ID: 958882183

View in Genome Browser
Species Human (GRCh38)
Location 3:99684904-99684926
Sequence CTGGCGTAATTGCAGTTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 59
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 54}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958882183 Original CRISPR CTGGCGTAATTGCAGTTGGG AGG Intronic
900973799 1:6005604-6005626 CTGGTGTATTTGTAGTTGGAAGG + Intronic
904466226 1:30709161-30709183 ATGGCGTAATTGCATGTGAGAGG - Intergenic
910798852 1:91125172-91125194 CTAGCCCACTTGCAGTTGGGTGG + Intergenic
913488166 1:119352985-119353007 CTGGCTTAATGGAAGTTGGATGG - Intergenic
916466372 1:165078099-165078121 CTGGCTTAATTGGATTGGGGTGG - Intergenic
1063948788 10:11203530-11203552 CTGGCCTGATTCCAGTTAGGTGG - Intronic
1066278390 10:33890848-33890870 CTGGAGTGATAGCTGTTGGGGGG - Intergenic
1076224231 10:128760866-128760888 CCGGCCTAATTGCAGTTTGTGGG - Intergenic
1093480267 12:19597396-19597418 CTTCCGTAACTGCAGATGGGTGG + Intronic
1099620744 12:85000220-85000242 CTGGCGTAGTTGAAGTTTGCTGG - Intergenic
1110610883 13:77486181-77486203 CTGGCTTACTTGGAGCTGGGAGG - Intergenic
1116938612 14:50768593-50768615 CTGGGGTAGGTGCAGTGGGGTGG + Intronic
1117025772 14:51618538-51618560 CTGGAGTAAATGGAGTTAGGAGG + Intronic
1117459351 14:55929317-55929339 TTGGCGAAAATGTAGTTGGGTGG + Intergenic
1120864802 14:89286556-89286578 CTGGGGAAATTGCAGTCTGGTGG - Intronic
1127959322 15:63879252-63879274 CTGGGGCCATTGCAGGTGGGTGG + Intergenic
1138241475 16:55430789-55430811 CTGGTGTAATTGCTCTTTGGTGG + Intronic
1147514413 17:41102130-41102152 CTGGGGTGACAGCAGTTGGGTGG + Exonic
1150237795 17:63607064-63607086 CTGCCCTGATTGCAGTTGGGAGG - Intronic
1151068553 17:71181028-71181050 CAGGCAAAATTGAAGTTGGGTGG - Intergenic
1156356478 18:36346426-36346448 CTGGCCTAATAGCTGTTTGGGGG - Intronic
1156488635 18:37483193-37483215 CTGGTGTTATTGCTGTTGGTTGG - Intronic
1157191463 18:45585740-45585762 CTGGGGTATCTGCAGTAGGGAGG - Intronic
1162893020 19:13747739-13747761 TTGGCGTAAGCGCGGTTGGGCGG + Intronic
928411968 2:31061227-31061249 CTGTTGAAATTGGAGTTGGGTGG - Intronic
929150089 2:38739906-38739928 CTGGTGTAATTTCAGTATGGAGG - Intronic
930171295 2:48254389-48254411 CAGGTGTAAATGCAGGTGGGTGG + Intergenic
930855287 2:56009378-56009400 CTGGGGTATTTGCAGGTGGTGGG + Intergenic
938289780 2:130143030-130143052 CTGAGGTCATTGCAGTGGGGAGG - Intronic
938303014 2:130229371-130229393 CTGGTGTCATGGCAGGTGGGCGG + Intergenic
938466746 2:131529908-131529930 CTGAGGTCATTGCAGTGGGGAGG + Intronic
940640507 2:156341343-156341365 CTGACGGAATTGTACTTGGGGGG + Intronic
943903051 2:193465696-193465718 ATGGCCTGATAGCAGTTGGGAGG + Intergenic
1170524719 20:17226700-17226722 CTGGCCTGATTACAGCTGGGGGG + Intronic
1173047688 20:39528375-39528397 ATGACTTAATTGGAGTTGGGGGG - Intergenic
1173078257 20:39841558-39841580 CTGGGGTAATTGGTGTTTGGAGG + Intergenic
1180019477 21:45112553-45112575 CTGTTCTAAATGCAGTTGGGTGG + Intronic
1183985714 22:41569069-41569091 CTGGGAAAACTGCAGTTGGGAGG + Intronic
958882183 3:99684904-99684926 CTGGCGTAATTGCAGTTGGGAGG + Intronic
960107393 3:113813149-113813171 CTGAAGTACTGGCAGTTGGGAGG + Intergenic
966930590 3:184673092-184673114 CTGGTGGACCTGCAGTTGGGCGG + Intronic
969572936 4:8020635-8020657 TTGGCGAATTTGCAGTTGGTTGG - Intronic
971882368 4:32393870-32393892 CTCACGTAGTTTCAGTTGGGTGG + Intergenic
972492230 4:39598856-39598878 CTGGCTTAGTTGCAGGGGGGCGG - Intronic
977619957 4:99125155-99125177 CTTGCTTCTTTGCAGTTGGGTGG + Intronic
981098066 4:140802022-140802044 CTGTAGTAAATGCAGTTTGGAGG - Intergenic
987838963 5:23198175-23198197 GTGGCCTACTGGCAGTTGGGAGG + Intergenic
991216740 5:64165292-64165314 CTTGACAAATTGCAGTTGGGAGG - Intergenic
1001629167 5:173161726-173161748 CAGGAGTAGTTGCAGTTGGGGGG + Intronic
1032414887 7:131728258-131728280 CAGGTGTAATTGTAGTTGAGGGG + Intergenic
1036993078 8:13621437-13621459 CTGGCATATTTGCTGTTGGTTGG - Intergenic
1039729132 8:40255680-40255702 ATGGCCTAATAGCACTTGGGAGG + Intergenic
1049992204 9:1000593-1000615 CTGGCTTCCTTCCAGTTGGGAGG - Intergenic
1054874657 9:70082744-70082766 CTGGCATAATTACTGTTGGAGGG + Intronic
1055837078 9:80456194-80456216 CTGGTGTCATTGCATTTGTGTGG + Intergenic
1056034609 9:82590690-82590712 CTGGGGTAATTGGAATTGGGAGG - Intergenic
1056483480 9:87030733-87030755 CTGTGGTAATTGCAGTTGGCTGG - Intergenic
1056740987 9:89255278-89255300 CTGGGGGAATTGGAGGTGGGAGG - Intergenic
1192263845 X:69525161-69525183 CTGGGCTAATTGCAGTTGCCTGG + Intronic