ID: 958892670

View in Genome Browser
Species Human (GRCh38)
Location 3:99797732-99797754
Sequence CCTTAGAAGCGGACTGTGGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 80}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958892670 Original CRISPR CCTTAGAAGCGGACTGTGGA AGG Exonic
902404556 1:16175637-16175659 CCTGAGGTGGGGACTGTGGAGGG - Intergenic
903774271 1:25782769-25782791 CCACAGAACCTGACTGTGGAGGG - Intronic
918705203 1:187651958-187651980 CAGTAGAAGCTGAGTGTGGAGGG + Intergenic
924676126 1:246179817-246179839 ACTTAGAAAGAGACTGTGGATGG - Intronic
1062959510 10:1562069-1562091 CCTGAGAACCGCACTGTGAATGG - Intronic
1063173871 10:3534449-3534471 CCTTTGCAGCAGACTGTGGTAGG + Intergenic
1069160360 10:65084639-65084661 CCTCAGAAGCAGATTCTGGAGGG + Intergenic
1070968062 10:80541854-80541876 GCTTAGAGGCGGACTGTGAAAGG + Intronic
1077981240 11:7302921-7302943 CCTTGGGAGCCGACTGCGGAAGG - Intronic
1087380630 11:97400385-97400407 CCTTTGAAGCAGATGGTGGAAGG - Intergenic
1090247204 11:125224914-125224936 CCTTTGGAGAGGACTGTGGCAGG + Intronic
1093764586 12:22948368-22948390 CCTTAGATGAGGACTTTGCATGG - Intergenic
1096600609 12:52726016-52726038 CCTTAGAAGGGCACTTTGCATGG + Intergenic
1097281721 12:57848779-57848801 CCTTAGAAGAGGGCAGGGGAAGG - Intergenic
1097820141 12:64120433-64120455 CCTGAGAACTGGAATGTGGATGG + Intronic
1097935928 12:65250936-65250958 CCTTAGATGGGGATTGAGGATGG + Intergenic
1100039373 12:90295306-90295328 CTTTAGAAGCAGACAATGGAAGG - Intergenic
1103783597 12:123415753-123415775 CCTTCAAAGCAGACTGAGGAGGG - Exonic
1106020884 13:25914483-25914505 GCTCAGAAGTGGAATGTGGAAGG + Intronic
1112186700 13:97134631-97134653 TGTGAGAAGCGGACTGTGGTGGG - Intergenic
1112926433 13:104680441-104680463 CCTTGGAAGAGGAAAGTGGAAGG - Intergenic
1116394775 14:44434382-44434404 CTTTATAAGAGCACTGTGGAAGG + Intergenic
1120024781 14:79570548-79570570 CCTGAGATGCTGACTGTGCAAGG + Intronic
1124103767 15:26718672-26718694 CCTTAGCAGCAGGCTTTGGATGG + Intronic
1125200496 15:37097815-37097837 CCTTAGGAAGGGACCGTGGAGGG - Intronic
1125474546 15:40038349-40038371 CCAAAGAAGGGTACTGTGGAGGG - Exonic
1128381349 15:67115379-67115401 CCATCAAAGCAGACTGTGGAGGG - Intronic
1131329277 15:91481438-91481460 CCCTAGAAGTGAACTGTGTAAGG + Intergenic
1131356842 15:91752579-91752601 CCTTAGAAGAGGACAGTAGGTGG - Intergenic
1141771067 16:86089909-86089931 GCTGAGAAGAGGACTGTGGAGGG - Intergenic
1146053438 17:29569159-29569181 CCTCAGATGGTGACTGTGGAGGG - Intronic
1156130341 18:33965370-33965392 CCCTAGAAGTGTACTGGGGAGGG + Intronic
1156445722 18:37235400-37235422 CTTCAGAAGAGGCCTGTGGAAGG + Intergenic
1157181379 18:45501285-45501307 CCTTATAAGGGGAGTGTTGATGG - Intronic
1163223122 19:15935683-15935705 CCTTAGAGGGGGACAGAGGAGGG + Intergenic
1163398803 19:17079339-17079361 CGTTAGGAACGGACTGTGGGAGG + Intronic
928028775 2:27761311-27761333 TCTTAGAACAGGACTGTGAAGGG + Intergenic
929024287 2:37584662-37584684 CCTTAGAATCCAACGGTGGAAGG + Intergenic
933833917 2:86231121-86231143 CCAGAGAAGGGGACTGTGCAGGG - Intronic
934583809 2:95470743-95470765 CTTTAAAAGGAGACTGTGGATGG - Intergenic
934595643 2:95605971-95605993 CTTTAAAAGGAGACTGTGGATGG + Intergenic
934883830 2:98007377-98007399 CCTGAGAAGGGGGCTGTGGCTGG + Intergenic
937266199 2:120616060-120616082 CCTGAGAAGGGGACCCTGGAGGG - Intergenic
940112283 2:150168096-150168118 CCTTAGAAGGGGAAGGTGTAGGG + Intergenic
940781222 2:157936164-157936186 TCTTAGAAGGGGAGTGTGGTTGG + Intronic
942017018 2:171827984-171828006 GCTTAGATGCTGTCTGTGGAGGG - Intronic
942033135 2:171983692-171983714 TCTTAGAAGCAAAGTGTGGAAGG - Intronic
945020668 2:205567816-205567838 CATTGGAAGCGGAGTGAGGAAGG + Intronic
945294273 2:208155382-208155404 CCTAAGAAGAGGACCCTGGACGG - Intergenic
1169153867 20:3312655-3312677 CCTTAGAAGGGGACTTGGGCAGG - Intronic
1172939811 20:38646369-38646391 GCTTAGAAGCGGGTTGGGGAGGG + Intronic
1174080935 20:47970364-47970386 GATGAGAAGCGGAGTGTGGAAGG - Intergenic
1182722431 22:32414320-32414342 CCTGATAAGCAGACAGTGGAGGG - Exonic
958892670 3:99797732-99797754 CCTTAGAAGCGGACTGTGGAAGG + Exonic
962032483 3:131615974-131615996 CCTCAGAAGGGGGCTGTGGCGGG - Intronic
964490110 3:157227258-157227280 CCTGAGCAGCTGAATGTGGAGGG + Intergenic
964578959 3:158209060-158209082 CCTTAAAAGGGGAATTTGGATGG + Intronic
964661299 3:159123432-159123454 TCTTAGAAGCTGACTGGGCAGGG - Intronic
967300668 3:188009149-188009171 GCTTGGAAGCGGACTGTGCTTGG - Intergenic
969857084 4:10008668-10008690 CATTAAAAGCGGCCTCTGGATGG + Intronic
975685414 4:76916090-76916112 CCGTGGAAGGAGACTGTGGAGGG - Intergenic
976362887 4:84201181-84201203 CCTTAGAAGAGGAAGGTAGAGGG - Intergenic
980802414 4:137769403-137769425 CCTTAGAAGAAGACTATCGAAGG + Intergenic
981321343 4:143395795-143395817 CCTTAGAAAGGGTATGTGGAGGG - Intronic
985918807 5:2949780-2949802 CCTTCGAAGCCGACTGTTCAAGG - Intergenic
989395319 5:40949600-40949622 CCTAAGAAGCTGACTGTAAATGG + Intronic
992197830 5:74357259-74357281 CCTCAGAAGCAGAGTGAGGAGGG - Intergenic
995075426 5:107977953-107977975 CCTAAGAAGGGAACAGTGGAAGG + Intronic
1001147855 5:169200349-169200371 CCTAAGAAGCTGCCTGGGGAAGG - Intronic
1004066139 6:12246274-12246296 CCTAAGAGGCGGGCTGTGGAAGG - Intergenic
1004305023 6:14492804-14492826 GCTTTTAAGGGGACTGTGGAAGG - Intergenic
1018818504 6:167354557-167354579 CTTTAGAAGCAGACAATGGAAGG - Intronic
1026914409 7:74111488-74111510 CCTTAGAAGCAGACAGTTGTGGG + Intronic
1035168665 7:157006000-157006022 ACTTAGAAGCAGAATGGGGAGGG + Intronic
1037253070 8:16919802-16919824 CCTTGGAAGCTGAATGTGGCTGG - Intergenic
1037327285 8:17705272-17705294 CCTTAGAAACAGGCTGTGCATGG - Intronic
1038037300 8:23697125-23697147 CCTTAGACTCTGACTCTGGATGG + Intergenic
1042281639 8:67062434-67062456 CCTTAAGAGCGGGATGTGGAGGG + Intronic
1049261024 8:141639306-141639328 CCTTGGAAGCGGGGTTTGGAGGG + Intergenic
1051184448 9:14443532-14443554 GCTTAGAAAGGGACTGAGGATGG - Intergenic
1051604066 9:18903629-18903651 CCTTAGAAGGAAACTGTGGTTGG - Intronic
1055307371 9:74943688-74943710 TCTTAGAAGCAGAATGGGGATGG - Intergenic
1057705445 9:97392089-97392111 CCCTAGAAGAGCAATGTGGAAGG - Intergenic
1057747434 9:97763183-97763205 CCTTAGAGGCAGAATGTGGAGGG + Intergenic
1190931994 X:54956713-54956735 CCTGAGATGAGGACTGTGGGAGG - Intronic