ID: 958889974

View in Genome Browser
Species Human (GRCh38)
Location 3:99772514-99772536
Sequence CAGGATGTTCATAATGGGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 774
Summary {0: 1, 1: 3, 2: 36, 3: 167, 4: 567}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958889974 Original CRISPR CAGGATGTTCATAATGGGGG AGG Intronic
900079681 1:846505-846527 GGGGATGTTGATAATGGGGGAGG + Intergenic
900360936 1:2288780-2288802 CAGGCTGGTGATAGTGGGGGTGG + Intronic
900578578 1:3396260-3396282 TAGGATATTCATAAAGGGGGTGG - Intronic
900812017 1:4811420-4811442 GATGATATTGATAATGGGGGAGG + Intergenic
901065358 1:6491620-6491642 CAGGATGTGAGTAATGGGAGAGG - Intronic
901274336 1:7979339-7979361 CAGGATGTTGATAGTAGGGGAGG - Intronic
902070855 1:13735652-13735674 TAGGATGTTGATAATGGGGAAGG - Intronic
902424928 1:16312726-16312748 GGGGATGTTGATAATGGGAGAGG + Intronic
903212362 1:21825509-21825531 CAGGATGTCCATACTGTGTGTGG + Intronic
904518593 1:31076513-31076535 CTGGATGTTGATAGTGGTGGAGG + Intergenic
905272481 1:36796020-36796042 CAGGATGCTCCTCATGGGGCTGG + Exonic
906907122 1:49907864-49907886 GAGGATGTTGATAATTGGAGAGG + Intronic
907142267 1:52198824-52198846 GAGGATATTGATAATGGCGGAGG - Intronic
907492570 1:54817512-54817534 CTTGGTGTTCATAATGGGGTTGG + Intronic
907645770 1:56241926-56241948 ACAGATGTTGATAATGGGGGAGG + Intergenic
907882173 1:58560856-58560878 AAGGCTGTTGATAACGGGGGAGG + Intergenic
908022816 1:59915815-59915837 CAGGAAGTTTATTATGGGGCTGG + Intronic
908217599 1:61970313-61970335 CAGGATATTGATAGTGGGAGAGG - Intronic
908238107 1:62166799-62166821 GAGGATGTTGATAATGGGAGAGG - Intergenic
908279233 1:62513032-62513054 GGGGATGTTAATAATGGGGGAGG + Intronic
908562594 1:65321611-65321633 GGGGATGTTGATAATGGGAGAGG - Intronic
908674771 1:66591535-66591557 GGGGATGTTGATAATGGGGGAGG - Intronic
908917294 1:69143483-69143505 GGGGATGTTGATAATGGGGAAGG + Intergenic
909186321 1:72491081-72491103 AGGGATGTTGATAATGGAGGAGG + Intergenic
909252935 1:73381371-73381393 CAGGAAGTTCATAATCATGGTGG - Intergenic
909446040 1:75750129-75750151 CAGGATGATCATATTTAGGGTGG - Intronic
909471088 1:76028898-76028920 GAGGATGTTGGTAATGGGTGAGG + Intergenic
909510361 1:76446265-76446287 ATGGATGTTGATAATGGGGGAGG - Intronic
910136121 1:83972043-83972065 GTGGATGTTGATAATGGGGGAGG - Intronic
910767946 1:90801289-90801311 TGGGATGTTGAGAATGGGGGAGG - Intergenic
910804035 1:91172944-91172966 AGGAATGTTGATAATGGGGGAGG + Intergenic
910997525 1:93123874-93123896 AGGGATGTTGATAATGGAGGAGG - Intronic
911078355 1:93902596-93902618 GGGTATGTTGATAATGGGGGAGG - Intronic
911388276 1:97205090-97205112 CAAGATATTAATAATGGGGAAGG - Intronic
911809607 1:102258599-102258621 GAGGATGTTGATAATGGTGGAGG + Intergenic
912010916 1:104961201-104961223 GAGGATGTTGATAATGGGGAAGG + Intergenic
912136944 1:106672310-106672332 AAAGATGTTGATAATGGGGAAGG + Intergenic
912306427 1:108572350-108572372 CAGGATGTTGCTAGTGGGGGAGG - Intronic
912479624 1:109971440-109971462 AGGGATGTTCATGGTGGGGGAGG + Intergenic
912854478 1:113154843-113154865 CAGAATGTTGATAGTGGGGGAGG - Intergenic
912970844 1:114281593-114281615 GGGGATGTTGATAATGGGGGAGG + Intergenic
913235476 1:116777469-116777491 GGGGATGTTGATAATGGGGAAGG + Intergenic
913294213 1:117303248-117303270 CAGGATGTTGATGATGGGAGAGG - Intergenic
913404967 1:118480240-118480262 GGGGGTGTGCATAATGGGGGAGG + Intergenic
913493377 1:119404075-119404097 CAGGCTGTTGATGGTGGGGGAGG + Intergenic
913507466 1:119530849-119530871 GAGGGTGTTGATAGTGGGGGAGG + Intergenic
913665101 1:121040934-121040956 CAAGATGTTGATAGTGAGGGAGG + Intergenic
914016493 1:143824208-143824230 CAAGATGTTGATAGTGAGGGAGG + Intergenic
914161290 1:145136793-145136815 CAAGATGTTGATAGTGAGGGAGG - Intergenic
914243144 1:145866119-145866141 GAGGATATTGATAATTGGGGAGG + Intergenic
914655110 1:149732748-149732770 CAAGATGTTGATAGTGAGGGAGG + Intergenic
915072823 1:153286217-153286239 GAGGATCCTCATGATGGGGGAGG + Intergenic
915891821 1:159780793-159780815 CTGGATCATCATAATGGGCGGGG - Intergenic
915941138 1:160119096-160119118 CAGGGTGTTGATAGTGGGTGAGG + Intronic
916938080 1:169651433-169651455 GCAGATGTTGATAATGGGGGAGG + Intergenic
916949056 1:169760273-169760295 CGGGATGCTGATACTGGGGGAGG - Intronic
917063144 1:171062895-171062917 GGGGATGTCGATAATGGGGGAGG - Intronic
918557618 1:185822267-185822289 GGGGATGTTGATAATGGCGGAGG + Intronic
918568951 1:185964632-185964654 CATAATTTACATAATGGGGGTGG + Intronic
918979733 1:191540647-191540669 GGGGATGTTGATAATGGGAGAGG - Intergenic
919306944 1:195854032-195854054 AAGGATGTTGACAATGGAGGAGG + Intergenic
920162217 1:204007737-204007759 TGGGATGTTAATAATGGGGGAGG + Intergenic
920165433 1:204032305-204032327 AAGGAGGTTCAGAATGGGTGTGG - Intergenic
920617546 1:207508355-207508377 AAAGATGTTTATAATAGGGGAGG + Intronic
920633922 1:207680169-207680191 AAAGATGTTTATAATAGGGGAGG + Intronic
921039808 1:211419018-211419040 CTGGATGTTGATAGTGAGGGAGG + Intergenic
921279510 1:213551636-213551658 CTGGATGTTGATAGTGGGGGAGG - Intergenic
921658038 1:217764004-217764026 CAGGATGTTGACAGTGGGGAAGG - Intronic
922018888 1:221683892-221683914 GAGAATGTTCATACTGGGAGGGG - Intergenic
922069900 1:222181740-222181762 AAGGGTGTTATTAATGGGGGAGG + Intergenic
922181318 1:223235291-223235313 GGGGATGTGAATAATGGGGGAGG - Intronic
922318297 1:224462097-224462119 GCGGATGGTGATAATGGGGGAGG - Intronic
923158802 1:231300307-231300329 CAGGAGGTTCATAAGGCAGGTGG - Intergenic
923159053 1:231301845-231301867 CAGGAGGTTAATAATGCAGGTGG - Intergenic
923159325 1:231303378-231303400 CAGGAGGTTCATAAGGGAGGTGG - Intergenic
923717681 1:236438775-236438797 CAGGATGCTGACAATGGGGGTGG - Intronic
924167517 1:241300208-241300230 CAGGGTGTTGATAGTGGGGTAGG - Intronic
1062778332 10:175163-175185 TGGGATGTTGATAATAGGGGAGG + Intronic
1063378212 10:5566761-5566783 GAGGATGTTTGCAATGGGGGTGG - Intergenic
1063650987 10:7936612-7936634 GGGGATGTTGATAGTGGGGGAGG - Intronic
1065818643 10:29505737-29505759 GGGGATGTTGATAATTGGGGTGG + Intronic
1065954277 10:30678659-30678681 GGGGATGTTGATAATTGGGGTGG - Intergenic
1067246757 10:44553904-44553926 CAGGATGTGTATAATAGGAGAGG - Intergenic
1067378554 10:45751423-45751445 CAGGATGTGTATACTGAGGGAGG + Intronic
1067397457 10:45935439-45935461 GGGGATGTTGATAATGGGGGAGG + Intergenic
1067529164 10:47057999-47058021 GGAGATGTTGATAATGGGGGAGG + Intergenic
1067761465 10:49050982-49051004 CAGGATGTTGATCATGGGGGAGG - Intronic
1067865775 10:49904525-49904547 GGGGATGTTGATAATGGGGGAGG + Intronic
1067882993 10:50062741-50062763 CAGGATGTGTATACTGAGGGAGG - Intergenic
1067886251 10:50092103-50092125 CAGGATGTGTATACTGAGGGAGG + Intronic
1068037348 10:51777548-51777570 CAGGATTTTGATAGTGAGGGAGG - Intronic
1068590921 10:58852228-58852250 AGGGATATTGATAATGGGGGAGG + Intergenic
1069107296 10:64398568-64398590 GAGGATGTTGATAATGGGGGAGG - Intergenic
1069149136 10:64933732-64933754 GGGGATGTTGATAATGTGGGAGG - Intergenic
1069586923 10:69612730-69612752 CGAGATGTTGGTAATGGGGGAGG + Intergenic
1070412871 10:76160085-76160107 GGGGATGTTGATAAGGGGGGAGG + Intronic
1070852594 10:79579259-79579281 GGGGATGTTCATAATGAGGGAGG + Intergenic
1071049705 10:81431395-81431417 CAAGATGTTGATAGTGGGGGAGG - Intergenic
1071264581 10:83953581-83953603 CAGGTTATTCAGAATGGGTGGGG + Intergenic
1071534770 10:86419338-86419360 CAGGATGTTGATCATGGGGGAGG + Intergenic
1071535124 10:86422175-86422197 CTGGATGTTAATCATGGGGGAGG - Intergenic
1073024440 10:100476837-100476859 TAAGATGTTCACACTGGGGGAGG - Intronic
1073638512 10:105224016-105224038 GAGGATGTTGATAATGGAGGAGG - Intronic
1074146620 10:110722349-110722371 GGGGATGCTGATAATGGGGGAGG - Intronic
1074374856 10:112931940-112931962 CAGGATGTTGATAGTGGGAGAGG + Intergenic
1074523349 10:114244338-114244360 CAGGATGTTCAACAAGGGAGAGG - Intronic
1074562937 10:114550486-114550508 GGGGATGTTGCTAATGGGGGAGG - Intronic
1074918154 10:117979165-117979187 CAGAATGTTGATAGTGGGGTAGG + Intergenic
1075447438 10:122523498-122523520 AGGGATGTTGATAATGGGGGCGG + Intergenic
1075501402 10:122978519-122978541 AAGGATGTTGATAGTGGGGGAGG + Intronic
1076082092 10:127591443-127591465 GAGGATGTTGATAATGGGGAGGG + Intergenic
1076578517 10:131490463-131490485 CAGGAGGTGCAAAATGGGGTAGG + Intergenic
1076852971 10:133102180-133102202 CAGGATGCTCTTACTGTGGGTGG - Intronic
1077475797 11:2789898-2789920 CAGGATGTTAGGATTGGGGGTGG - Intronic
1078282297 11:9914893-9914915 CAGGGTGTTTATAGTGGGGGGGG + Intronic
1078682695 11:13493858-13493880 CAGCATGTTAATTCTGGGGGAGG - Intronic
1078720726 11:13881034-13881056 CAGGAAATCCATAATGGGGCAGG + Intergenic
1078976567 11:16484617-16484639 CAGGATGTCCATCCTGGGGCTGG - Intronic
1079123468 11:17701526-17701548 CAGGATGTTGACAGTGGGGGAGG - Intergenic
1079684784 11:23345322-23345344 CGGGATGTTAATAATGGAGTCGG + Intergenic
1080798429 11:35587514-35587536 GGGGATGTTGATAGTGGGGGAGG - Intergenic
1080812485 11:35718507-35718529 CAGGATGATAATAGTTGGGGAGG - Intronic
1081459542 11:43259222-43259244 GGGGATGTTGATAATGGGAGAGG + Intergenic
1082192326 11:49261592-49261614 GGGGATGTTGATAATTGGGGAGG - Intergenic
1082635721 11:55591009-55591031 AAGGATGTTGATAATGGAGAAGG - Intergenic
1084602829 11:70156366-70156388 CGGGATGTTTCAAATGGGGGTGG - Intronic
1084924194 11:72498835-72498857 GGGGATGTTGATAATGGGGGAGG - Intergenic
1084934203 11:72578435-72578457 CAGGATGTCCAGGATGGGGGAGG - Intronic
1085429360 11:76433754-76433776 CAGGATGTTGATAGTGAGGGAGG - Intergenic
1086288134 11:85272541-85272563 CAGACTGTTAATAATGTGGGTGG - Intronic
1086326391 11:85705513-85705535 TGGGATGTTGATAGTGGGGGAGG - Intronic
1086478247 11:87203136-87203158 CGGGATGTTAATAATGGGGGAGG - Intronic
1086537996 11:87872383-87872405 CAGGATGTTGATGGTGGGGGAGG - Intergenic
1086663159 11:89446936-89446958 GGGGATGTTGATAATGGGGGAGG + Intronic
1086673799 11:89579367-89579389 GGGGATGTTGATAATTGGGGAGG + Intergenic
1087803806 11:102533892-102533914 AGGGATGTTGATAATGGGGGAGG + Intergenic
1087955529 11:104282231-104282253 GAGGATGTTGATAATGGAGGAGG - Intergenic
1088991625 11:114958903-114958925 GAGGATGTTGATAGTGGGGAAGG + Intergenic
1089576225 11:119446295-119446317 GGGGATGTTGATGATGGGGGAGG + Intergenic
1090306029 11:125692107-125692129 CAGGATGTTAATATTGGGGGAGG + Intergenic
1091166365 11:133479813-133479835 AAGAATGTGCACAATGGGGGTGG - Intronic
1091454462 12:596429-596451 GGGGATGTTGATAATGGGGGCGG + Intronic
1091599705 12:1910449-1910471 CAGGATGTTGATAGCGGGGAAGG + Intronic
1093176907 12:15922890-15922912 GGGGATGTTGATAATGGGGGAGG + Intronic
1093437573 12:19153537-19153559 CAAGATGTCCACAGTGGGGGAGG - Intronic
1094215341 12:27935021-27935043 GGGGATGTTGATAATGGGGAAGG + Intergenic
1095256205 12:40039744-40039766 GAAGATGTTGATAATTGGGGAGG - Intronic
1095325773 12:40890276-40890298 CGGGATGTTGACAGTGGGGGAGG - Intronic
1095681349 12:44980139-44980161 GGGGATGTTGATACTGGGGGAGG - Intergenic
1096728506 12:53585402-53585424 CAGTATGTTGACAGTGGGGGAGG + Intronic
1097256515 12:57679914-57679936 CAGGATGTTGACAGTGGGGGAGG + Intergenic
1097407778 12:59212006-59212028 CTGGATGTTGATAGTGGGGAAGG - Intergenic
1097437159 12:59563964-59563986 GAAGCTGTTGATAATGGGGGAGG + Intergenic
1097497026 12:60352727-60352749 GAGGATGTTGATAATGAAGGAGG - Intergenic
1098069356 12:66655410-66655432 TGGGATGTTGATAGTGGGGGAGG - Intronic
1098656392 12:73035689-73035711 GAGGATGTTGATACTGGGGGAGG - Intergenic
1098974063 12:76883886-76883908 CAGGATGTTGGAGATGGGGGAGG - Intergenic
1099403796 12:82234456-82234478 CAGGCTCTTCATATTGGGGATGG + Intronic
1100636957 12:96443713-96443735 TAGGATGTTGATGGTGGGGGAGG - Intergenic
1100852822 12:98731247-98731269 GGGGATGTTCATAATGGAAGAGG - Intronic
1100911764 12:99372190-99372212 GGGGATGTTCATGATGGGGGAGG + Intronic
1100992091 12:100262096-100262118 CAGGATGTTGATAATGGGGAAGG + Intronic
1101102446 12:101407636-101407658 CAGGGGGTTCATCATGGGTGAGG - Exonic
1101649435 12:106661474-106661496 AGGGATGTTGTTAATGGGGGAGG - Intronic
1101786319 12:107886700-107886722 CAGGATGTGGATAAAGTGGGAGG + Intergenic
1102643511 12:114387724-114387746 CAGGATGTCCATGGTGGGGGTGG + Intronic
1102824571 12:115937179-115937201 CAGGATGTTGATGATGGGGGAGG + Intergenic
1102896930 12:116605731-116605753 CAGGATGTTGATGGTGGTGGAGG - Intergenic
1103943856 12:124515431-124515453 CAGGATGTTATTCTTGGGGGAGG - Intronic
1104182958 12:126399914-126399936 GTGGATGTTGATAGTGGGGGAGG + Intergenic
1105654266 13:22418484-22418506 GAGGAGGTTGATAATGGGGAGGG + Intergenic
1105670478 13:22608005-22608027 CAGGATGCTGATAGTGGGGGAGG + Intergenic
1106110255 13:26771001-26771023 AAGGATGTGGATAATGGGGGAGG + Intergenic
1106173908 13:27312004-27312026 CAGGATGCTGCTAGTGGGGGAGG - Intergenic
1106175219 13:27324500-27324522 CAGGATGTTGATAGTCGGGGAGG + Intergenic
1106939261 13:34759159-34759181 CTGGATGTTAATAGTGGGAGGGG - Intergenic
1107044595 13:35981419-35981441 CTGGATGTTGATAGTGGGGGAGG - Intronic
1107415632 13:40197574-40197596 CAGGATATTGACAGTGGGGGAGG + Intergenic
1107448870 13:40491005-40491027 GAGGATGTTCATAGCTGGGGAGG + Intergenic
1108042419 13:46351542-46351564 CAGCACATTTATAATGGGGGTGG + Intronic
1108827507 13:54432575-54432597 CAGGATGTGGATAAGGGGAGGGG + Intergenic
1109358009 13:61257461-61257483 CAGTAAGTTGATAATGAGGGAGG - Intergenic
1109988450 13:70020960-70020982 GGGGATGTTGATAATAGGGGAGG - Intronic
1110202959 13:72874857-72874879 GGGGATGTTCATAATGGGGTAGG - Intronic
1110458594 13:75718571-75718593 GGGGACGTTGATAATGGGGGAGG - Intronic
1110473106 13:75882759-75882781 CAGGATGTCCAGAATGAGTGTGG + Intronic
1110753432 13:79143103-79143125 TGGGATGTTGATAGTGGGGGAGG - Intergenic
1110782290 13:79480721-79480743 GGGGATGTTGATAATGGTGGGGG + Intergenic
1110783973 13:79501367-79501389 GGGGATGTTGTTAATGGGGGAGG + Intronic
1110873496 13:80480398-80480420 GGGGATGCTGATAATGGGGGAGG - Intergenic
1111330591 13:86759250-86759272 CACCTAGTTCATAATGGGGGTGG + Intergenic
1111533081 13:89565559-89565581 CAGGATGTTGACAGTGGGGCAGG + Intergenic
1111599957 13:90460382-90460404 GGGGATGCTGATAATGGGGGAGG - Intergenic
1111605039 13:90526890-90526912 CAGAATGTTGATAATGGGGGAGG + Intergenic
1111807355 13:93054085-93054107 CAGGATGTTGATAGTGAGGGAGG + Intergenic
1112240983 13:97680719-97680741 GGAGATGTTGATAATGGGGGAGG - Intergenic
1112586573 13:100723676-100723698 CAGGTTGTTCTTCATGGTGGGGG + Intergenic
1113237588 13:108297745-108297767 GGGGATTTTGATAATGGGGGAGG - Intronic
1113414465 13:110117562-110117584 CAGGAGGTTCAGAAGGCGGGAGG + Intergenic
1113971290 13:114192289-114192311 GGGCATGTTGATAATGGGGGAGG + Intergenic
1114212716 14:20629006-20629028 CAGGATGTCCTTGATGAGGGAGG - Intergenic
1114239431 14:20852651-20852673 GGGGATGTCGATAATGGGGGAGG + Intergenic
1114358600 14:21943494-21943516 GTGGATGTTGATAATGGGAGAGG - Intergenic
1114546165 14:23503216-23503238 GGGGATGTTGATAATGGGGGAGG - Intronic
1115169562 14:30489039-30489061 ATGGACGTTGATAATGGGGGAGG + Intergenic
1115833940 14:37376117-37376139 CAGGATGTTGATAGTGGGAGAGG - Intronic
1116218037 14:42045505-42045527 GGGGATGTTGATAATGGGGGAGG - Intergenic
1116276223 14:42836141-42836163 GGGAATGTTGATAATGGGGGAGG + Intergenic
1116577945 14:46599477-46599499 GAGGATTTGAATAATGGGGGTGG + Intergenic
1117625417 14:57632576-57632598 GGGAATGTTGATAATGGGGGAGG - Intronic
1117794352 14:59376871-59376893 GGGGATGTTGATAATAGGGGAGG + Intergenic
1117927996 14:60805339-60805361 CAGGATGTTAATAATGGGGGAGG - Intronic
1118295099 14:64561261-64561283 CAGGAAGTTCAAGCTGGGGGAGG - Intronic
1118534718 14:66748457-66748479 AAGAATGTTGATAATGGGGGAGG - Intronic
1119028941 14:71176415-71176437 GGGGATGTGGATAATGGGGGAGG - Intergenic
1119197743 14:72729983-72730005 GAGGATGTTGATCATGGGGGAGG + Intronic
1119896186 14:78221703-78221725 TAGGTTGTTCATAGTTGGGGTGG + Intergenic
1120690116 14:87582952-87582974 CAAAATGTTAATAATGGGAGAGG + Intergenic
1120837519 14:89054763-89054785 GGGGATGTTGATAATGGGGGAGG + Intergenic
1122569571 14:102686367-102686389 CAGGATGTTCACACTGGGGGAGG - Intronic
1123206018 14:106714171-106714193 CAGGATGGTCGTAGTGGAGGAGG + Intergenic
1123211102 14:106761578-106761600 CAGGATGGTCGTAGTGGAGGAGG + Intergenic
1123972781 15:25524470-25524492 GGGGATGTTGATGATGGGGGAGG + Intergenic
1124181275 15:27477626-27477648 CAGGATATTGACAATGGAGGAGG + Intronic
1124723957 15:32138463-32138485 GGGGATGTTGATGATGGGGGAGG - Intronic
1125060346 15:35413045-35413067 GGGGAGGTTGATAATGGGGGAGG + Intronic
1125234361 15:37495388-37495410 GGGGATGTTGATAATGGAGGAGG - Intergenic
1125278217 15:38016122-38016144 GGGGGTGTTGATAATGGGGGAGG + Intergenic
1125278820 15:38022718-38022740 GGAGATGTTGATAATGGGGGAGG + Intergenic
1125312351 15:38393789-38393811 CTGGATGTTGATATTAGGGGAGG + Intergenic
1125742440 15:41975116-41975138 CAGGATGTTGATAGTGGGGGAGG - Intergenic
1125779785 15:42254902-42254924 CAGTATGTTGACGATGGGGGAGG + Intronic
1125897746 15:43316736-43316758 CAGGATGTTCATCAGAGGGAGGG + Intergenic
1126017427 15:44365899-44365921 GGGGATGTTAATAATCGGGGAGG + Intronic
1126419198 15:48453713-48453735 GAGGATGCTGATGATGGGGGAGG + Intronic
1126641910 15:50836154-50836176 TAGGATGTCCATAGTGGGTGAGG - Intergenic
1126833029 15:52629281-52629303 GAGGTTGTTCATAATCGAGGAGG - Intronic
1127046829 15:55034737-55034759 CAGCATGTTCTTAATGTGTGTGG - Intergenic
1127068042 15:55260989-55261011 TGGGATGTTGATAGTGGGGGAGG + Intronic
1128023183 15:64411370-64411392 AGGGATGCTAATAATGGGGGAGG + Intronic
1128639656 15:69326825-69326847 CAAGATGTTAATAACGGGGGTGG - Intronic
1128711887 15:69878383-69878405 AAGGATGATGATAATGGAGGGGG + Intergenic
1130035907 15:80361280-80361302 AAAGATATTCATAGTGGGGGTGG + Intronic
1131013154 15:89035505-89035527 CAGAATGTTGATAGTGGGGGAGG - Intergenic
1134015308 16:10883930-10883952 CTGAGTGTTCATCATGGGGGAGG - Intronic
1135159437 16:20080624-20080646 CAGGATGTTGATAATAGGGGAGG - Intergenic
1135231640 16:20714040-20714062 CAGAATATTCATAATGGATGAGG + Intronic
1135433621 16:22409030-22409052 GGGGATGTTGACAATGGGGGAGG - Intronic
1135914286 16:26591040-26591062 CAGGATGTTAATAATAGGGGAGG + Intergenic
1136408931 16:30065452-30065474 CAGAATGTTGGCAATGGGGGAGG - Intronic
1137238647 16:46636272-46636294 GGGGCTGTTGATAATGGGGGAGG + Intergenic
1137628761 16:49927305-49927327 GAGGATGTTGATAATGAAGGAGG + Intergenic
1138356123 16:56381882-56381904 AGGGATGTTGATAATGGGGAAGG + Intronic
1138429344 16:56958624-56958646 CAAGATGTTCATAATGAGGCCGG + Intergenic
1139232915 16:65303696-65303718 CAGGATGTCAATAGTGGGGGAGG + Intergenic
1139499955 16:67354687-67354709 CAGGATGTCCATAGTCAGGGAGG - Intronic
1139608947 16:68040805-68040827 GTGGATGTTCTTACTGGGGGTGG + Intronic
1141177545 16:81730720-81730742 CAGGATGCCCAGAATGGGCGGGG + Intergenic
1141838337 16:86557794-86557816 CAGGATGTTGATAGTGGGGGAGG - Intergenic
1143143795 17:4759911-4759933 CCGGATGTTGATAGTGGGGGAGG - Intergenic
1143149757 17:4800510-4800532 CAGAATGTTGACAGTGGGGGAGG - Intergenic
1144149138 17:12426646-12426668 GAGAATGTTCATAATCGGGGAGG + Intergenic
1144245288 17:13356786-13356808 GAGGATGTTGATAGTAGGGGAGG - Intergenic
1145108254 17:20138319-20138341 GGGGATGTTGATAATGGGAGAGG - Intronic
1145229378 17:21161260-21161282 AGGGATGTGGATAATGGGGGAGG + Intronic
1146091142 17:29879491-29879513 GGAGATGTTGATAATGGGGGAGG - Intronic
1148023166 17:44567003-44567025 AGGGATGTTGATAATGGGGAAGG - Intergenic
1148034474 17:44648484-44648506 CAGGATGCTGATATTGGGGGAGG + Intergenic
1148129173 17:45252812-45252834 CAGGATGTCCATGGCGGGGGAGG + Intergenic
1149999376 17:61423925-61423947 GGGGATGTTGAAAATGGGGGAGG + Intergenic
1150061082 17:62068678-62068700 GGGGATGTTGATAATGAGGGAGG + Intergenic
1150680988 17:67284326-67284348 GGGGATATTGATAATGGGGGAGG + Intergenic
1150923928 17:69513065-69513087 CAGGAAGTTTATACTGTGGGTGG - Intronic
1151044211 17:70900282-70900304 ATGGATATTAATAATGGGGGAGG + Intergenic
1151087429 17:71396958-71396980 GAGGATTTTGATAATGGGGGAGG + Intergenic
1151516031 17:74596513-74596535 GGGGATGTTGATAATGGGGGAGG - Intergenic
1151532925 17:74718963-74718985 GAGGGTGTTGATAATGGGGAAGG + Intronic
1152426856 17:80222731-80222753 CAGGAGGGACATAATGGCGGTGG - Exonic
1153029590 18:701342-701364 CAGAATGTTGATAATGAAGGAGG + Intronic
1153404999 18:4727852-4727874 TGGGATGTTGCTAATGGGGGAGG + Intergenic
1153792618 18:8593768-8593790 GAGGATGCTGCTAATGGGGGAGG + Intergenic
1154398659 18:14013689-14013711 GGGGATGTTGATAGTGGGGGAGG - Intergenic
1155564369 18:27117341-27117363 AGGGATGTTGAAAATGGGGGAGG - Intronic
1155764409 18:29609615-29609637 GAGGATGTTCATAATGGAGGCGG - Intergenic
1155856013 18:30835467-30835489 GAGAATGTTGATAATGGGGAAGG + Intergenic
1155985176 18:32222859-32222881 CAGGATGTTGATAGCGGGGGAGG - Intronic
1156146444 18:34186964-34186986 CAGGATGTTGATAGCAGGGGAGG - Intronic
1157640695 18:49210751-49210773 CAGGATGTTGATAGTGGGGGAGG + Intronic
1157750672 18:50175245-50175267 AAGGATGATCATGATGGTGGAGG - Intronic
1158382822 18:56953106-56953128 GAGGATATTGATAGTGGGGGAGG + Intronic
1158519505 18:58159444-58159466 CAGGATGTTGATCATGGGGGAGG + Intronic
1158730956 18:60022036-60022058 GGGGATGTTGGTAATGGGGGAGG - Intergenic
1159690579 18:71482768-71482790 CAGGAAGTTCAAACTGGGTGTGG - Intergenic
1159736511 18:72105611-72105633 TGGAATGTTGATAATGGGGGAGG + Intergenic
1159818288 18:73105593-73105615 GGGGATGTTGATAATGGAGGAGG - Intergenic
1159907792 18:74113490-74113512 CAGGATATTAATAATGGGAGAGG + Intronic
1160162603 18:76485619-76485641 CAGAATGTTAAAAATGGAGGTGG + Intronic
1160468524 18:79104304-79104326 CAGGATGTTCATAGAGGAAGTGG + Intronic
1162116826 19:8435438-8435460 AACGATGTTAATAGTGGGGGAGG - Intronic
1162703625 19:12538921-12538943 CAGTATGTTAAAAATAGGGGAGG + Intronic
1162746120 19:12799700-12799722 CAGGATGTTTCTAATGTGGTAGG - Intronic
1164534023 19:29071056-29071078 CAGGATGTTGATAGTTGGGGAGG + Intergenic
1164689008 19:30194015-30194037 CAGAAGCTTCATACTGGGGGAGG - Intergenic
1164715201 19:30385769-30385791 CAGGAGATTCATGATGGAGGCGG - Intronic
1165613924 19:37182047-37182069 GGGGATGTTGATGATGGGGGAGG + Exonic
1165731127 19:38145595-38145617 CAAGATGTTAACAATAGGGGAGG - Intronic
1167764947 19:51475856-51475878 GGGGCTGTTGATAATGGGGGTGG + Intergenic
1167839990 19:52107979-52108001 GAGGATGTTGACAATGGGGAAGG + Intergenic
1167975066 19:53219540-53219562 TGGGTTGTTAATAATGGGGGAGG - Intergenic
1168329324 19:55557551-55557573 GGGGATGTTGATAGTGGGGGAGG - Intergenic
924971839 2:135583-135605 GGTGATGTTGATAATGGGGGTGG + Intergenic
926780874 2:16470770-16470792 GGGGATGTTGATAATGGGGGAGG + Intergenic
927671855 2:25075015-25075037 CAGGATGTTCACACTAGGGGAGG - Intronic
927918689 2:26954115-26954137 TAGGATGTTAGTAATAGGGGAGG - Intergenic
928020766 2:27703036-27703058 GGGAATGTTGATAATGGGGGAGG - Intergenic
928306983 2:30178338-30178360 CAGGCTGTTCCCAATGGGAGGGG - Intergenic
929344844 2:40869426-40869448 CGGGATGTTGATAATGGGAGAGG - Intergenic
929734165 2:44527789-44527811 GAGTATATTGATAATGGGGGGGG - Intronic
931276815 2:60751369-60751391 CAGGATGTTGATAATGGAGGAGG + Intergenic
931662365 2:64577981-64578003 AAGGGTGTTCTTAATGGTGGTGG - Intronic
931965501 2:67529216-67529238 CAGGATGTCTATAATGGGGGAGG + Intergenic
932488920 2:72106071-72106093 GGGGATGTTAATAATGGGGGAGG - Intergenic
932515684 2:72345891-72345913 CAGGGTGTTGATAGTGGAGGAGG + Intronic
932636944 2:73397857-73397879 CAGGATGTTAACAGTGAGGGAGG - Intronic
932923764 2:75946404-75946426 GGGGATGTTGACAATGGGGGAGG - Intergenic
933531130 2:83513740-83513762 GTGGATGTTGATAATGGGGGAGG + Intergenic
933578718 2:84100733-84100755 CAGGATGTTGATACTGGGAGAGG + Intergenic
934051275 2:88213202-88213224 CAAGATGTTAACATTGGGGGAGG - Intergenic
935209245 2:100924179-100924201 GGGGATGCTGATAATGGGGGAGG - Intronic
935506273 2:103908057-103908079 AAGGATGCTGATAATGGAGGAGG - Intergenic
936919414 2:117672212-117672234 GGGGATGTTGATAATGGGGGAGG + Intergenic
937011797 2:118569457-118569479 CAGCATTTTCATAATGAGTGGGG - Intergenic
937344189 2:121113413-121113435 CAGAATGTTGATAATAGGGGAGG + Intergenic
938691118 2:133790271-133790293 CAGGATCTTCATCATGGAGAAGG - Intergenic
939145141 2:138404595-138404617 GAGGATGTTGGTAATGGAGGAGG + Intergenic
939173817 2:138726709-138726731 CAGGATGCTGACAATGGGGGAGG - Intronic
939237107 2:139508960-139508982 CGGGATGGTCATAATGGGAGAGG + Intergenic
939395777 2:141627843-141627865 CAGGATGTTGATAGTAGGGGAGG + Intronic
939812493 2:146851824-146851846 CAGGATGTTGAAATTGTGGGAGG + Intergenic
939857850 2:147382033-147382055 TGGGATGTTGATAATTGGGGAGG + Intergenic
939940550 2:148345097-148345119 CAAGATGTTGATAATGGGGGAGG + Intronic
940878750 2:158924561-158924583 GGGGATGTTCATATTTGGGGAGG - Intergenic
941089553 2:161159283-161159305 AGGGATGTTGATAATGGGGAAGG + Intronic
941339177 2:164284861-164284883 CAGGTTGTTGATAGTGGGAGAGG + Intergenic
941508625 2:166377487-166377509 GGGAATGTTGATAATGGGGGAGG - Intergenic
941553690 2:166948278-166948300 CAGGATGTTGATAATGAGCAGGG + Intronic
941717429 2:168778834-168778856 GGTGATGTTGATAATGGGGGAGG + Intergenic
941733400 2:168945179-168945201 GGAGATGTTGATAATGGGGGAGG + Intronic
941811742 2:169762314-169762336 CAGGATGCTCATAATACAGGTGG - Intronic
942287018 2:174429555-174429577 TGGGATGTTGATAGTGGGGGAGG - Exonic
942530890 2:176909129-176909151 GGGGATGTTGATAATGGAGGAGG + Intergenic
942720198 2:178942720-178942742 GGGGATGTTGATTATGGGGGAGG + Intronic
942752615 2:179304769-179304791 CGAGATGTTGAGAATGGGGGAGG - Intergenic
942919028 2:181348300-181348322 GGGGATGTTGATAATGGGGGAGG + Intergenic
942960512 2:181824913-181824935 CATGGGGTTCATAATGGGAGGGG - Intergenic
942991264 2:182206333-182206355 GGGGATGTTGACAATGGGGGAGG - Intronic
943032005 2:182696679-182696701 GGGGATGTTGACAATGGGGGAGG + Intergenic
943287919 2:186028294-186028316 CAGGATATTGATAGTGAGGGAGG + Intergenic
943367902 2:186982857-186982879 CAGGAGGTTCATAAGGCAGGTGG - Intergenic
943822316 2:192341156-192341178 GAAGATGTTGATAATGGGAGAGG - Intergenic
944080611 2:195784022-195784044 ATGGATGTTGATACTGGGGGAGG - Intronic
944194500 2:197038214-197038236 GAGGATGATGATAATGGAGGAGG + Intronic
944726795 2:202479555-202479577 GGGAATGTTGATAATGGGGGAGG - Intronic
944739424 2:202597163-202597185 CATGATGTTGATAGTGAGGGAGG - Intergenic
945238446 2:207654324-207654346 CAGGATGTTGATAATGGTAAAGG + Intergenic
945473904 2:210259211-210259233 CAAGACGTCCATATTGGGGGAGG + Intergenic
946576115 2:221077475-221077497 CAGGATGCTCCTAAAGGGGAGGG - Intergenic
946671748 2:222112137-222112159 GAGGATGTTGATAATGGGGGAGG + Intergenic
1170417042 20:16155675-16155697 GAGGATGTTCATAATGGGGGAGG + Intergenic
1170651476 20:18246493-18246515 GGGGATGTTAATAATGGGGGAGG - Intergenic
1170880294 20:20291094-20291116 GGGGATGTTGATAGTGGGGGAGG - Intronic
1171384522 20:24761156-24761178 TGGGATGTTGATAATGGGGAAGG + Intergenic
1172077065 20:32307151-32307173 GGAGATGTCCATAATGGGGGAGG - Intronic
1172553790 20:35822914-35822936 CAGGATGTTGAAAGTGGGGGAGG - Intronic
1173163840 20:40672139-40672161 CAGGAGGTTCTTACTGGGGGTGG - Intergenic
1173787179 20:45802581-45802603 CCTGATGTCGATAATGGGGGAGG - Intronic
1174010914 20:47448957-47448979 CAGGATGTTGATAATCAGGGAGG + Intergenic
1175511604 20:59531529-59531551 GGCGATGTTGATAATGGGGGAGG + Intergenic
1176316289 21:5247692-5247714 CAGGTTGTACACAATGGGTGTGG - Intergenic
1176889148 21:14293371-14293393 GAGGATGTTGATAATGGGGGAGG + Intergenic
1176983254 21:15407155-15407177 CAGGATATTAAAAAGGGGGGAGG - Intergenic
1177001123 21:15614493-15614515 GGGGATGTTGATAATGGGGAAGG + Intergenic
1177670000 21:24212646-24212668 GGGGATGTTGATAATAGGGGAGG + Intergenic
1177835127 21:26179308-26179330 AAGAGTGTTCATGATGGGGGTGG + Intergenic
1177935587 21:27341308-27341330 CAGGATGTTGATAATGAGGCAGG + Intergenic
1178381157 21:32110040-32110062 GGGGATGTTGATAATGGGGAAGG + Intergenic
1178498705 21:33108706-33108728 TAGAATGTTCTTTATGGGGGAGG - Intergenic
1178861057 21:36290109-36290131 CAGGATGTTGATAATACGGCAGG + Intronic
1179057541 21:37949953-37949975 GGGGATGTTGATAGTGGGGGAGG + Intergenic
1179192626 21:39136353-39136375 GAGGATGTTGATAATGGCGGAGG + Intergenic
1179227644 21:39469198-39469220 GGGGATGTTGATAATGGGGGAGG - Intronic
1180019330 21:45111396-45111418 ACGGATGTTGATAATGGGGGAGG - Intronic
1180394092 22:12313610-12313632 CAGGGTGTACATAATGGGTGTGG - Intergenic
1180405654 22:12551140-12551162 CAGGGTGTACATAATGGGTGTGG + Intergenic
1181416578 22:22763705-22763727 CAGGATGTGCAGGATGGAGGTGG - Intronic
1182178562 22:28319540-28319562 TGGGATGTCAATAATGGGGGAGG + Intronic
1182704381 22:32267288-32267310 CAGGATGTGAATAAGGTGGGAGG + Intergenic
1183766456 22:39880538-39880560 GGGGATGTTTATAATGGGGGAGG + Intronic
1183818271 22:40322297-40322319 GAGGATGTTGATAATAGTGGAGG - Intronic
1184937312 22:47734635-47734657 CAGGATGTTGGTGATGGTGGAGG + Intergenic
1185134168 22:49059439-49059461 CAAGACTTTCATAATGGGAGTGG + Intergenic
949428853 3:3950511-3950533 CAGGATATTGATAATGGGGAAGG + Intronic
951066214 3:18268735-18268757 TAGGATGTTGAAAGTGGGGGTGG + Intronic
951611549 3:24495912-24495934 CACGATATGCATAATGGCGGTGG - Intergenic
951630559 3:24715593-24715615 CAAGATGTTAACACTGGGGGAGG - Intergenic
951829691 3:26912250-26912272 CAGGATGCTGATAATGGGGGAGG + Intergenic
952569022 3:34691958-34691980 CAATATGATCATATTGGGGGGGG + Intergenic
952851556 3:37733930-37733952 CAGGATGTTCACACTGGGAGTGG - Intronic
953192655 3:40702090-40702112 CAGGATGTTGAGAGTGGGGGAGG - Intergenic
953203580 3:40799997-40800019 CAGGATGTTTTTGATGGGGAGGG - Intergenic
953432262 3:42850029-42850051 AAGGATGTACAAAAGGGGGGAGG + Intronic
954348101 3:50017982-50018004 CAGGATGCTGATAGTTGGGGAGG - Intronic
954555240 3:51512508-51512530 TAGGATGTTGATAATGGAGGAGG + Intergenic
955677960 3:61469206-61469228 CAGGATGTGGATAATTGGGGAGG - Intergenic
955677975 3:61469331-61469353 CAGGATGTTGATAATAGGGGAGG - Intergenic
956092567 3:65683354-65683376 GGGGATGTTGATAATGTGGGAGG + Intronic
956115862 3:65917986-65918008 GGGGACGTTGATAATGGGGGAGG + Intronic
956495114 3:69816805-69816827 GATGATGTTGATAATGGTGGTGG + Intronic
956771426 3:72529291-72529313 GGGGATGTTGATAGTGGGGGAGG + Intergenic
957676423 3:83372770-83372792 GGGGATGTTGATAATGGGAGAGG + Intergenic
957825471 3:85436783-85436805 AAGGATGTTAATAGTGGGAGAGG - Intronic
957901756 3:86503333-86503355 AGGAATGTTGATAATGGGGGAGG - Intergenic
958889974 3:99772514-99772536 CAGGATGTTCATAATGGGGGAGG + Intronic
959243273 3:103828559-103828581 GTGGATGTTTATAATGGGGGAGG + Intergenic
959300375 3:104591911-104591933 GAGGATGTTTATAATGTGGGAGG + Intergenic
959633042 3:108530634-108530656 GGGGATGTTGATAATGGGTGAGG + Intergenic
959877001 3:111395050-111395072 AGGGATGTTGATAATGAGGGAGG - Intronic
959891964 3:111567039-111567061 CAGGATGTCCACAGTGGGGGAGG + Intronic
959933512 3:112007184-112007206 GGGGATGTTGATAATGGGGAAGG - Intronic
960717365 3:120590029-120590051 GAGGATGTCGATAACGGGGGAGG + Intergenic
961335659 3:126178079-126178101 CATGATGTTAAAAATAGGGGAGG + Intronic
962621408 3:137183643-137183665 CGGGGTGTTGATAATGGGGGAGG - Intergenic
962699906 3:137987787-137987809 GGGGATGTTGATAATGGGAGAGG - Intergenic
962992899 3:140595667-140595689 GGGGATGTTGATGATGGGGGAGG - Intergenic
963824940 3:149943331-149943353 CAGGATGTTGATAATTGGTAAGG - Intronic
963824951 3:149943456-149943478 CAGGATGTTGATAATAGGGGAGG - Intronic
963860451 3:150304435-150304457 CAGGATTTTGATAGTCGGGGAGG - Intergenic
964625540 3:158755135-158755157 CAGGATGTTGATAGTGGGAGAGG - Intronic
964671037 3:159226544-159226566 CAAGATGCTAATATTGGGGGAGG + Intronic
964755327 3:160086752-160086774 CAGGATGTTAATAAGGTAGGTGG - Intergenic
964756223 3:160092723-160092745 CAGGAGGTTCATAAGGCAGGTGG - Intergenic
964800152 3:160547505-160547527 CAGGATGTTGATGTAGGGGGAGG - Intronic
964917729 3:161856316-161856338 GGGTATGTTGATAATGGGGGAGG + Intergenic
965526485 3:169724782-169724804 AAGAATGTTCATAATGGGAGAGG + Intergenic
965618711 3:170621413-170621435 CAGGAAGTTCAGACTGGGTGCGG - Intronic
965641520 3:170833741-170833763 GGGGATGTTGATAATGGGAGAGG - Intronic
966098535 3:176237875-176237897 CAGGATGTTGATGGTGGGGGAGG + Intergenic
966734293 3:183176672-183176694 CAGGATGCTGACAGTGGGGGTGG - Intergenic
968023284 3:195415174-195415196 CAGGATGTTGATAGTGGGGAAGG + Intronic
969109675 4:4836077-4836099 AGGGATGTTGATAATGGTGGAGG + Intergenic
970226579 4:13864575-13864597 TAGGATATTGATAATGAGGGAGG - Intergenic
970750865 4:19358922-19358944 AAGGATGTTGATAATGAAGGAGG + Intergenic
970880269 4:20920441-20920463 CAGAATGTTCATAATGTGTCTGG - Intronic
971306065 4:25482717-25482739 GGGAATGTTGATAATGGGGGAGG + Intergenic
971577540 4:28295061-28295083 AAGGATGTTGAAAGTGGGGGAGG + Intergenic
971991728 4:33906758-33906780 GAGGATGTTGATAATGAGGGAGG + Intergenic
971992682 4:33920363-33920385 GGGGATGTTGATAATGGGGGAGG - Intergenic
972615836 4:40697139-40697161 GAAGATGTTGATAATAGGGGAGG + Intergenic
973134880 4:46695049-46695071 CAGGATGTTGATATCTGGGGAGG - Intergenic
973289172 4:48453404-48453426 GGGGATGTTGATAATGGGGGAGG + Intergenic
973727900 4:53794058-53794080 CAGGATGTTGATAGCAGGGGAGG - Intronic
974394026 4:61311950-61311972 TGGGATGTTAATAATGGGGGAGG + Intronic
974509581 4:62821262-62821284 GAGGATGTTGATAATAGGGAAGG - Intergenic
974632618 4:64513423-64513445 GGGGATGTTAATAATGGGGGAGG + Intergenic
974892526 4:67899090-67899112 CAGAATGTTGATAGTAGGGGAGG - Intergenic
975124500 4:70766660-70766682 TGGGATGTTGATAATGAGGGAGG - Intronic
975645163 4:76538591-76538613 CAGGATGTTCCAACTGGGTGTGG + Intronic
975646806 4:76553897-76553919 CAGGATTTTGATAGTGGGGGAGG - Intronic
975915984 4:79325866-79325888 GCGGATGTTCATAATGGCAGAGG + Exonic
976280620 4:83323381-83323403 GGGGATGTTGATAATGAGGGAGG + Intronic
976409737 4:84699730-84699752 TAGGATGACCATAATGGGGTGGG - Intronic
977314621 4:95430221-95430243 CAGGATGTTAATAATGAGGGAGG + Intronic
977428364 4:96899207-96899229 GAGGACGTTGATAATGAGGGAGG + Intergenic
977454603 4:97242479-97242501 GAAGATGTTGATAGTGGGGGAGG + Intronic
977574387 4:98660502-98660524 GGGGATGTTGACAATGGGGGAGG - Intergenic
977822192 4:101486049-101486071 CAGGATGTTGATAATGGAGGAGG - Intronic
978033016 4:103959006-103959028 GGGGATGTTGATAATGGAGGAGG + Intergenic
978051967 4:104212177-104212199 CAGGATGTTGATAGTGAGGGAGG - Intergenic
978129552 4:105178629-105178651 TGGGATGTTGATAATGGGGAAGG + Intronic
978135412 4:105251967-105251989 AAGGATGTTGATAATGAGGGAGG - Intronic
978243668 4:106547414-106547436 TGGGATGTTGATAATGGGGGAGG + Intergenic
978398633 4:108308580-108308602 CAGGATATCCATAGTGGAGGAGG + Intergenic
978686157 4:111446012-111446034 AGGGATGTTGATAATGTGGGAGG + Intergenic
978821469 4:112971712-112971734 GAGGAGCTTCATATTGGGGGTGG + Intronic
979162932 4:117486782-117486804 GGGGATGTTAATAATGGGGGAGG - Intergenic
979706669 4:123727865-123727887 CAGGATTTTGATAGTGGGGAAGG - Intergenic
979748830 4:124250543-124250565 AAGGATGTTGGTAATGAGGGAGG + Intergenic
979830377 4:125293228-125293250 GAGGATATTAATAATGGAGGAGG + Intergenic
980620697 4:135299084-135299106 GAGGATGTTTATAAGGAGGGAGG - Intergenic
981366754 4:143912798-143912820 CAGCATATTCCAAATGGGGGTGG - Intergenic
981376551 4:144023030-144023052 CAGCATATTCCAAATGGGGGTGG - Intergenic
981978478 4:150761391-150761413 CACGCTGATCATAATGGGAGGGG - Intronic
982033855 4:151326248-151326270 GGGGATGTTGATAATGGGGGAGG + Intergenic
982085321 4:151829759-151829781 AAGGATGGTCTCAATGGGGGAGG - Intergenic
982168357 4:152637061-152637083 GGGGACGTTGATAATGGGGGAGG + Intronic
982211938 4:153044828-153044850 GGGTATGTTGATAATGGGGGAGG + Intergenic
982491243 4:156032129-156032151 GAGGATGTTGATAATGGAGGAGG - Intergenic
983110702 4:163745947-163745969 GGGGGTGTTGATAATGGGGGAGG - Intronic
983208333 4:164933464-164933486 CAGGATGGTCATGGTGGGGTGGG + Intergenic
983372109 4:166873465-166873487 GAGGATGTTGATAATGGAAGAGG + Intronic
983376032 4:166929066-166929088 GAGTATGTTGATAATGGGGAGGG + Intronic
983504337 4:168536382-168536404 CAGGATGGTAATAATGCAGGAGG - Intronic
984292630 4:177814564-177814586 GGGGATGTTGATAATAGGGGAGG - Intronic
984313617 4:178097368-178097390 GGGGATGTTGATAATGGGGAAGG + Intergenic
985294892 4:188426078-188426100 TATGATGTTGATAATGGTGGTGG - Intergenic
985430562 4:189875640-189875662 CAGGGTGTACACAATGGGTGTGG + Intergenic
986021824 5:3811819-3811841 GGGGATGCTCATAATGGGGGAGG + Intergenic
986344831 5:6824609-6824631 CAGGGTGCTGATAGTGGGGGAGG + Intergenic
986373944 5:7110970-7110992 GGGGATGTTGATAATGGGAGAGG + Intergenic
986538521 5:8817724-8817746 TAAGATGTTGATAGTGGGGGAGG - Intergenic
986839000 5:11674451-11674473 GGGGATGTTGATAATGAGGGAGG - Intronic
986877426 5:12128355-12128377 GGGGATGTTGATAATGAGGGAGG + Intergenic
987024085 5:13906317-13906339 GGGGATGTTCATAATGGGGGAGG + Intronic
987420740 5:17717297-17717319 GGGGATGTTGTTAATGGGGGAGG + Intergenic
988332946 5:29866099-29866121 CAGGATATTGACAGTGGGGGAGG + Intergenic
989291732 5:39775319-39775341 CAAGATGTTAATAATGGGAGAGG + Intergenic
989711870 5:44407964-44407986 CAGGATGTTGATAGTGGGGGCGG + Intergenic
989809003 5:45649350-45649372 GGGGATGTTGATAATGGGGAGGG - Intronic
990173595 5:53082603-53082625 CGGGATTTTGATAGTGGGGGAGG - Intronic
990369349 5:55101690-55101712 CAGGATGTTAACTATGGGGATGG + Intergenic
991022317 5:61992636-61992658 CAGGATGTTCAGAATAGGGCTGG + Intergenic
991081785 5:62608695-62608717 CAGGATGTGGACAGTGGGGGAGG - Intronic
991146425 5:63310721-63310743 CAGGATGTTGATATTGGGAGAGG + Intergenic
991688307 5:69201981-69202003 GGGGATGTTGATAATGGGAGAGG + Intronic
991981434 5:72235563-72235585 CAGGATGTTGATTATGAGGAAGG + Intronic
992593273 5:78317981-78318003 CCGGATGTCCATAGTAGGGGAGG + Intergenic
992857818 5:80881282-80881304 CAGGATGTCAATAGTGAGGGAGG - Intergenic
993202361 5:84831835-84831857 CAGGATGTTGACAATGAGAGAGG - Intergenic
993424673 5:87748405-87748427 CAGGATGGTAATAGTGGAGGTGG + Intergenic
993935722 5:93999601-93999623 GAGGCTGTTGATAATGAGGGAGG - Intronic
994096950 5:95855977-95855999 CACGATGTTAATAATAGGGAAGG - Intronic
994802329 5:104394859-104394881 AGGGATGTTCATAATTGTGGAGG + Intergenic
995469688 5:112488014-112488036 AGGGATGTTGGTAATGGGGGAGG - Intergenic
995577000 5:113547553-113547575 GGGGATGTTGATAATGGGGGAGG + Intronic
995802900 5:116018939-116018961 CAGGATGTTGATAGAGGGGGAGG - Intronic
996002434 5:118380827-118380849 AGGGATGTTGATAATGGGGTGGG - Intergenic
996070761 5:119128664-119128686 GTGGATGTTGATAATGTGGGAGG + Intronic
996285564 5:121787125-121787147 TAGGATGTTCATTATGGGAGTGG - Intergenic
996325191 5:122265075-122265097 CTGGATGTTGATAGTGGGAGAGG - Intergenic
996580063 5:125021824-125021846 GAGGATATTGATAATGGGGGAGG + Intergenic
996987651 5:129586105-129586127 GTGAATGTTGATAATGGGGGAGG - Intronic
997054952 5:130431110-130431132 GGGGATGTTGATAATGGAGGAGG + Intergenic
997117646 5:131142691-131142713 CAGAATGTTGATAGTGGTGGAGG + Intergenic
997683424 5:135772023-135772045 CATAATATTCATAATGGGAGAGG + Intergenic
998311119 5:141133355-141133377 GAGGATGTTGATAATGGGTGAGG + Intronic
998361889 5:141595377-141595399 GGGGATGTTGACAATGGGGGAGG + Intronic
998855420 5:146390312-146390334 GAGGATGTTCAGAAGGGGAGGGG - Intergenic
999045554 5:148465294-148465316 GAGGATATTGACAATGGGGGAGG + Intronic
999118318 5:149184798-149184820 CAGGATTTTCACAATGGCAGGGG - Intronic
999418914 5:151423848-151423870 GTGGATGTTGATAATGGGAGAGG + Intergenic
999428871 5:151509287-151509309 CAGTATGTTCAGAATAGGGCTGG + Intronic
999799163 5:155017344-155017366 CAGGATCTTGCTATTGGGGGTGG - Exonic
999841133 5:155428407-155428429 AAGGATGTTCACAATGAGGGAGG - Intergenic
999846146 5:155482683-155482705 GTGGATGTAGATAATGGGGGAGG + Intergenic
1000282086 5:159790977-159790999 CAGGGTGTTAATAAAGGTGGAGG - Intergenic
1000405393 5:160882317-160882339 GGGGATGTTGATAATGGGAGAGG + Intergenic
1001591517 5:172868759-172868781 CAGGATGTTGATAGTGAGGGAGG + Intronic
1002084357 5:176762800-176762822 CAGGATGTTGGTAGTCGGGGAGG - Intergenic
1002084511 5:176764215-176764237 GGGGACGTTGATAATGGGGGAGG - Intergenic
1002686792 5:181018487-181018509 CAGGATGTTGATGGTGAGGGAGG - Intergenic
1003086772 6:3066644-3066666 CAGGATGTTGATGGTAGGGGAGG - Intronic
1004471475 6:15933355-15933377 GGGGATGTTAATAATAGGGGAGG - Intergenic
1004794098 6:19061909-19061931 GTGGATATTGATAATGGGGGAGG - Intergenic
1004815450 6:19307474-19307496 AAGGATGTTGATAACAGGGGAGG + Intergenic
1005523050 6:26617022-26617044 CAGGATGTTGATAGTGGAGGAGG + Intergenic
1005600407 6:27421291-27421313 AAGGAAGTTGATAATGGGAGAGG + Intergenic
1005688453 6:28278700-28278722 GGGGATGTTGATAATAGGGGAGG - Intronic
1006247318 6:32749036-32749058 AAGGATGTTACTAGTGGGGGAGG + Intergenic
1006590637 6:35153291-35153313 GGGGATATTGATAATGGGGGAGG - Intergenic
1006766448 6:36510616-36510638 CAGCATGGTCATAATGGCAGCGG - Intronic
1006891068 6:37429162-37429184 CAGAATGATGATGATGGGGGTGG - Intergenic
1006992634 6:38228470-38228492 GAGGATGTTGATACTTGGGGAGG + Intronic
1007624339 6:43234795-43234817 AGGGATGTTGATAATGGCGGAGG + Intergenic
1007968686 6:46028735-46028757 ATGAATGTTGATAATGGGGGAGG - Intronic
1008124675 6:47654899-47654921 CGAGATGTTGATAGTGGGGGAGG + Intergenic
1008322848 6:50139153-50139175 ATGGATGTTGATAATGAGGGAGG - Intergenic
1008358088 6:50579260-50579282 GGGGATATTAATAATGGGGGAGG + Intergenic
1008744255 6:54649714-54649736 GGGAATGTTCATAATGGGAGAGG - Intergenic
1009536693 6:64896832-64896854 CAGGAAGTTCAGACTGGTGGAGG + Intronic
1010828681 6:80503979-80504001 CAGGATGTTGATAGCAGGGGAGG + Intergenic
1011007723 6:82666172-82666194 CAAGATGTCAATAGTGGGGGAGG + Intergenic
1011519475 6:88189121-88189143 CAGGATGTTGATAGTTGGGGAGG - Intergenic
1012083050 6:94785198-94785220 CAGGAAGTTCAAACTGGGCGGGG - Intergenic
1012163472 6:95918215-95918237 GGGGATGTTGATAATGAGGGAGG + Intergenic
1012218952 6:96624867-96624889 CTGGAGGTTCTTACTGGGGGAGG - Intergenic
1012320906 6:97844390-97844412 AGGGATGTTGATAATGGGGAAGG - Intergenic
1012803219 6:103861366-103861388 CAGGATGCTCATTGTGGGGGAGG - Intergenic
1012822451 6:104103213-104103235 CAGGATGTTGATAGTGAAGGAGG + Intergenic
1013845629 6:114447593-114447615 AGGAATGTTGATAATGGGGGAGG - Intergenic
1013863756 6:114668496-114668518 CAGAATGTTGATAGTGGGAGAGG - Intergenic
1014227191 6:118861927-118861949 CAGGCTGTTCAGGATGAGGGAGG + Intronic
1014333798 6:120105669-120105691 GAGGATGTTGATAATGGGGGAGG - Intergenic
1014368836 6:120579724-120579746 GAGGATGTTAATAATAGGAGAGG + Intergenic
1014701042 6:124688410-124688432 GAGGATGCTGATAATGGGGGAGG - Intronic
1014716442 6:124869826-124869848 GAGGATGTTGATAGTGGGGAAGG + Intergenic
1014775276 6:125501929-125501951 GGGGATGTTGATAATGAGGGCGG + Intergenic
1014992881 6:128103580-128103602 CAGGATGTTCAACAGGGGTGTGG - Intronic
1015218009 6:130772452-130772474 GAGGATGTCCATAGTGAGGGAGG + Intergenic
1015767450 6:136733727-136733749 GGGGATGTTGACAATGGGGGAGG - Intronic
1016678462 6:146799688-146799710 GGGGATGTTAATAATGGGGGAGG + Intronic
1017768513 6:157626600-157626622 GGAGATGTTGATAATGGGGGAGG - Intronic
1019438839 7:1036562-1036584 CAGGGTGTTGATAATGGGGGAGG + Intronic
1020866327 7:13568662-13568684 GGGGATGTTGATAATGAGGGAGG - Intergenic
1020874980 7:13681818-13681840 GGGGATGTTGATAATGGGGGAGG + Intergenic
1021341040 7:19463067-19463089 GGGGATGTTGATAATGGGGGAGG + Intergenic
1021729954 7:23586389-23586411 CAGGAAGTCCATGATGGCGGCGG + Intergenic
1023404952 7:39823730-39823752 GAGGACATTGATAATGGGGGAGG - Intergenic
1023633843 7:42189056-42189078 GAGGATGTTGACAGTGGGGGAGG + Intronic
1024035958 7:45507627-45507649 GGGGATGTTGATAATGGGGGAGG - Intergenic
1024144288 7:46496441-46496463 GGGGATGTTGATAATGAGGGAGG + Intergenic
1026231584 7:68488704-68488726 CAGGCTGTGCATCTTGGGGGGGG - Intergenic
1026842832 7:73680057-73680079 CAGAAGGTTCAGACTGGGGGTGG - Intergenic
1027393651 7:77730332-77730354 GGGGATGTTAATAATGGGGAAGG - Intronic
1028445823 7:90922934-90922956 CCAGATGTTAATAGTGGGGGAGG - Intronic
1028723003 7:94055449-94055471 GGGGATGTTGATAATGGTGGAGG + Intergenic
1028770188 7:94610418-94610440 GGGGATGTTGATAATGGGGGAGG + Intronic
1029846108 7:103413895-103413917 GGGGATGTTGATAGTGGGGGAGG - Intronic
1029920930 7:104262539-104262561 TGGGATGTTGATAGTGGGGGAGG - Intergenic
1030011848 7:105177611-105177633 GAGGATGCTCATCCTGGGGGCGG + Intronic
1030290528 7:107867676-107867698 GGGGATGTTGATAATGGGAGAGG + Intergenic
1030598375 7:111565281-111565303 CAGGATATTCATAGTCAGGGAGG + Intergenic
1030723951 7:112902691-112902713 CTGGATGTTGACAGTGGGGGAGG + Intronic
1030779942 7:113587875-113587897 CTGGATGTTGATAGTGGGGAAGG - Intergenic
1031249278 7:119358603-119358625 CAGGATGTTGATTGTGGGGAAGG + Intergenic
1031379005 7:121061518-121061540 GGGGATGTTAATAATGGAGGAGG + Intronic
1031430239 7:121659038-121659060 GAGGATGTTGATAATTGGGATGG - Intergenic
1031542396 7:123010208-123010230 CAGGATGTTGATAATGGGGAAGG + Intergenic
1031695002 7:124840092-124840114 GAGGATGTTGATACTGGAGGAGG - Intronic
1032178446 7:129653379-129653401 CAGGATGTTGATAGTGGGGGAGG - Intronic
1032757307 7:134903355-134903377 AGGGATGTTTATAATGGGAGAGG + Intronic
1033402708 7:141042071-141042093 GGGGGTGTTAATAATGGGGGAGG + Intergenic
1033889229 7:145988327-145988349 AAGGATATGGATAATGGGGGAGG - Intergenic
1033933454 7:146552773-146552795 CAGGATGTTCATAAAGCAAGGGG - Intronic
1033985027 7:147214759-147214781 AAGGATGTTGATAATGGAGGAGG - Intronic
1035525823 8:312411-312433 GGGGATGTTGATAATGGGGGAGG - Intergenic
1035659670 8:1337539-1337561 GATGATGATCATAATGGTGGTGG + Intergenic
1035836151 8:2754376-2754398 GGGGATGTTCATAACTGGGGAGG + Intergenic
1035965660 8:4188792-4188814 CAGGATGAATATTATGGGGGAGG + Intronic
1036064819 8:5368096-5368118 GAAGATGTTGATAATGGGGTAGG + Intergenic
1036177510 8:6553158-6553180 CAGGATGTTGATCGTAGGGGAGG + Intronic
1036703223 8:11027888-11027910 TGGGATGTTGATAATGGGGGAGG - Intronic
1037016754 8:13917259-13917281 CAGGATGTTAATGGTGGGGTGGG - Intergenic
1037074942 8:14703013-14703035 CAGGATGGTAGTAATGGAGGAGG - Intronic
1037120332 8:15277480-15277502 GAGGATGTTGATAATAGGGAAGG + Intergenic
1037231049 8:16659359-16659381 CAGGATTTTCATGATAGGGGAGG + Intergenic
1037693052 8:21199070-21199092 CAGGTTGTTCCTGATGGGGCTGG - Intergenic
1037816032 8:22112372-22112394 TAAGATGTTCACAATAGGGGAGG + Intergenic
1038419716 8:27425540-27425562 GAGAATGTTGATAGTGGGGGAGG - Intronic
1038473879 8:27848224-27848246 GGGGATGTTGATAATGGGGAAGG - Intergenic
1038477955 8:27881801-27881823 GGGGATGTTGATAATGGGGGAGG - Intronic
1039078465 8:33713392-33713414 AAGGATGGTGATAATAGGGGAGG - Intergenic
1039333363 8:36563230-36563252 AGGGATGTTGATAATGGGGGAGG + Intergenic
1039925137 8:41923190-41923212 GAGGATGTCAATAATCGGGGAGG + Intergenic
1039940956 8:42090700-42090722 GGGGATGTTTATAATGGGGGAGG + Intergenic
1040004847 8:42611227-42611249 TGGGATGTTGATAATGGGGAAGG + Intergenic
1040711889 8:50198567-50198589 CAGGAAGTTCATAATAGGGAAGG + Intronic
1041093288 8:54324929-54324951 GGGGGTGTTGATAATGGGGGAGG + Intergenic
1041180531 8:55243120-55243142 GAGGATGTTGATAAGTGGGGAGG - Intronic
1041339733 8:56831706-56831728 GAGGATGTTGATAATAGAGGAGG + Intergenic
1041540432 8:58978675-58978697 CACCATGTTTATAGTGGGGGAGG - Intronic
1042127356 8:65551876-65551898 GAGGATGTTGATAGTGGGGGAGG - Intergenic
1042243999 8:66692818-66692840 GCAGATGTTGATAATGGGGGAGG + Intronic
1042427800 8:68669232-68669254 GGGGATGTTGATAATGGGGGAGG + Intronic
1042540864 8:69906016-69906038 CAGGCTGTGCAGAATGGGGCAGG - Intergenic
1043038801 8:75232549-75232571 GAAGATGTTGATAATGGGGGGGG + Intergenic
1043359998 8:79461096-79461118 CAGGATGTGCATTGTGAGGGAGG - Intergenic
1043739710 8:83795363-83795385 GGGCATGTTGATAATGGGGGAGG + Intergenic
1043828883 8:84963743-84963765 AAGGATGTTGATAATGGGACAGG + Intergenic
1043830880 8:84987422-84987444 GAGGATGTTGATAATGGGGGAGG - Intergenic
1043987688 8:86713950-86713972 GGGGATGTTGATAATGGGGAAGG - Intronic
1044057789 8:87593867-87593889 GGGGATGTTTATAATGGGAGAGG - Intronic
1044325302 8:90851708-90851730 GGGGATGTTAATAATGGGGCAGG - Intronic
1044848107 8:96401460-96401482 GAGGATGTTGACAATGGGGGAGG + Intergenic
1045619866 8:103963633-103963655 GAGGAGGTTGATAATGGGAGAGG - Intronic
1045650262 8:104335746-104335768 GGGGATGTTGATATTGGGGGAGG + Intronic
1045773149 8:105769115-105769137 CAGGATGTTCATGTTTTGGGTGG + Intronic
1045992043 8:108319408-108319430 CAGGATTTTGATAGTGGGGGAGG - Intronic
1046230351 8:111347749-111347771 CAAGATGTTAACATTGGGGGAGG - Intergenic
1046679163 8:117149600-117149622 GAGGGTGGTCATAATGGTGGTGG + Intronic
1047640650 8:126817978-126818000 GGGGATGTTGATAATGGGGGAGG - Intergenic
1048188682 8:132267864-132267886 GAGGATATTGAGAATGGGGGAGG - Intronic
1048318644 8:133381166-133381188 GGGGATGTTGATAATGGGGGAGG + Intergenic
1048810722 8:138283657-138283679 GGAGATGTTGATAATGGGGGAGG + Intronic
1050011270 9:1187754-1187776 GAGGATGTTGATAACGGGAGAGG - Intergenic
1050145629 9:2564378-2564400 AGGGATGTTGATAATGGGTGAGG + Intergenic
1050196768 9:3093093-3093115 GGGGATGTTGATAATGGGTGAGG + Intergenic
1050567266 9:6899258-6899280 AAGGATATTGATAATGTGGGGGG - Intronic
1050777353 9:9282286-9282308 GGGGATGTTGATAATGGGGCAGG + Intronic
1050847241 9:10237141-10237163 GGGGATGTTGATAATGGGTGAGG + Intronic
1050909296 9:11046946-11046968 CATTATGAACATAATGGGGGTGG - Intergenic
1050948556 9:11558565-11558587 CAGTGTGTTCATGGTGGGGGGGG + Intergenic
1051442178 9:17097087-17097109 TGGGATGTTGATAGTGGGGGAGG - Intergenic
1051746710 9:20301676-20301698 GGGGATGTTGATAATGGAGGAGG - Intergenic
1051860342 9:21617392-21617414 CAGGATGAGAATGATGGGGGCGG + Intergenic
1052139486 9:24961409-24961431 GAGGATGTTGATAACGGGGGAGG + Intergenic
1052996128 9:34552435-34552457 CAGGATCTGCCTGATGGGGGAGG - Intronic
1053040846 9:34870143-34870165 CAGGATGTTGATAGTGGGGAAGG - Intergenic
1053624760 9:39857820-39857842 GGGGATGTTTATTATGGGGGAGG - Intergenic
1053838118 9:42162779-42162801 GGGGATGTTTATTATGGGGGAGG - Intergenic
1053880110 9:42585408-42585430 GGGGATGTTTATTATGGGGGAGG + Intergenic
1053892551 9:42708901-42708923 GGGGATGTTTATTATGGGGGAGG - Intergenic
1054219135 9:62392878-62392900 GGGGATGTTTATTATGGGGGAGG + Intergenic
1054231578 9:62516295-62516317 GGGGATGTTTATTATGGGGGAGG - Intergenic
1055092244 9:72374784-72374806 TGGGATGTTGATAATGGGGAAGG + Intergenic
1055743458 9:79415699-79415721 CAGGATGTTGATACTGGAGGAGG + Intergenic
1055781512 9:79826278-79826300 GAGGATGCTCATAATGGGGGAGG + Intergenic
1055850459 9:80621957-80621979 GAGGATATTGATAATAGGGGAGG + Intergenic
1056084345 9:83130347-83130369 TGGGATGTTGATAATTGGGGAGG - Intergenic
1056096927 9:83264520-83264542 TGGGATGTTGATGATGGGGGAGG + Intronic
1056104280 9:83331648-83331670 AAGGATATTGATAATGAGGGAGG + Intronic
1056193032 9:84203576-84203598 CAGGATGTTAACAGTGGGAGAGG + Intergenic
1056212443 9:84377238-84377260 GGGGATGTTGATAATGAGGGAGG - Intergenic
1056276640 9:85000174-85000196 CAGGATGTTAACAGTGGGGGAGG - Intronic
1056701467 9:88914634-88914656 TGGGATGTTGATAGTGGGGGAGG + Intergenic
1056749018 9:89332250-89332272 CAAGATGTTGATAATGAAGGAGG - Intronic
1056954169 9:91069130-91069152 CAGGCTCTTCCTAATGTGGGTGG - Intergenic
1057011108 9:91602115-91602137 GGGGATGTTAATAATGTGGGAGG - Intronic
1057858687 9:98623009-98623031 GGGGATGTTGATAATGGGGGAGG + Intronic
1058863801 9:109143377-109143399 CAGGATGTTGATAATGGGGGAGG + Intronic
1058875125 9:109237615-109237637 CAGGATTTTTAGACTGGGGGAGG + Intronic
1059090671 9:111354638-111354660 CAGGATGTTGATAGTGGGCGAGG + Intergenic
1059145195 9:111893724-111893746 CAAGATGTTAATAGTGGAGGAGG - Intergenic
1059742023 9:117161166-117161188 CAGGATGATGATGATGGTGGTGG + Intronic
1059892711 9:118821910-118821932 CAGGATATTGATAGTGGGGTAGG - Intergenic
1060111069 9:120906586-120906608 GGGGATGTTGATAGTGGGGGAGG - Intronic
1060196471 9:121626985-121627007 CAGGATGTTGATGGTGGGGGAGG - Intronic
1060257273 9:122043147-122043169 CAGGATTTTGATGGTGGGGGAGG + Intronic
1060371621 9:123078819-123078841 TAGGATGTTAATAATGAAGGTGG - Intronic
1061580797 9:131534631-131534653 CGGGATGTTGAAAATCGGGGAGG + Intergenic
1203782056 EBV:106121-106143 CAGGATGTCCCTAAAGGGGACGG + Intergenic
1203455145 Un_GL000219v1:160026-160048 CAGGTTGTACACAATGGGTGTGG - Intergenic
1185819241 X:3185657-3185679 GGGGATGTTCATAGTGGGGGAGG + Intergenic
1185852362 X:3500986-3501008 GGGGATATTGATAATGGGGGAGG + Intergenic
1186248233 X:7637663-7637685 GAGGATGTTAATAATGGGGGAGG - Intergenic
1186563486 X:10637862-10637884 TAAGATGTTCATAACAGGGGAGG + Intronic
1186629560 X:11334521-11334543 CAGGCTGTTCAGAATGGTAGAGG + Intronic
1186867741 X:13737490-13737512 CAAGATGTTGACAGTGGGGGAGG - Intronic
1187153744 X:16705041-16705063 CAGGATGTTAATAGTCAGGGAGG + Intronic
1187559687 X:20390391-20390413 GAGTATTTTCATATTGGGGGTGG + Intergenic
1187783287 X:22854258-22854280 AGGGATGTTGATAGTGGGGGAGG + Intergenic
1188269050 X:28116092-28116114 GGGGATGTTGATAATGGGGGAGG - Intergenic
1188400006 X:29732576-29732598 AAGGATGTTCATTATGTGGAAGG - Intronic
1188502194 X:30839650-30839672 TAGGATGCTGATAATGGGGCAGG + Intronic
1189464969 X:41271638-41271660 GGGGATATTGATAATGGGGGAGG + Intergenic
1189729289 X:44002010-44002032 CTGGATGTTGATAGTGGGGGAGG + Intergenic
1189937545 X:46085581-46085603 GGGGATGTTGATAGTGGGGGAGG - Intergenic
1190899944 X:54661819-54661841 GAGGATATTGATAATGGGAGAGG - Intergenic
1191915824 X:66200302-66200324 CAGGATGTGGATCATGGTGGAGG + Intronic
1191953299 X:66617698-66617720 CATGATGTTTATTAGGGGGGTGG - Intronic
1192187645 X:68962863-68962885 GGGGATGTTGATAATGGGGGAGG - Intergenic
1192477202 X:71453249-71453271 CAAGATGTTGATAACTGGGGAGG - Intronic
1192903643 X:75525670-75525692 GGGGATGTTGATAATGGAGGTGG - Intergenic
1193192748 X:78592205-78592227 CAGCATATTCATAGTGGTGGTGG - Intergenic
1193681381 X:84523282-84523304 AAGGATGTTGAAAATAGGGGAGG - Intergenic
1194184444 X:90756510-90756532 GGGGATATTGATAATGGGGGAGG + Intergenic
1194369216 X:93050065-93050087 CAGGATGTTGATAGTGAGGGAGG - Intergenic
1194783113 X:98049115-98049137 CAGGAAGTTCAAACTGGGAGCGG - Intergenic
1194896548 X:99448359-99448381 CAAGATGTACATAGTAGGGGAGG + Intergenic
1195587481 X:106581812-106581834 GAGGATGTTGATAATGGGTGAGG + Intergenic
1195943462 X:110184117-110184139 CAGGATGTTGATAGTGGGGTAGG + Intergenic
1196263403 X:113613025-113613047 CAGAATGTTAATAGTGGGAGAGG - Intergenic
1196411636 X:115425815-115425837 CCAGATGTTGATAGTGGGGGAGG - Intergenic
1196673758 X:118397731-118397753 CAGGATGTACTTAATGAGTGGGG + Intronic
1197640978 X:128967805-128967827 GATGATGTTGATAATGGTGGTGG + Intergenic
1198255587 X:134921649-134921671 GAGGCTGTTGATAATGGGGGAGG + Intergenic
1198502376 X:137264252-137264274 GAGGATGTTGATAATGGGGGAGG + Intergenic
1199088090 X:143652623-143652645 GAGGATGTTGATAAAGGGGAAGG - Intergenic
1199498839 X:148486676-148486698 GAGGATGTTGATAATGGGGAAGG + Intergenic
1199515958 X:148675704-148675726 CAGGATGTTCATCCTGAGTGGGG + Intronic
1199702496 X:150392885-150392907 CAGGATGCAGGTAATGGGGGAGG - Intronic
1200147650 X:153934893-153934915 GCGGATGTTCATAACGGCGGCGG + Exonic
1200531033 Y:4338423-4338445 GGGGATATTGATAATGGGGGAGG + Intergenic
1200677416 Y:6166302-6166324 CAGGATGTTGATAGTGAGAGAGG - Intergenic
1201071406 Y:10150331-10150353 CAGGATCTTCATACAGGAGGTGG + Intergenic