10:82743983-82744005 GATCTTTGTGGTGTGGCCTTTGG + Intronic
1071405227 10:85323476-85323498 GCTCTTTGTGGGGTGATCTCAGG + Intergenic
1071789470 10:88939063-88939085 GCTCTGAGAGGGGTGAGCCTGGG - Intronic
1072035252 10:91557206-91557228 GATCTTTGAGGTTTGGGATTTGG + Intergenic
1072788947 10:98303581-98303603 ACTCTTTGGGGAGGGGGCTTGGG + Intergenic
1073069357 10:100783426-100783448 GCTCTTTGAGGAGGGGCCTGAGG + Intronic
1074356578 10:112790959-112790981 GCCCTTTGAGGAGGGGTCTTTGG - Intronic
1075749688 10:124755616-124755638 GAACTTTGAGGGGTGGGGTAGGG - Intronic
1076032170 10:127168736-127168758 GCTCTTGGAGGGGTGAGCCTGGG + Intronic
1076582034 10:131518134-131518156 GATCGAGGAGGGGTGGGCTTCGG + Intergenic
1077164992 11:1130916-1130938 GCTCCCTGAGGGGTGGGGTGAGG - Intergenic
1078452292 11:11449331-11449353 CCTCAATGTGGGGTGGGCTTGGG - Intronic
1078652639 11:13209966-13209988 ACTCTCTGAGGGATGGGCTGGGG - Intergenic
1078656651 11:13246932-13246954 GCCCTTGGAGGGGTGGGGCTGGG - Intergenic
1081287973 11:41295797-41295819 GTTCTGTGAGGGAAGGGCTTGGG + Intronic
1081957548 11:47106755-47106777 GCTCCTGCATGGGTGGGCTTTGG - Intronic
1083784504 11:64936018-64936040 GCTCTTTGAGGTGCGGTCCTCGG + Intergenic
1084145935 11:67265470-67265492 GCTGGTTGGGGGGTGGGGTTGGG + Intergenic
1090393446 11:126404439-126404461 GCTCTGTGAGGGTTGGAATTGGG - Intronic
1091119838 11:133047694-133047716 GCTCCCTGAGGAGTGGGCTGGGG - Intronic
1091124795 11:133084250-133084272 GGTGTCTGGGGGGTGGGCTTTGG - Intronic
1092856100 12:12675124-12675146 GCTCCTTGAGGCCTGGACTTAGG + Intronic
1093261456 12:16942422-16942444 GCTCTTTAATGAGTGAGCTTTGG + Intergenic
1099335204 12:81347570-81347592 GGGCTTCGAGGGGTGAGCTTTGG + Exonic
1100214580 12:92434567-92434589 GCTCTGTGCAGGGTGGGCTGAGG - Intergenic
1101086404 12:101240775-101240797 GTTCTCTGAGTGGTTGGCTTGGG - Intergenic
1102446129 12:113004185-113004207 TGTCTTTAAGAGGTGGGCTTCGG - Intronic
1103063797 12:117880455-117880477 TCTCTTTGGTGGGGGGGCTTGGG - Intronic
1103194787 12:119034164-119034186 GCTCTCTGTGGTGTGGGCTGAGG - Intronic
1103708641 12:122895200-122895222 GCTCTTTAAGGGTTGGGCGAGGG - Intronic
1104982785 12:132581692-132581714 GGTCTGTGAGGCGTGGGCTGCGG - Intronic
1106047396 13:26155817-26155839 GCACCTTGAAGAGTGGGCTTTGG + Intronic
1106230052 13:27814703-27814725 GCTCTAGGAGGGCAGGGCTTTGG - Intergenic
1107179598 13:37443490-37443512 GTTCCTTAAGGGGTGGGGTTGGG - Intergenic
1108065407 13:46572231-46572253 GCTCTTTATGGGGAGGACTTTGG + Intronic
1108315660 13:49234967-49234989 GCACTTTGAGAGGTGGAGTTGGG + Intergenic
1112247132 13:97745528-97745550 CCTCTTTGAGGGGTGGGAACTGG - Intergenic
1113088554 13:106593269-106593291 CCTCTGTGAGGGTTGGTCTTTGG - Intergenic
1116343130 14:43752503-43752525 CCTCTGTGAGGGGTGGGCATTGG - Intergenic
1117814299 14:59581534-59581556 GCTTTTTCATGGGTGGCCTTGGG - Intergenic
1117953044 14:61101703-61101725 GCTCTTTAAGGCTTGGGCTGTGG - Intergenic
1118145171 14:63126941-63126963 GCACTTTGCGGGGTGGGGTGGGG - Intergenic
1118396881 14:65345175-65345197 GCTCCTTGAGGGCAGGGCCTGGG + Intergenic
1118764033 14:68898321-68898343 GCTGTTTGACAGGTGGGTTTTGG - Intronic
1119774051 14:77237616-77237638 GTTCATTGAGGGTTGCGCTTGGG + Intronic
1120154950 14:81083139-81083161 ACTCTTTGAGGTGTGGACTCAGG + Intronic
1121570008 14:94940443-94940465 GCTCTTTGAGGCAGGGGCTGGGG + Intergenic
1122251364 14:100442119-100442141 TCTTTTGGAGGGATGGGCTTGGG + Intronic
1123031880 14:105455841-105455863 GCACATTGAGGGCTGGGCCTGGG + Intronic
1124254014 15:28126481-28126503 ACTCATTGATGGATGGGCTTTGG - Intronic
1125577099 15:40763634-40763656 TCTCTGAGAGGGGTGGGCTGGGG + Intergenic
1125791953 15:42373761-42373783 GGTCTTTGAGGGGTGGGCCAGGG + Intronic
1126648199 15:50895890-50895912 GCTCTTTGAGGGCAGGGATCAGG - Intergenic
1127474989 15:59324658-59324680 CCTCTGTGGGGGGGGGGCTTGGG - Intronic
1129193501 15:73951308-73951330 GCTCTTGGAAGGAAGGGCTTTGG - Intronic
1129651045 15:77490027-77490049 GCACTTTGAGAGGTGGGAGTGGG + Intergenic
1131168755 15:90161579-90161601 TCTCCTGGAGGGGTGGTCTTGGG + Intronic
1131480268 15:92774722-92774744 GCTAGTTGTGGGGTGTGCTTGGG - Intronic
1132663668 16:1072409-1072431 CGTCTCTGAGGGGTGGGCTGGGG - Intergenic
1133267162 16:4592090-4592112 GCTGTGTGAGGGGTGGTCTGAGG - Intronic
1133635227 16:7658634-7658656 CCTCTTTGAGGGAGGGGATTGGG - Intronic
1134031652 16:10996747-10996769 GCTCTGAGAGGGGTGGACTGTGG + Intronic
1138185095 16:54970787-54970809 GCAGTTTGAGGGGTGGGGTTGGG + Intergenic
1138629800 16:58284476-58284498 GCTCTGTGAGGGCAGGGCTTGGG - Intronic
1139511840 16:67432162-67432184 GCTCTTAGAGAGCTGGGCTCAGG + Intronic
1139833729 16:69821524-69821546 GTTCTGTGAGGTGTCGGCTTTGG + Intronic
1140667994 16:77245180-77245202 GCATTTTGAGGGTGGGGCTTTGG - Intergenic
1142067188 16:88069427-88069449 ACTCTGTGAGGGGAGGGCTCGGG - Intronic
1142196042 16:88739759-88739781 TCTCTGAGAGGGGTGGGCTCAGG - Intronic
1145909978 17:28536859-28536881 TCTTTTTGGGGGGTGGGCATTGG - Intronic
1147944161 17:44070857-44070879 GGGCTCAGAGGGGTGGGCTTTGG + Exonic
1147998560 17:44374922-44374944 GCTCTGGGAGGGGCGGGGTTTGG - Intronic
1148996461 17:51714485-51714507 GCTCTTTGGGAGGTGGGCTGGGG + Intronic
1153245035 18:3065441-3065463 GCTTTTTGAGGGGTGTGGTGGGG + Intergenic
1155645329 18:28070678-28070700 GCTCTGTGAGGGCTGGGAGTGGG - Intronic
1157496095 18:48158507-48158529 GGTCTTGGAGGGGTGGGGTGGGG + Intronic
1157725396 18:49959902-49959924 CTTCTTGGAGGAGTGGGCTTGGG + Intronic
1157760961 18:50265507-50265529 GCTCCTTGAAGGGAGGGCTCAGG + Intronic
1158960422 18:62583680-62583702 CCTCTTGGTGGGGTGGGGTTGGG - Intronic
1159778466 18:72631684-72631706 GCTTTATGAGGGTTGGGTTTTGG - Intronic
1160209653 18:76866296-76866318 GCGTTTTGTGGGGTGGGTTTGGG + Intronic
1161453892 19:4360898-4360920 GCTTTCTGAGGGCGGGGCTTGGG + Exonic
1161645539 19:5451224-5451246 GCTCCTTGAGGGCTGGGCAGGGG + Intergenic
1162374274 19:10295776-10295798 GCACTTTGAGGGGTGGGAGATGG + Intronic
1163271606 19:16257951-16257973 GCTCCTTGAGGACTGGGCTAGGG + Intergenic
1163432425 19:17276298-17276320 GCACTTAGAGGGGTGGGGCTGGG + Intronic
1164171048 19:22725570-22725592 GCTCGCTGCAGGGTGGGCTTAGG - Intergenic
1165336920 19:35177130-35177152 GCTATTTGAGGGGTGAGGTGGGG + Intergenic
1166857379 19:45789609-45789631 GCTCTTTGAGTTCTGGGCTCTGG - Intronic
1166892284 19:46000862-46000884 GCTCTTCGCGGGGTGGGTATGGG + Intronic
1167514659 19:49916117-49916139 GCTGTTTGCTGGGTGGCCTTGGG - Intronic
1168571591 19:57475511-57475533 GTTCTGTGAGTGCTGGGCTTGGG - Intronic
925893379 2:8453887-8453909 GAGCTCTGGGGGGTGGGCTTGGG - Intergenic
927365434 2:22290347-22290369 GCTCTTTGAGGGCAGGGACTGGG - Intergenic
927701918 2:25274538-25274560 GCTCTGTGAGGAGTGGGGTCAGG - Intronic
928431373 2:31221292-31221314 GCTCTGTCTGGGGAGGGCTTGGG + Intronic
928473200 2:31595129-31595151 GCTTTTTGAGGTGTGAGCTTAGG - Intergenic
930644975 2:53896487-53896509 TCTCTTTGGGTGGTGGGATTAGG - Intronic
930694530 2:54397695-54397717 GCTCTTTCAGTGGTGAGCTAAGG + Intergenic
932496386 2:72147810-72147832 GCTCTTTGAGGGCTTGGATCTGG - Exonic
932640767 2:73443618-73443640 GCTCTTTGAGGGTAGAGCTCGGG + Intronic
932885264 2:75543571-75543593 GCTCCTTGCGGGGTGGGGTGGGG - Intronic
934579208 2:95425095-95425117 GCTCTGTGAGTGGTGGGATTCGG - Intergenic
934600238 2:95651629-95651651 GCTCTGTGAGTGGTGGGATTTGG + Intergenic
934618688 2:95791180-95791202 GCTCTTTGCCGGGCAGGCTTGGG + Intergenic
934642205 2:96033377-96033399 GCTCTTTGCCGGGCAGGCTTGGG - Intronic
935632335 2:105222531-105222553 AATCTTTGAGGGGTGGGATCTGG - Intergenic
938286352 2:130120736-130120758 GCCCTTTCTGGGGTGGGCGTGGG - Intronic
938429255 2:131218160-131218182 GCCCTTTCTGGGGTGGGCGTGGG + Exonic
938573539 2:132584063-132584085 GTTTTTTGAGGGGTGGGGTAGGG + Intronic
940762653 2:157754180-157754202 GTTCCTTGAGGTGTGGCCTTAGG - Intronic
941454251 2:165696420-165696442 GTTCTCTGAGGGTTGGGCTGAGG - Intergenic
947837297 2:233184867-233184889 GCTCTTTGAGGTCTGGACCTGGG - Intronic
948456146 2:238105546-238105568 CCTCTTTGAGGAGGGGACTTGGG + Intronic
948616306 2:239201448-239201470 GCTCTGTGTGGCTTGGGCTTTGG + Intronic
1168984058 20:2032482-2032504 GCTCTTGGAGGCGGGGTCTTTGG + Intergenic
1169909663 20:10637097-10637119 GCTCTGAGAAGGGTGAGCTTTGG + Intergenic
1169954058 20:11081900-11081922 GTGCCTGGAGGGGTGGGCTTGGG + Intergenic
1170124939 20:12952192-12952214 GTTCTTTGAGGTGTGAACTTAGG + Intergenic
1173205703 20:40991480-40991502 GCTTTTTGTGGGGTGGGTGTGGG + Intergenic
1173465940 20:43281508-43281530 CCTCCTTGAGGGGTGAGCTGGGG - Intergenic
1173555148 20:43960723-43960745 GCTTTTTGAGGAGTGGCCTTGGG + Intronic
1174705012 20:52646571-52646593 GGTCTTTAAGGGGTGGGGATGGG + Intergenic
1178593583 21:33932626-33932648 GCTATTAGTGGGGTGGTCTTTGG + Intergenic
1179092280 21:38277969-38277991 GTTCTTTGAGGGCAGGGGTTGGG - Intronic
1179185120 21:39079707-39079729 GCTCTTGCAGGGGTGGGGTTGGG - Intergenic
1179469983 21:41603886-41603908 GTTCTTGGAGGGGTGGGATGGGG - Intergenic
1179517571 21:41919434-41919456 CCTCTTTGAGGGGTAGGTTGAGG - Intronic
1179718608 21:43302844-43302866 GTTGTTTGAGGGGTGGACCTGGG + Intergenic
1181319229 22:21991772-21991794 GCTCTGTGAGGGGAGGGCCCAGG + Intergenic
1181495752 22:23286577-23286599 GCTCTTTGGGGGATGGGATGGGG + Intronic
1182359355 22:29737737-29737759 CCTCTTTGAGGGAAGGGCCTCGG - Intronic
1182897376 22:33869836-33869858 GCCCTTTGTGGGGTGGCTTTGGG - Intronic
1184373632 22:44098170-44098192 GCTCTCTGAAGGCTGGGATTGGG + Intronic
1184514523 22:44953911-44953933 TCTCCTGGCGGGGTGGGCTTGGG - Intronic
1185301374 22:50082909-50082931 GCACTTTGAGGGGTGGAGGTGGG - Intronic
950728130 3:14932464-14932486 CCTCTGTGTGGGGTGTGCTTTGG - Intronic
951544023 3:23807239-23807261 GCTGTTTGCGGGGTGGGGTGGGG + Exonic
952396174 3:32922457-32922479 GTACATTGAGGGGTGGGCTGTGG + Intergenic
952949761 3:38513046-38513068 GCCCTTTGAGGGGTGGAGGTGGG - Intronic
953822300 3:46217884-46217906 GTTCCTTGAGGTGTGGCCTTAGG - Intronic
955089164 3:55732324-55732346 GCTCTTTGGTGGGTGGGGTGAGG + Intronic
957931823 3:86888455-86888477 GCTACTTGAGTGGAGGGCTTAGG + Intergenic
958881009 3:99669848-99669870 GCTCTTTGAGGGGTGGGCTTGGG + Intronic
959348865 3:105234839-105234861 GATCTGTGAGCGGTGGGTTTTGG - Intergenic
961997315 3:131259637-131259659 GCTCTCTGAGGGTTTGGCTAAGG - Intronic
962352934 3:134668883-134668905 GTTCTTTGAGGGTTGGGGTTGGG - Intronic
968946727 4:3668863-3668885 GGTTTTTGTGTGGTGGGCTTTGG - Intergenic
970443649 4:16106658-16106680 CCTCTCTCAGGGGTGGGATTGGG - Intergenic
973330074 4:48904045-48904067 GCACTTTGTTGGATGGGCTTAGG - Intronic
975746015 4:77474850-77474872 TCTCTTTTAGGGCTGGTCTTGGG - Intergenic
978851216 4:113339115-113339137 CCATTTTGAGGGGTGGGATTTGG + Intronic
980707880 4:136523259-136523281 GATCTCTGAGTGGTGGGATTAGG - Intergenic
982769609 4:159384922-159384944 CCTCCTTAAGGGTTGGGCTTTGG - Intergenic
982831485 4:160066617-160066639 GCTCTTTGAGGTGTGGCATTAGG + Intergenic
987425400 5:17767090-17767112 GCTCCATGAGGGTTGGGGTTTGG + Intergenic
991367275 5:65882427-65882449 GCTCTCTGTGGGGTGAGCTGAGG + Intergenic
992168131 5:74074764-74074786 GCTCTTTGATGTGTGGCCTCAGG - Intergenic
992379717 5:76225335-76225357 GCTCCTTGAGGGCTGAGCATGGG - Intronic
993379114 5:87185905-87185927 GCTCTTTGGGTGTTTGGCTTGGG - Intergenic
1000040072 5:157478940-157478962 GCTCTGTGAGGCATGGGGTTGGG + Exonic
1002570741 5:180137986-180138008 GCTCGGTGGGGGGTGGGCTGAGG + Exonic
1005447712 6:25941845-25941867 GGTCTTTGGGAGGTGAGCTTAGG + Intergenic
1006485687 6:34339351-34339373 GCTCTTTGAGGGATGGACTGTGG - Intronic
1006668722 6:35716427-35716449 GCTCTGGGAGGGGTGGGCAGAGG + Intronic
1008604310 6:53125096-53125118 CCTCTTGGAGGGGTGGGAATAGG + Intergenic
1011026082 6:82871131-82871153 ACTCTTTAAGTGATGGGCTTTGG - Intergenic
1011943775 6:92875509-92875531 CATTTTTGAGGGGTGGGGTTAGG - Intergenic
1012961763 6:105629808-105629830 GCTCTTTGAGTGTAGGGATTAGG - Intergenic
1013183057 6:107734042-107734064 GTTATTTGAGGAGTGGGCATAGG + Intronic
1015126467 6:129760677-129760699 GGTCTGTGAGGGTAGGGCTTTGG - Intergenic
1016643756 6:146380352-146380374 GCTCTCTGATGGGTGCCCTTTGG - Intronic
1017259489 6:152370295-152370317 GCTCCATGAGGGGAGGGCCTGGG + Intronic
1018089499 6:160333482-160333504 GATGTCTGAGGAGTGGGCTTTGG + Intergenic
1018108012 6:160507361-160507383 TCTCTTTGAGGGGTGAGGTGGGG + Intergenic
1019188279 6:170234059-170234081 GTTCTGTGTGGGGAGGGCTTGGG - Intergenic
1019775970 7:2912460-2912482 GCTCCTTGAGGGCAGGGCTAAGG + Intronic
1020744843 7:12068199-12068221 GCTGTCTGAGGAGAGGGCTTGGG - Intergenic
1020949896 7:14662047-14662069 GCCCGTTGTGGGGTGGGGTTAGG + Intronic
1023835000 7:44062750-44062772 GCCAAGTGAGGGGTGGGCTTGGG - Exonic
1024145621 7:46513697-46513719 GATCTGTGAGGGGAGGGCTAGGG - Intergenic
1025257122 7:57391903-57391925 GCACTTTGGGAGGTGGGCATGGG - Intergenic
1027295685 7:76767108-76767130 GTTATTTGAGGTGTGGCCTTAGG - Intergenic
1027624009 7:80526310-80526332 GCTGGTTGAGAGGTGGGGTTCGG + Intronic
1027796559 7:82700935-82700957 GGTTTTTGAGGGCGGGGCTTGGG + Intergenic
1030065121 7:105653554-105653576 GCTGTTTAAGAGGTGGACTTTGG - Intronic
1030923490 7:115421720-115421742 CCTGTTTGAGGGGTGGGGTGGGG - Intergenic
1034133790 7:148746104-148746126 CCTCTCTGAGGGGTGGGCTTGGG + Intronic
1035702146 8:1644260-1644282 GCTCTTGGTCGGGCGGGCTTAGG - Intronic
1036707554 8:11056526-11056548 GCTCTTTGAGGAGTTGCATTTGG - Intronic
1037707300 8:21326118-21326140 GCTCCTTGGGGGCTGGACTTCGG - Intergenic
1040512654 8:48108660-48108682 GAGCTCTGAGGAGTGGGCTTCGG - Intergenic
1040815159 8:51499980-51500002 GCTCCTTTCTGGGTGGGCTTTGG - Intronic
1040879182 8:52186557-52186579 GCTCTTTCAGGTGTGTACTTAGG - Intronic
1044749906 8:95406232-95406254 GCTCTAAGAGGATTGGGCTTGGG + Intergenic
1046057169 8:109092870-109092892 GGTCTTTGAGAGGTGGGGTCAGG - Intronic
1046490279 8:114943272-114943294 GCTCCTTGAGGCGTGGGGGTGGG + Intergenic
1049431967 8:142569419-142569441 CTTCTTCCAGGGGTGGGCTTGGG + Intergenic
1051684776 9:19646629-19646651 CCTCTTTCAAGGGTGTGCTTAGG + Intronic
1053474115 9:38369777-38369799 GCTCCTTGAGGGCTGTGCTGAGG - Intergenic
1053581319 9:39407375-39407397 GCACTTTGAGAGGTGGGATCGGG - Intergenic
1053845801 9:42235429-42235451 GCACTTTGAGAGGTGGGATCGGG - Intergenic
1054102906 9:60966174-60966196 GCACTTTGAGAGGTGGGATCGGG - Intergenic
1054583456 9:66940686-66940708 GCACTTTGAGAGGTGGGATCGGG + Intergenic
1055286402 9:74732945-74732967 GCTCTTTGGGGGGTGGAGGTGGG + Intronic
1055740387 9:79382127-79382149 CCTCTGGGAGGGGTGGGCTGGGG + Intergenic
1056167296 9:83951779-83951801 GCTCTTTGAGGGTGGTGTTTTGG + Intronic
1056293951 9:85172839-85172861 GCTGTTTGAAGGCTGGGCTTTGG + Intergenic
1057832470 9:98417818-98417840 TCTCTTTGAGGGGGTGGCTTAGG + Intronic
1059751048 9:117247681-117247703 CCTCTTAGAGGTGTGGGCTGTGG - Intronic
1059998201 9:119934137-119934159 GCTCTTTGAGGGTGGGGCTCTGG + Intergenic
1060835615 9:126753297-126753319 ACTCTTTGAGGGCAGAGCTTAGG + Intergenic
1060863643 9:126977420-126977442 GTTGTTTGGGGGGTGGGCCTGGG - Intronic
1060882325 9:127126028-127126050 GTTCTTAGAGGGGTGTACTTGGG + Intronic
1061099155 9:128478966-128478988 GCTCTTAGAGTAGGGGGCTTTGG + Intronic
1061667582 9:132169373-132169395 GCTTTTGGAGGGGTGGTTTTTGG + Intronic
1061861194 9:133469518-133469540 GCTCCCTGAGGGCAGGGCTTGGG - Exonic
1062634048 9:137480688-137480710 GCTCGTTGAGGGGCAGGCTGGGG + Intronic
1186322443 X:8443735-8443757 ACTGTTTGGGGGGTGGGTTTCGG - Intergenic
1186681841 X:11883086-11883108 GCTCTGTAAAGGCTGGGCTTTGG - Intergenic
1186964935 X:14776599-14776621 GCTCTTGGAGAGGTGGGGCTGGG - Intergenic
1188472610 X:30557449-30557471 GTTCCTTGAGGAGTGGTCTTGGG - Intergenic
1189216200 X:39326953-39326975 GCTCTGGGAGGGGAAGGCTTTGG - Intergenic
1189332704 X:40153240-40153262 GGTCTGTGAGGCGTCGGCTTTGG + Intronic
1190740064 X:53282721-53282743 GGGCTTTGAGGGGTGGGCAGAGG - Intronic
1191218339 X:57956603-57956625 GCTTGTTGTGGGGTGGGCGTAGG + Intergenic
1192210256 X:69123355-69123377 ACTCTTTGAGGGGCGGGGTGGGG + Intergenic
1194918889 X:99739508-99739530 GATCTTTGAGGGCAGGGATTCGG - Intergenic
1196652249 X:118179997-118180019 GGTCTCTGAGCGGTAGGCTTGGG - Intergenic
1198087882 X:133297590-133297612 GCTGTCAGAGGGGTGTGCTTGGG - Intergenic
1200357356 X:155565823-155565845 GCCCTTTGGGGGGTAGCCTTTGG + Intronic