ID: 958889811

View in Genome Browser
Species Human (GRCh38)
Location 3:99770926-99770948
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 4, 3: 21, 4: 148}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958889808_958889811 9 Left 958889808 3:99770894-99770916 CCATGTGATAGAGAGTGACTGGG 0: 1
1: 0
2: 1
3: 19
4: 183
Right 958889811 3:99770926-99770948 TGCCTTCGCCAGAGTGGTCAAGG 0: 1
1: 0
2: 4
3: 21
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type