ID: 958884500

View in Genome Browser
Species Human (GRCh38)
Location 3:99710657-99710679
Sequence CATGTTAGCACACCTGTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 121}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958884500 Original CRISPR CATGTTAGCACACCTGTGCC TGG (reversed) Intronic
901078780 1:6571917-6571939 CATGTCAGCACCTCTGAGCCAGG - Intronic
903610256 1:24606189-24606211 CAAGTTAGTTCCCCTGTGCCTGG - Exonic
904382374 1:30120021-30120043 CATTCCAGCACACCTGGGCCGGG - Intergenic
906862589 1:49377810-49377832 GATGTAAGCACACCTGTACCTGG + Intronic
918203116 1:182285840-182285862 CAGGTGAGCACTACTGTGCCTGG - Intergenic
924624916 1:245689466-245689488 CATGTTTGCACACCTGCCACAGG + Intronic
1064861738 10:19834205-19834227 CTTTTTAGCACACCTGTTCTAGG - Intronic
1065298108 10:24295823-24295845 CATGCTACCACTCCTGAGCCAGG + Intronic
1065680929 10:28231765-28231787 CCTGTTAGGTCACCTGTGCCTGG - Intronic
1065986726 10:30961436-30961458 CAGGTGTGCACAACTGTGCCTGG + Intronic
1067740465 10:48891638-48891660 CTTGTTAGCACACAGATGCCTGG + Intronic
1067782350 10:49217959-49217981 CCTTTTTGCACACCTGTGCTGGG - Intergenic
1070594759 10:77824746-77824768 CATCTTGGCACTGCTGTGCCCGG + Intronic
1072155093 10:92716705-92716727 GATGTTAGCAGACCTGGCCCAGG - Intergenic
1072420716 10:95289307-95289329 CCTGGTAGCAGACCTGTACCTGG - Intronic
1075554027 10:123416611-123416633 CATGCCACCACACCTGTGCCTGG + Intergenic
1076435594 10:130439034-130439056 CAGGTAAGCAAACCTGAGCCTGG - Intergenic
1078348510 11:10573147-10573169 AATGCTAGCACACCTGTGTGAGG + Exonic
1078600947 11:12730072-12730094 CATGTTAGCAAGCCTGTATCAGG + Intronic
1079363755 11:19791609-19791631 CATGTGAGAACATCTGTGACTGG + Intronic
1081779885 11:45702899-45702921 GCTGTTAGCCCACCAGTGCCTGG + Intergenic
1091151914 11:133336887-133336909 CAAGTTAGCACAGCTATACCTGG + Intronic
1093539335 12:20262372-20262394 CATGATAGCACACCAGGGCAAGG + Intergenic
1100688537 12:97013112-97013134 CTGGTTACCATACCTGTGCCTGG + Intergenic
1102689406 12:114748643-114748665 CAGGTGTGCACAGCTGTGCCTGG + Intergenic
1104967901 12:132517578-132517600 AGTGTGAGCACAGCTGTGCCTGG + Intronic
1110241498 13:73272129-73272151 CTTGTTTGACCACCTGTGCCAGG + Intergenic
1110684872 13:78360088-78360110 CATGTGAGCATATGTGTGCCAGG + Intergenic
1112780757 13:102898171-102898193 CATGTAAGGACCACTGTGCCTGG + Intergenic
1115575100 14:34703487-34703509 CAGGTGAGCACCACTGTGCCTGG + Intergenic
1118057943 14:62101719-62101741 CATGTTATAACACCTGTGAATGG + Exonic
1121734917 14:96211493-96211515 CGTGTGAGCACACCTGTAGCAGG - Intronic
1128880257 15:71236106-71236128 CATGTTAGCACAGCTGAGAGAGG + Intronic
1131883168 15:96880446-96880468 AAGGTTGGCACGCCTGTGCCAGG - Intergenic
1133321955 16:4919650-4919672 CAGGTGTGCACTCCTGTGCCTGG - Intronic
1133801160 16:9086683-9086705 CAGGTGAGCACCACTGTGCCCGG + Intergenic
1136179230 16:28539367-28539389 GATATCAGCACACTTGTGCCAGG + Intergenic
1139658630 16:68404907-68404929 CAAGTCTGCACACATGTGCCTGG - Intronic
1141681952 16:85550060-85550082 CGTGTAATCACACCGGTGCCTGG - Intergenic
1143242825 17:5458468-5458490 CATGCTTGCACACCTGTGTCTGG - Intronic
1144453875 17:15403389-15403411 CATGGGTGCACACCTCTGCCTGG + Intergenic
1145113960 17:20190836-20190858 CACAGTAGCTCACCTGTGCCTGG + Intronic
1154502327 18:15003044-15003066 CATCCCAGCCCACCTGTGCCAGG - Intergenic
1159366286 18:67469502-67469524 CATGTTTGAACACCTGAGCATGG - Intergenic
1159973611 18:74682919-74682941 CATGTATGCACACTTGTGTCTGG + Intronic
1160385945 18:78496314-78496336 CATCTTGGCAAACCTGAGCCTGG + Intergenic
1162723134 19:12674256-12674278 CATCTTAGCATCCCTGTGCATGG + Intronic
1165127810 19:33613102-33613124 CATCTTAGCACATCTGTAACTGG + Intergenic
1165275608 19:34748488-34748510 CTAGTTAACACACCTGTGCTAGG + Intergenic
1167151497 19:47712980-47713002 CAGGTGTGCACCCCTGTGCCTGG + Intergenic
925098417 2:1225868-1225890 CAGCTTAGCACACCTGGGCAGGG + Intronic
928854171 2:35784339-35784361 CTTGTTAGGACACTTGTGCTTGG + Intergenic
931235687 2:60410743-60410765 CATGTTCCCCCTCCTGTGCCTGG - Intergenic
938733621 2:134165863-134165885 CATCTTAACACACATCTGCCAGG - Intronic
938877375 2:135546437-135546459 CTTTTTAGCACAACTGAGCCAGG - Intronic
938970560 2:136427350-136427372 CATGTTAGCACTCCTTTGAAAGG - Intergenic
941645222 2:168033057-168033079 TATGTTGGCAGACCTGTGCCAGG - Intronic
941968622 2:171325464-171325486 CAGGTGAGCACCCCTGTGACAGG + Intronic
944469798 2:200040870-200040892 AATGTTAGCTGACGTGTGCCTGG - Intergenic
946169042 2:217883386-217883408 CCTGTTAGCACAGCTATTCCAGG - Intronic
947678491 2:232007476-232007498 CAGGTGTGCACCCCTGTGCCTGG + Intronic
1173366260 20:42388082-42388104 AATGTTAGCATCCCTGGGCCAGG - Intronic
1174062567 20:47843144-47843166 CATGCCAGCACACCTGTTGCTGG + Intergenic
1174073068 20:47912354-47912376 CATGCCAGCACACCTGTTGCCGG - Intergenic
1174150995 20:48486290-48486312 CATGCCAGCACACCTGTTGCTGG + Intergenic
1176093234 20:63328232-63328254 ATCGTTAGCACACCTGGGCCAGG + Intronic
1178471067 21:32893407-32893429 TCTGTTAGCACTCCTGTGTCTGG + Intergenic
1180027421 21:45175786-45175808 GATGGCAGCACACCTGGGCCTGG + Exonic
1180180614 21:46117264-46117286 CATGTGGGCACCCGTGTGCCAGG + Intronic
1182268550 22:29138114-29138136 AATGTGAGCACATGTGTGCCGGG + Intronic
1183032474 22:35116416-35116438 CCTGTTTCCACACCTGTTCCTGG - Intergenic
1183138643 22:35915198-35915220 TATGTTAGCACACATGTGCAGGG + Intronic
1184648413 22:45908401-45908423 CAGGTGAGCCAACCTGTGCCTGG + Intergenic
1185276756 22:49953247-49953269 CTTGTGTGCACACCTGTCCCAGG - Intergenic
1185412230 22:50688780-50688802 CATGAGAACACACCTGTGCCTGG + Intergenic
950791779 3:15477806-15477828 CCTGATACCACACCTTTGCCTGG + Intronic
954467996 3:50668328-50668350 CAAGATGGCACATCTGTGCCAGG - Intergenic
955860987 3:63330063-63330085 TATGTAGGCTCACCTGTGCCTGG + Intronic
958884500 3:99710657-99710679 CATGTTAGCACACCTGTGCCTGG - Intronic
959637523 3:108591851-108591873 CAAGTGAGCACACCCATGCCCGG - Intronic
966954563 3:184861241-184861263 CATTTTAGCACATCAGTGTCTGG + Intronic
968469348 4:771836-771858 TGTGTTAGTACACCTGTGACCGG + Intergenic
976434484 4:85001664-85001686 CATGCTTGAACAACTGTGCCTGG + Intergenic
980134303 4:128845448-128845470 CATGTTTGCACACCTTCACCTGG - Intronic
980167676 4:129249037-129249059 CATGTTAGTAAACCTTTGCCTGG + Intergenic
981931253 4:150191387-150191409 TAGGTTAGCAAACCTGTTCCAGG + Intronic
983889495 4:173016158-173016180 CACTATAGCACACCTCTGCCCGG - Intronic
985390363 4:189486088-189486110 TATGTAAGTATACCTGTGCCAGG - Intergenic
985934061 5:3080877-3080899 CATGTTAGGACATGTGAGCCTGG + Intergenic
987381607 5:17290615-17290637 CATGTCAGCACTCCTGAGTCAGG - Intergenic
990812597 5:59746191-59746213 CATATTAGAAAATCTGTGCCAGG + Intronic
994959796 5:106584601-106584623 CATGGGAGCACACGTGTGCGTGG + Intergenic
995540535 5:113181991-113182013 CATGTTAGCACATCAGGGCCTGG - Intronic
996268718 5:121576757-121576779 CAACTTAGCACAGTTGTGCCTGG + Intergenic
996417307 5:123224100-123224122 CATGTGAACATAACTGTGCCAGG - Intergenic
1000119013 5:158179076-158179098 AAAGTGAGGACACCTGTGCCAGG + Intergenic
1001799601 5:174531529-174531551 GGTGTGTGCACACCTGTGCCTGG + Intergenic
1003537326 6:6986844-6986866 CATGTTAGGACTCCTGTGGCAGG + Intergenic
1004584991 6:16990560-16990582 CATGTTAGAAAACCTCTCCCTGG + Intergenic
1006716112 6:36121603-36121625 CCTGTTGCCACACCTGTGCTCGG + Intergenic
1007249561 6:40486516-40486538 CATCTCAGCGGACCTGTGCCTGG + Intronic
1008324377 6:50160035-50160057 TCTGTTGGCATACCTGTGCCTGG - Intergenic
1010247361 6:73674048-73674070 CAGGTGAGCACTACTGTGCCTGG - Intergenic
1011727972 6:90229994-90230016 CATATTAGCAAACCTGGGTCTGG + Intronic
1019352990 7:563892-563914 CATGTGTGCACACGTGTGCATGG + Intronic
1023013664 7:35944593-35944615 CATGTGAACACACAGGTGCCAGG - Intergenic
1024077466 7:45829241-45829263 CATGTGAACACACAGGTGCCAGG + Intergenic
1024889737 7:54186185-54186207 AATGCTAGCACACCTGTGTGAGG - Intergenic
1025126944 7:56352166-56352188 CATGTGAACACACAGGTGCCAGG - Intergenic
1026298917 7:69080450-69080472 CAGGTGTGCACCCCTGTGCCTGG + Intergenic
1030228797 7:107183262-107183284 CATATTTGCACACCTGTGAGTGG + Intronic
1031190009 7:118536931-118536953 CATTTTAGCAATCCTGTGACTGG - Intergenic
1032383875 7:131508189-131508211 CGTGTGAGCACACCTGTGTGAGG - Intronic
1035255450 7:157622912-157622934 CTTGGGAGCACACCTGCGCCAGG + Intronic
1035645572 8:1216155-1216177 CATGTTTGCACACATCTGCAGGG + Intergenic
1038652601 8:29419300-29419322 CAGGTGAGCACCACTGTGCCTGG + Intergenic
1042704405 8:71650980-71651002 CATTTTTGCACACATGGGCCAGG - Intergenic
1042786135 8:72549159-72549181 TAAGTTAGCACAGTTGTGCCAGG + Intronic
1044861563 8:96529005-96529027 AATTTTGGCACAGCTGTGCCGGG - Intronic
1045359604 8:101420677-101420699 CAGGTGTGCACAACTGTGCCTGG - Intergenic
1047216550 8:122880630-122880652 CAGGTGTGCACAACTGTGCCTGG - Intronic
1048287450 8:133152921-133152943 CATGTAAGCACACATGTGCACGG - Intergenic
1049992169 9:1000411-1000433 GAAGTGAGCCCACCTGTGCCTGG + Intergenic
1053429513 9:38032853-38032875 CATGGAAGCATACCCGTGCCAGG + Intronic
1057185023 9:93052709-93052731 CATGCTAGGACTCCTGTCCCAGG - Intergenic
1058389099 9:104473973-104473995 CATGAAAGCACACCTGGGGCAGG - Intergenic
1061022781 9:128027006-128027028 CATGTGAACACAGCTGTGTCTGG - Intergenic
1062498165 9:136841314-136841336 CATTCCAGCCCACCTGTGCCAGG + Intronic
1062659750 9:137623561-137623583 CTTGCTACCACGCCTGTGCCTGG + Intronic
1062661860 9:137640552-137640574 CAGGTGTGCACCCCTGTGCCTGG + Intronic
1187279281 X:17845421-17845443 CATCTTAGGACACCAGTGACAGG - Intronic
1190587014 X:51955529-51955551 CATGTTTTCTCACCTGTCCCTGG + Intergenic
1196489423 X:116249185-116249207 CCTGTTATCAGACCTGTCCCTGG + Intergenic