ID: 958894474

View in Genome Browser
Species Human (GRCh38)
Location 3:99814495-99814517
Sequence CTCCCCACCATTACTAGTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958894474_958894476 10 Left 958894474 3:99814495-99814517 CCAGGACTAGTAATGGTGGGGAG No data
Right 958894476 3:99814528-99814550 TCCTAAGTCTGAAGAGACAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958894474 Original CRISPR CTCCCCACCATTACTAGTCC TGG (reversed) Intergenic
No off target data available for this crispr