ID: 958889811

View in Genome Browser
Species Human (GRCh38)
Location 3:99770926-99770948
Sequence TGCCTTCGCCAGAGTGGTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 4, 3: 21, 4: 148}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958889808_958889811 9 Left 958889808 3:99770894-99770916 CCATGTGATAGAGAGTGACTGGG 0: 1
1: 0
2: 1
3: 19
4: 183
Right 958889811 3:99770926-99770948 TGCCTTCGCCAGAGTGGTCAAGG 0: 1
1: 0
2: 4
3: 21
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958889811 Original CRISPR TGCCTTCGCCAGAGTGGTCA AGG Intronic
902135570 1:14301857-14301879 TGCCTTTGGTAGAGTAGTCAAGG - Intergenic
902423962 1:16304642-16304664 TCTCTACTCCAGAGTGGTCAAGG - Intronic
902530862 1:17089833-17089855 TGCCTGGGGCAGAGAGGTCACGG - Intronic
902811838 1:18892451-18892473 TGCTTCAGCCAGGGTGGTCAGGG + Intronic
903374597 1:22858040-22858062 TGCTTTAGCCAGGGTGGTCAGGG + Intronic
903687901 1:25146005-25146027 TGCCTTCCGCAGCTTGGTCAGGG + Intergenic
907324137 1:53625943-53625965 TGCCTTCTCCACAGAGGTCTGGG + Intronic
908536583 1:65084017-65084039 TGCTTTAGCCTGGGTGGTCAAGG + Intergenic
908705084 1:66944807-66944829 TGCCTGAGCCAGGGAGGTCAAGG - Intronic
909061731 1:70886571-70886593 TGCTTTCGACAGATTGATCAAGG - Intronic
912401084 1:109393427-109393449 TGCCTTGGCCAGAGTTGTGGTGG - Intronic
915526304 1:156478388-156478410 TGCCATTCCCAGAGTGGTCCGGG - Intronic
915885445 1:159716601-159716623 TGGCTTCACTAGAGTGGTGAAGG - Intergenic
919668320 1:200314264-200314286 TGCTTTCTCCAGTGTGTTCAGGG - Intergenic
920267429 1:204734522-204734544 TGCCTTATCAAGCGTGGTCAAGG - Intergenic
920404219 1:205697076-205697098 TGCCTCCTCCAGAGTGGGCATGG - Intergenic
920636472 1:207709320-207709342 TGCTTGAGCCAGAGAGGTCAAGG + Intronic
920776114 1:208938781-208938803 TGCCTTTTCCAGAGTTGGCATGG - Intergenic
920893045 1:210012315-210012337 TGTCTTCACCAGATTGTTCAAGG + Intronic
920999435 1:211027551-211027573 TGCCTACACTAGAGTGATCATGG - Intronic
923900820 1:238324408-238324430 TGGCTTCTCCAGTGTGGTCCTGG - Intergenic
1064814898 10:19249701-19249723 AGCCTTAGCTTGAGTGGTCAAGG + Intronic
1071717854 10:88114916-88114938 TGCTTTAGGAAGAGTGGTCAAGG - Intergenic
1073378191 10:103055111-103055133 TGACTGCTCCAGAGAGGTCAAGG + Intronic
1074334768 10:112560403-112560425 TGCTTTAGAAAGAGTGGTCAGGG - Intronic
1075138210 10:119806450-119806472 TGCCATCGCGAGAGTGGTCATGG + Exonic
1075867399 10:125736858-125736880 TGCTTTGGCCAGAGTGGTCAGGG - Intronic
1080067637 11:28037727-28037749 TGACTTCTCCAGAGTGATGAGGG - Intronic
1080599119 11:33805186-33805208 TGCTTTAGCCAGACAGGTCAAGG + Intergenic
1084648457 11:70474294-70474316 TGTCTTCCCCAGGGTGGCCATGG + Intronic
1084872412 11:72107181-72107203 TGCCTGAGCCTGGGTGGTCAAGG + Intronic
1084971044 11:72772213-72772235 TGCCATAGCCATAGTGGGCATGG + Intronic
1084971072 11:72772326-72772348 TGCCATAGCCACAGTGGGCACGG + Intronic
1085104901 11:73833938-73833960 TACCTGAGCCAGAGAGGTCAAGG - Intronic
1085361136 11:75888215-75888237 TGCCGGAGCCTGAGTGGTCAAGG - Intronic
1089242333 11:117092434-117092456 TGCCTCAGATAGAGTGGTCAGGG - Intronic
1090593783 11:128298730-128298752 TTAATTTGCCAGAGTGGTCAGGG - Intergenic
1099141937 12:78989082-78989104 TGGCTTCACCAAAGTGTTCAAGG - Intronic
1101407154 12:104438721-104438743 TGCCTTAGAAAGGGTGGTCAAGG - Intergenic
1102244822 12:111348553-111348575 TGCCTCCTGCAGAGGGGTCAGGG - Exonic
1102953854 12:117046946-117046968 TGCCAAAGCCAGAGGGGTCAGGG + Intronic
1103555064 12:121761363-121761385 TGCCCTGGGCTGAGTGGTCAGGG + Intronic
1103945350 12:124523109-124523131 TCCCTTAGCCAACGTGGTCAGGG - Intronic
1108258889 13:48637530-48637552 TACTTTAGCTAGAGTGGTCAGGG + Intergenic
1109792123 13:67262752-67262774 TGCCCTAGCCAGAGTGGGGAGGG - Intergenic
1110839941 13:80130498-80130520 TGCTTGAGCCAGAGAGGTCAAGG - Intergenic
1113647983 13:112012297-112012319 TGCGTTCCCCGGAGTGTTCACGG + Intergenic
1115103355 14:29730401-29730423 TGCATTCCCCAGAGTGTACAGGG - Intronic
1117467712 14:56010072-56010094 TGCCTGAGCCTGAGAGGTCAAGG - Intergenic
1119790038 14:77341851-77341873 TGCCCTCACCAGGGTAGTCATGG + Exonic
1122199174 14:100111816-100111838 TGCATTCACCAGAGTGGCCTGGG - Intronic
1122229650 14:100299394-100299416 TCCCTCCCCCAGAGTGGCCACGG + Intronic
1122999861 14:105287522-105287544 TGCCTTCCCCCAAGTGGCCAAGG - Intronic
1123470461 15:20548035-20548057 TGCTTTGGCTACAGTGGTCAAGG + Intergenic
1123647598 15:22452665-22452687 TGCTTTGGCTACAGTGGTCAAGG - Intergenic
1124281271 15:28364321-28364343 TGCTTTGGCTACAGTGGTCAAGG + Intergenic
1124301431 15:28547300-28547322 TGCTTTGGCTACAGTGGTCAAGG - Intergenic
1124944046 15:34246728-34246750 CGCCTGAGCCAGAGAGGTCAAGG - Intronic
1126717823 15:51539723-51539745 TGCCTGAGCCGGAGAGGTCAAGG + Intronic
1127484295 15:59405116-59405138 TGGCTTAGACTGAGTGGTCAGGG - Intronic
1129274173 15:74434353-74434375 TGCGTTCGCCTAAGTGGACACGG + Exonic
1131101744 15:89696576-89696598 TGCTTTAGCCAGGGAGGTCAAGG - Intronic
1133101824 16:3484645-3484667 TGCCCTGGCGAGCGTGGTCAGGG + Intronic
1134034831 16:11021711-11021733 TGCTTGAGCCAGAGAGGTCAAGG + Intronic
1134150757 16:11802839-11802861 TACCTTAGCTAGAGTGGACAGGG - Intergenic
1136105745 16:28029088-28029110 TACCTTCTCCACTGTGGTCAAGG + Intronic
1137378388 16:47974873-47974895 TGCCTGAGCCAGAGCGGTCAAGG + Intergenic
1138010128 16:53371661-53371683 TGCTTTGGCTACAGTGGTCAAGG + Intergenic
1138132817 16:54496139-54496161 TACCTTCGTAGGAGTGGTCAGGG + Intergenic
1138556749 16:57775356-57775378 TGCCTTGGCCAGAGTGCTCGTGG - Intronic
1139526990 16:67522916-67522938 TGCTTTCGTCAGGTTGGTCAGGG - Intronic
1146714178 17:35070252-35070274 TGCTTGAGCCAGGGTGGTCAAGG - Intronic
1150160465 17:62893850-62893872 TGCCATTGCCAGAGTGGACTGGG - Intergenic
1152210500 17:79000679-79000701 TGCCAGGGCCAGTGTGGTCAGGG - Intronic
1152580196 17:81162402-81162424 TGCCTGAGCCTGAGTGGTCTGGG + Intronic
1156394909 18:36690638-36690660 TGCAGTGGCCAGAGTGGTGAAGG - Intronic
1157660876 18:49442465-49442487 TGCCTGAGCCTGAGAGGTCAAGG + Intronic
1158146668 18:54322383-54322405 TACTTTTGCCAGAGTGGTGATGG - Intergenic
1160435328 18:78847674-78847696 TGCCCTCGCCACTGTGGCCATGG - Intergenic
1160870721 19:1276522-1276544 TGACTTTGCCAGGGTGGTGATGG - Intronic
1164147571 19:22521409-22521431 TGCCCTCTTCAGAGAGGTCAGGG - Intronic
1164159035 19:22614704-22614726 TGCCCTCTTCAGAGAGGTCAGGG + Intergenic
1165936741 19:39393882-39393904 AGCCTAGGCCAGAGTGGTTAGGG + Intronic
1167280973 19:48568378-48568400 TGCTTTAGCCAAGGTGGTCAGGG + Intronic
925131255 2:1495767-1495789 TGCCTGCACCTGAGTGGTCCCGG + Intronic
925282597 2:2695224-2695246 GGCCTTTTCCTGAGTGGTCAAGG - Intergenic
926336124 2:11864168-11864190 TGCCTTGGCCAGAAGGGTCCTGG - Intergenic
931950337 2:67354769-67354791 TGCTTTCCCCAGTGTGTTCAGGG - Intergenic
932312562 2:70755382-70755404 TGCTTTAGCCAGAGTGGTCAGGG - Intronic
932363804 2:71132537-71132559 TGCTTTGGCTACAGTGGTCAAGG - Intronic
932635231 2:73382344-73382366 TTCCTTAGCCAGAGTTTTCATGG - Intergenic
935148330 2:100411844-100411866 TGCCTTGGGCAGAGTGGTCTGGG + Intronic
937099048 2:119254640-119254662 AGCCTTTGCCACAGTGTTCATGG + Intronic
939945894 2:148410511-148410533 TGCTTGAGCCAGAGTGGTCAAGG - Intronic
940326573 2:152431878-152431900 TGCTTGAGCCAGAGAGGTCAAGG + Intronic
940835600 2:158517830-158517852 TGCCTGAGCCTGAGAGGTCAAGG + Intronic
941637571 2:167951708-167951730 TGCCTGAGCCTGAGAGGTCAAGG + Intergenic
941978123 2:171427673-171427695 TGCTTTAGCCAGAGTGGTCAGGG - Intronic
942955326 2:181766384-181766406 TTCCTTCTCCAGAGTGGGCCTGG - Intergenic
944335742 2:198531742-198531764 TGCCTTAGTCATAGTGGTTAAGG + Intronic
946100982 2:217322943-217322965 TGCCTGAGCCTGAGAGGTCAAGG - Intronic
948301204 2:236908813-236908835 TCCCTTCCCCTTAGTGGTCAGGG + Intergenic
1171081359 20:22188522-22188544 TACCTGCTCCAGAGTGATCACGG - Intergenic
1172637570 20:36420324-36420346 TGCTTTGGACAGTGTGGTCAGGG + Intronic
1173559007 20:43989049-43989071 TGCTATCCCCAGTGTGGTCATGG + Intronic
1173958365 20:47052283-47052305 TGCTTTAGCTGGAGTGGTCAGGG + Intronic
1174077168 20:47945968-47945990 TGCTTTAGCCAGGGTGGTCAGGG + Intergenic
1174202122 20:48814054-48814076 TGCCCTCCCCAGTGTGGTAAGGG + Intronic
1174539111 20:51275391-51275413 TGCATTCACTAGGGTGGTCATGG + Intergenic
1175112355 20:56657585-56657607 TCCCTTAGCGAGAGTGGTCAGGG + Intergenic
1175173528 20:57095666-57095688 TACTTTGGCCAGGGTGGTCAGGG - Intergenic
1175255088 20:57638600-57638622 TGCTTGAGCCAGAGAGGTCAAGG - Intergenic
1176341780 21:5705596-5705618 TGCCTGAGCCTGAGTGGTCAAGG + Intergenic
1176474034 21:7137748-7137770 TGCCTGAGCCTGAGTGGTCAAGG + Intergenic
1176503047 21:7618860-7618882 TGCCTGAGCCTGAGTGGTCAAGG - Intergenic
1176536101 21:8103665-8103687 TGCCTGAGCCTGAGTGGTCAAGG + Intergenic
1179005545 21:37510959-37510981 AGCATCAGCCAGAGTGGTCAGGG + Intronic
1179816261 21:43908282-43908304 TTCCTTCCCCAGAGTCCTCAGGG - Intronic
1184360346 22:44013489-44013511 TGGCTTCGCCGGCGTGGTGAGGG - Intronic
1184513440 22:44946129-44946151 TGCTGGAGCCAGAGTGGTCACGG + Intronic
1203241047 22_KI270733v1_random:20062-20084 TGCCTGAGCCTGAGTGGTCAAGG + Intergenic
952252287 3:31666225-31666247 TGCCTTGGCCAGAGCCCTCAGGG - Intronic
953031427 3:39182432-39182454 TGCCTTAGACGGAGTGGCCAAGG - Intergenic
953604887 3:44405587-44405609 TGCCTAAGCCTGGGTGGTCAAGG + Intronic
955345687 3:58159937-58159959 TGCCTTAACCTGAGAGGTCAAGG + Intronic
958889811 3:99770926-99770948 TGCCTTCGCCAGAGTGGTCAAGG + Intronic
961938842 3:130615888-130615910 TGCTTTGGCAAGATTGGTCATGG + Intronic
963975709 3:151478028-151478050 TGCCTTCTCCAGGGTGTGCAGGG + Intergenic
969545980 4:7828135-7828157 TGGCTTTGCCAGAGTTCTCAAGG - Intronic
971422389 4:26485545-26485567 TGCCTTGCCCAGAGTGGTTGGGG - Intronic
971915841 4:32868804-32868826 TGCTTGAGCCAGGGTGGTCAAGG - Intergenic
973878828 4:55248323-55248345 TACCTTAGTCAGAGAGGTCATGG + Intergenic
978712385 4:111800066-111800088 TGCCTCAGCCAGAGTGGTGGTGG + Intergenic
978752097 4:112261346-112261368 TGCTTGAGCCAGAGAGGTCAAGG + Intronic
981886070 4:149674532-149674554 TGCCTATGACAGAGTAGTCAGGG + Intergenic
985393466 4:189515728-189515750 TGCTTTAGACAGAGTGGTCAGGG + Intergenic
988821061 5:34886300-34886322 TGCCTTCTCCATAGAGCTCAGGG + Intronic
989588416 5:43091274-43091296 TGCTTTCACCAGAGTGGCCTGGG - Intronic
991735018 5:69623947-69623969 TGCTTGAGCCAGAGAGGTCAAGG - Intergenic
991779960 5:70122771-70122793 TGCTTGAGCCAGAGAGGTCAAGG + Intergenic
991811452 5:70479082-70479104 TGCTTGAGCCAGAGAGGTCAAGG - Intergenic
991859247 5:70998201-70998223 TGCTTGAGCCAGAGAGGTCAAGG + Intronic
991872407 5:71123094-71123116 TGCTTGAGCCAGAGAGGTCAAGG + Intergenic
991985779 5:72285181-72285203 TGCCTTAACCAGAGAGATCAGGG - Intronic
998791979 5:145775550-145775572 TGGCTTCTCCAGAGTGCACAAGG - Intronic
1006003537 6:30985298-30985320 AGCCTTGGCCATAGTGATCAAGG + Intronic
1009765478 6:68069114-68069136 GGGCTTTGCCAGAGTGGTCAGGG + Intergenic
1015613562 6:135051571-135051593 TGCTTTACCCAGAGTGGTCAGGG - Intronic
1016270016 6:142277955-142277977 TGTTTTAGCCAGAGTGTTCATGG + Intergenic
1016310958 6:142733025-142733047 TGCCTTCCCTAAAGTGGGCAGGG - Intergenic
1017403524 6:154091904-154091926 TGCCTTGCCCACTGTGGTCATGG + Intronic
1019161197 6:170067934-170067956 GGCCTTTGCCACAGTGGCCAGGG - Intergenic
1024610872 7:51063015-51063037 TGCCTTTGACAGAGTGCTGAAGG - Intronic
1029347744 7:99991046-99991068 TGCCTGCCCCCTAGTGGTCAAGG + Intergenic
1031412653 7:121458046-121458068 TGCCCTCACCAATGTGGTCAGGG - Intergenic
1032691655 7:134293733-134293755 TGCCTAGGCCACAGTGGTGACGG - Exonic
1034510435 7:151530042-151530064 TGCTTGAGCCAGAGAGGTCAAGG - Intergenic
1037244485 8:16817295-16817317 TGCCTTAGCCAGGGAGGTCAAGG - Intergenic
1041466147 8:58159422-58159444 TGCCTTCTCCTGAGTGGTGTGGG + Intronic
1042337217 8:67640892-67640914 TGCCTTCAGCAGGGTGCTCATGG + Intronic
1043598836 8:81915660-81915682 CGCCTAAGCCACAGTGGTCAGGG + Intergenic
1044492374 8:92834621-92834643 AGCCTTCTCCAGAGTGGAGAAGG - Intergenic
1047521029 8:125595608-125595630 TGCCTTGGCCTGAGTGATCAGGG + Intergenic
1048188982 8:132271219-132271241 TGCCTGCCACAGGGTGGTCAAGG + Intronic
1048213716 8:132478262-132478284 TCCCTTCCCCAGACTGGACAAGG + Intronic
1049905756 9:214975-214997 TGCGCTCGGCAGAGTGGCCATGG - Exonic
1053854154 9:42320572-42320594 TCACTTCTCCAGAGTGGGCATGG - Intergenic
1057477061 9:95411802-95411824 TGGCTTCGGCAGATTGCTCACGG - Intergenic
1203457373 Un_GL000220v1:3149-3171 TGCCTGAGCCTGAGTGGTCAAGG + Intergenic
1187521850 X:20021099-20021121 TGCCTTCCCCAGGGTGGACCCGG + Intronic
1187820977 X:23287704-23287726 TGCCTTCTCCATAGGGGTCGAGG - Intergenic
1189727598 X:43983862-43983884 TGCCTTAGCCTGAGTAGTTACGG - Intergenic
1192005255 X:67204776-67204798 TGCCCTCGCCTGAGTGGTCCAGG - Intergenic
1195683487 X:107565609-107565631 TGCCTGGGCCAGAGAGGTCAAGG + Intronic