ID: 958895951

View in Genome Browser
Species Human (GRCh38)
Location 3:99829480-99829502
Sequence ATAGGTTATCAGAACTGGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 309
Summary {0: 1, 1: 0, 2: 1, 3: 42, 4: 265}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958895951 Original CRISPR ATAGGTTATCAGAACTGGAA GGG Intronic
902529615 1:17082359-17082381 ATCAGTTATCAGAGCAGGAAAGG + Intronic
903740414 1:25555483-25555505 GTAGTTTTTCAGAACTGGAAGGG + Intronic
903992605 1:27284324-27284346 ATAGAATCTCAGAGCTGGAAAGG - Intronic
905997923 1:42397923-42397945 ATAGGATGTCAGGACTGGGAGGG + Intronic
906967913 1:50477369-50477391 ACAGAATATCAGATCTGGAAGGG + Intronic
907109676 1:51915462-51915484 ATCGATTATCAGATCTGGAAAGG - Exonic
907512628 1:54973102-54973124 ATAGAGTCTCAGAACTTGAAAGG + Intergenic
907714072 1:56911556-56911578 CTTGGTTTTCACAACTGGAAGGG + Intronic
908435726 1:64103941-64103963 TTTGGTTATCACAACTGGAAAGG + Intronic
908965881 1:69762333-69762355 TTAGGTTGTCAGATCCGGAAGGG - Intronic
909427889 1:75548730-75548752 ATAGATTTTCATAGCTGGAAAGG + Intronic
909713759 1:78682035-78682057 ATAGAATTTCAGACCTGGAAAGG - Intergenic
910424248 1:87102692-87102714 ATAGATTCACAGAACTGGGAGGG + Intronic
912250998 1:108012460-108012482 ATAGAATTTTAGAACTGGAAGGG - Intergenic
913370011 1:118087922-118087944 TTTGGTTGTCACAACTGGAAGGG - Intronic
914422064 1:147538258-147538280 ATAGCATTTCAGAACTGGAAAGG + Intergenic
915579851 1:156807055-156807077 ATAGGTGTTCAAAGCTGGAAAGG - Intronic
916388557 1:164305023-164305045 ATGCCTTCTCAGAACTGGAATGG - Intergenic
917065449 1:171087723-171087745 ATAGAATATGAGAAATGGAATGG + Intergenic
919743878 1:200996583-200996605 ATAGGATGTCAGAGCAGGAAGGG - Intronic
920229038 1:204458283-204458305 ATAGGTAATCAGAGCTGGACAGG - Intronic
920233982 1:204490595-204490617 ATAGAGTATCAAAACTGGAAAGG - Intronic
920402914 1:205687978-205688000 ATTGGATTTCAGAACTGAAAAGG - Intergenic
921146340 1:212361527-212361549 ACAGGTTGTGAGGACTGGAAAGG - Exonic
922058012 1:222060120-222060142 ATATTTAATCAGAACTTGAAGGG + Intergenic
922274975 1:224069234-224069256 ATAGAATAACAGGACTGGAAAGG + Intergenic
1063777607 10:9281852-9281874 ATAGGAGACCAGATCTGGAAAGG - Intergenic
1063803278 10:9606331-9606353 ATAGGCAATGGGAACTGGAAAGG - Intergenic
1064611064 10:17103130-17103152 CTGGGTTATCAAAACTGAAATGG - Exonic
1064853939 10:19743608-19743630 ATAAGTTATAAGGACTGAAAAGG + Intronic
1065436920 10:25712392-25712414 ATAGGCTAGAAGGACTGGAAAGG - Intergenic
1066030800 10:31421652-31421674 ATAGGTTTCTAGAAATGGAAAGG - Intronic
1068682631 10:59836870-59836892 ATATATTAACAGAACTGAAAAGG + Intronic
1069135918 10:64765781-64765803 ATAGGTTATGAGAAGAGAAATGG - Intergenic
1069757071 10:70779865-70779887 ATAGATTATCAGAGCTGGGAGGG + Intronic
1070079010 10:73167680-73167702 ATTTGGTGTCAGAACTGGAAGGG + Intronic
1071407703 10:85354900-85354922 ATATGAAATCAGAACTAGAAGGG + Intergenic
1072390377 10:94978793-94978815 AAAGGCTATCAAAATTGGAAAGG - Intronic
1073319972 10:102609653-102609675 AATGGTTATCAGACCAGGAAGGG + Intronic
1073591750 10:104764441-104764463 AAAGGGTATGAGAACTGCAAAGG + Intronic
1074473912 10:113752448-113752470 ATAGAATATCTGAGCTGGAAAGG + Intronic
1077747226 11:4920001-4920023 AAAGGTAATTAGAACTGAAAAGG + Intronic
1079386535 11:19984933-19984955 ATAGAACATTAGAACTGGAAGGG - Intronic
1079412219 11:20200026-20200048 ATAGAACATTAGAACTGGAAGGG + Intergenic
1081503696 11:43693030-43693052 ATAGAATAGCAGAACTGGAAGGG + Intronic
1081816060 11:45943003-45943025 ATAGGTTATGAGAAAAAGAATGG - Intronic
1082808292 11:57463597-57463619 ACAGAGTATCAGAGCTGGAAAGG - Intronic
1083257401 11:61505199-61505221 ATACGATGTCAGAGCTGGAAGGG - Intergenic
1085589357 11:77743684-77743706 ATAAGTCATCTGAATTGGAAAGG - Intronic
1086120814 11:83302977-83302999 AAAGATTCTCAGAGCTGGAAGGG + Intergenic
1087123719 11:94601474-94601496 ATAGATACTCAGAGCTGGAAGGG + Intronic
1088634665 11:111808280-111808302 ATAGGTAATTATAACTGGCAAGG - Intronic
1089848321 11:121476114-121476136 ATGGGATGTCAGAGCTGGAAGGG + Intronic
1089978699 11:122754776-122754798 ATAGGCTATCAGAGCTGGAAGGG + Intronic
1090456610 11:126855696-126855718 ATAAGCTCTCAGGACTGGAAAGG - Intronic
1090457521 11:126862748-126862770 ATAGAATGCCAGAACTGGAAAGG - Intronic
1090464019 11:126917279-126917301 AAAGGTTATCAGGACTGAGACGG + Intronic
1090674671 11:128979904-128979926 ATAGAATTTCAGAGCTGGAAGGG + Intronic
1093419632 12:18960080-18960102 ATAGGAAATCCAAACTGGAAAGG - Intergenic
1095316857 12:40773391-40773413 ATAGGTTTTGAGAATTTGAAAGG - Intronic
1095685715 12:45030899-45030921 ATAGCTTCTCAGAACTGAAAGGG + Intronic
1097083772 12:56452702-56452724 ATAACGTATTAGAACTGGAATGG + Intronic
1097334831 12:58370423-58370445 ATAGATGATCAGAGCTGGCAGGG + Intergenic
1099751316 12:86777414-86777436 ATAATTTATCAGAATTGGACTGG + Intronic
1099906791 12:88780561-88780583 ATAGGTTTTCAGAAGGGGAGAGG - Intergenic
1100164665 12:91902730-91902752 ATAGTTTATGAAAAATGGAAGGG + Intergenic
1100360421 12:93873374-93873396 AAAGGTCATCCAAACTGGAAAGG - Intronic
1100762349 12:97823064-97823086 AGAGGTTATTACAACTGGAAAGG - Intergenic
1101019353 12:100537323-100537345 ATAAGATATTAGAACTAGAAAGG + Intronic
1101106031 12:101441124-101441146 ATAGAATATTAGAGCTGGAAGGG + Intergenic
1101627187 12:106456789-106456811 ATAGAATATTAGAATTGGAAAGG - Intronic
1101636200 12:106544012-106544034 ACAGGATATCCAAACTGGAAAGG + Intronic
1102700336 12:114833731-114833753 ATCACTTATAAGAACTGGAATGG + Intergenic
1105981629 13:25522374-25522396 AAAGGGCATCCGAACTGGAAAGG - Intronic
1106504456 13:30359097-30359119 CTAGGGTATCAGAGTTGGAAGGG - Intergenic
1109285482 13:60404094-60404116 ATACATCATCAGTACTGGAAAGG - Intronic
1109484445 13:63000347-63000369 AAAGGACATCAAAACTGGAAAGG + Intergenic
1109800468 13:67371112-67371134 AAAGGTTTTAAGAGCTGGAATGG + Intergenic
1109849044 13:68036440-68036462 ACAGTTTCCCAGAACTGGAAAGG + Intergenic
1115029049 14:28773394-28773416 AAAGGATATCAGGACTGGAATGG + Exonic
1115517670 14:34202241-34202263 ATAGATTCCTAGAACTGGAAGGG - Intronic
1117421929 14:55555252-55555274 ATGGGTTCTGAGAACTGGGAAGG - Intergenic
1117455228 14:55890334-55890356 TTTGGTTGTCACAACTGGAAAGG - Intergenic
1117831941 14:59760400-59760422 ATAGGAGACCAGAAGTGGAAGGG + Intronic
1117866555 14:60155562-60155584 ATAGGATAAAAGAACAGGAATGG - Intronic
1123831035 15:24137638-24137660 ATATGTCATCAGAACTGCCATGG + Intergenic
1124080656 15:26491857-26491879 AGAGGTTATCAGCAGAGGAATGG - Intergenic
1125336534 15:38631961-38631983 CTTGGTTCTCACAACTGGAAAGG + Intergenic
1125387894 15:39157693-39157715 ATAAGTCATCAAAACTGAAATGG + Intergenic
1126826477 15:52554807-52554829 ATAGATTATCAGAGCTGGGAGGG - Intronic
1129394298 15:75235807-75235829 ATAGGAAATCAGACCTGGAGAGG + Intergenic
1129586141 15:76868143-76868165 TTATGTTTTCATAACTGGAAGGG - Intronic
1129814713 15:78541192-78541214 ATAGGGAATCAAGACTGGAAAGG - Intronic
1130784500 15:87081357-87081379 ATAAATGATTAGAACTGGAAAGG + Intergenic
1135075977 16:19393912-19393934 TTAGCTTATCAGGACTGAAATGG + Intergenic
1135687631 16:24510960-24510982 ATAGGTTATCAGAAGTGATATGG - Intergenic
1136492792 16:30621377-30621399 ATGGGATATCAGAACGGAAAAGG - Intronic
1136722140 16:32330442-32330464 ACAGGATATCTGAATTGGAAAGG + Intergenic
1136840464 16:33536409-33536431 ACAGGATATCTGAATTGGAAAGG + Intergenic
1137272319 16:46910036-46910058 TTAGGTTAGCAAATCTGGAAGGG - Intronic
1137973207 16:53006276-53006298 ATAGCATGCCAGAACTGGAAAGG + Intergenic
1140798436 16:78462678-78462700 ATTGGTGATTAGAACTGGAAAGG + Intronic
1203004291 16_KI270728v1_random:187332-187354 ACAGGATATCTGAATTGGAAAGG - Intergenic
1203135901 16_KI270728v1_random:1723750-1723772 ACAGGATATCTGAATTGGAAAGG - Intergenic
1203150630 16_KI270728v1_random:1836702-1836724 ACAGGATATCTGAATTGGAAAGG + Intergenic
1144114657 17:12075776-12075798 ATTGGTTATCACTACTGGAATGG - Intronic
1147252254 17:39159988-39160010 ACTGGTTACCAGAAATGGAAGGG - Intronic
1149480788 17:57001503-57001525 ACAGGTTCTCTGAACTGGCAGGG + Intronic
1149981378 17:61314045-61314067 GTAGAATGTCAGAACTGGAAGGG + Intronic
1150192154 17:63254441-63254463 ATAGGGCATCCAAACTGGAAAGG - Intronic
1151386513 17:73758412-73758434 ATACGTTATCAGATAAGGAAAGG + Intergenic
1153791192 18:8581408-8581430 AGAGGTTATAAGAGCTGGTAAGG - Intergenic
1154085521 18:11301689-11301711 AAAGGATATCTGCACTGGAAAGG - Intergenic
1156087326 18:33421717-33421739 TTAGGTTATCAATGCTGGAACGG + Intronic
1157081694 18:44532519-44532541 ATTGGTGAAAAGAACTGGAAAGG + Intergenic
1157103512 18:44751392-44751414 AGAGGTTATCAGATCAGCAAGGG + Intronic
1157221186 18:45829401-45829423 ATAGGTTATCAGCAGAGAAAGGG - Intronic
1158303746 18:56082135-56082157 AATGGTTATGAGAATTGGAATGG + Intergenic
1159137414 18:64352451-64352473 TAAGGTTATCAGAACAGGAAAGG - Intergenic
1160473827 18:79165440-79165462 GTTGGTTTTCACAACTGGAAAGG - Intronic
1162258384 19:9512129-9512151 ATGGGATATCAGAATGGGAAAGG - Intergenic
1162857003 19:13476408-13476430 ATAGGTGCTCAAAACTGAAATGG - Intronic
1163023787 19:14497619-14497641 AGAGGTCAGCAGAACAGGAAGGG - Intergenic
1164400295 19:27897464-27897486 ACAGGATATCAGAAATGGAAGGG + Intergenic
1164411758 19:28012166-28012188 AGAGGATGTCAGAGCTGGAAGGG + Intergenic
1164516774 19:28943476-28943498 AGAGGATGTCAGAGCTGGAAGGG + Intergenic
1165817161 19:38649222-38649244 AAAGGTGATCAGAAGTGGAGTGG + Intronic
1166161723 19:40958958-40958980 TTAACTTATCAGAACTGAAATGG - Intergenic
1166403284 19:42500359-42500381 TAAGGTTATCAGAAATTGAAAGG - Intergenic
925411443 2:3642068-3642090 ATCGGTTGGCAGAACTGGGAGGG + Intronic
926100310 2:10111868-10111890 ATAGGATATTAGCATTGGAAAGG + Intergenic
926849396 2:17178298-17178320 ATGTGTTATCAGAACTCAAAAGG - Intergenic
927305433 2:21566417-21566439 ATAGCATTTCAGAGCTGGAAAGG - Intergenic
928245211 2:29620680-29620702 ATTGGCTATTAGAGCTGGAAGGG - Intronic
929768961 2:44875387-44875409 ATAGCTTAGCTGAACTGGACTGG + Intergenic
929915938 2:46135680-46135702 CTCGGTTATCAGCACTGCAATGG + Intronic
932155257 2:69411025-69411047 ATATGTTATTAAAACAGGAAGGG + Intronic
932721914 2:74144819-74144841 CTAGGATATCAGAGCTGGAGTGG - Intronic
935150862 2:100434107-100434129 ATAGGGTATTAGAGCTGGAAGGG - Intergenic
935733223 2:106083791-106083813 ATATATTACAAGAACTGGAATGG - Intergenic
937458238 2:122062575-122062597 ATAGAGTTCCAGAACTGGAAGGG - Intergenic
939596387 2:144128745-144128767 AGAACTTTTCAGAACTGGAAGGG - Intronic
940738907 2:157484761-157484783 ACATTTTATCAGGACTGGAAGGG + Intronic
941739778 2:169022923-169022945 ATAGGTTTTCAAAACAGGAATGG - Intronic
941847404 2:170147203-170147225 ACAGATCACCAGAACTGGAAAGG - Intergenic
942856401 2:180555059-180555081 ATAGGTTATGGGAAGTAGAATGG + Intergenic
943041071 2:182805846-182805868 TTAGGTTATCAGCACTTGAATGG + Intergenic
943562525 2:189481179-189481201 ACAGAATATCAGAGCTGGAAGGG - Intergenic
943692577 2:190882814-190882836 ATAGCTTTTTAGAACTTGAAAGG - Intronic
945500493 2:210567063-210567085 ATAGGTTATCAGTAAAGTAATGG + Intronic
946036116 2:216743606-216743628 ATAGGATGTCAGAACTAGAAGGG - Intergenic
1172829876 20:37824641-37824663 AGAGGTCAGCAGGACTGGAATGG + Intronic
1173405136 20:42757821-42757843 GCAGGTTATGAGAACTGGTAAGG + Intronic
1173743913 20:45421715-45421737 ATAGTTTCTCAAAACTGGAACGG + Intronic
1174503102 20:50999885-50999907 ATAGGCTAACAGGACTGGATGGG + Intergenic
1176269309 20:64227388-64227410 AGAGGGAAGCAGAACTGGAACGG - Intronic
1177539979 21:22479707-22479729 AAAGGGTAACCGAACTGGAAAGG + Intergenic
1178092750 21:29181702-29181724 ATAGGAAATTAAAACTGGAAGGG - Intergenic
1178199653 21:30389637-30389659 ATAGGATTTCAGCACTGAAATGG + Intronic
1179181961 21:39053345-39053367 AGACGTGATCAGAACTGGGAGGG - Intergenic
1180237799 21:46474781-46474803 CTAGGTTTTCAGAATTGAAAAGG + Intronic
1183940009 22:41288693-41288715 TTGGGTTTTCGGAACTGGAAGGG + Intergenic
949183455 3:1163058-1163080 TTGGGTAATCAGAACTGGAAAGG - Intronic
951579277 3:24144689-24144711 ATAGTATTTTAGAACTGGAAGGG + Intronic
951631202 3:24722618-24722640 ATAGGTTATCATGAGTGCAAAGG - Intergenic
951685688 3:25341680-25341702 TTTGGTTGTCACAACTGGAAGGG + Intronic
951897531 3:27624467-27624489 GTAGGTTGTCACCACTGGAAAGG + Intergenic
952826155 3:37526789-37526811 ATAGGATCTCAGAGCTGGAAGGG + Intronic
953353579 3:42234521-42234543 AGAGCTCATCAGAAATGGAAGGG - Intergenic
955787886 3:62558986-62559008 ACAGCTTATCAGAGCTGGGATGG - Intronic
955893034 3:63670384-63670406 AAAGATTATCAGAATGGGAAGGG - Intronic
957535938 3:81503629-81503651 TTAGGGAATCAGAAGTGGAAGGG + Intronic
958895951 3:99829480-99829502 ATAGGTTATCAGAACTGGAAGGG + Intronic
960929084 3:122826004-122826026 TTAGAGTATGAGAACTGGAAGGG + Intronic
960991261 3:123313201-123313223 ACTGATTGTCAGAACTGGAAGGG - Intronic
962810573 3:138955703-138955725 ATAGCATATCTGAACAGGAAGGG + Intergenic
964096056 3:152933057-152933079 ATATGTTTGCAGAATTGGAAGGG + Intergenic
964555355 3:157931081-157931103 ATAGGATCTCAGAATTGAAAGGG + Intergenic
965762811 3:172097929-172097951 ATAGATTAGTAGAACTGGCAGGG + Intronic
966432657 3:179848679-179848701 TTAGAATATCAGAGCTGGAAGGG + Intronic
966504206 3:180680333-180680355 ATAGTATCTCAGAACTGGAAAGG + Intronic
966531164 3:180982039-180982061 TTAGGTTATCAGAATTGTGAAGG + Exonic
967224421 3:187277075-187277097 ACAGACCATCAGAACTGGAAGGG + Intronic
967704826 3:192637644-192637666 ATAGGACGCCAGAACTGGAAGGG + Intronic
968644992 4:1735935-1735957 GGAGATGATCAGAACTGGAAAGG + Intronic
969553164 4:7885891-7885913 AAAGGGTATCAGAACTCGAGTGG + Intronic
970781044 4:19738214-19738236 ATAGGTAATCACAAATGAAAAGG + Intergenic
972622326 4:40759442-40759464 AGAGGTTATGATAACTGCAAAGG - Intronic
972835323 4:42863291-42863313 ATAAAATATCAGAACTAGAAAGG - Intergenic
975370398 4:73579291-73579313 ATAGATTCTCACAAATGGAATGG + Intronic
978720417 4:111901251-111901273 ATATGTCATCAGAACTGCCATGG - Intergenic
978800892 4:112754381-112754403 ATAGGATGTTAGAACTGGAAAGG - Intergenic
978879170 4:113680230-113680252 AGATTTTATCAGATCTGGAAAGG + Intronic
979885771 4:126025643-126025665 ATAGGTTATAAGATTTGGGATGG + Intergenic
980873315 4:138634921-138634943 ATAGACTGACAGAACTGGAAGGG - Intergenic
981598470 4:146455649-146455671 ATAGATTCACAGAACTGCAATGG + Intronic
982147954 4:152418193-152418215 ATAGGGTATTTGAACTGAAATGG + Intronic
983268960 4:165538833-165538855 GGAGGTTAACATAACTGGAAGGG + Intergenic
986536259 5:8790880-8790902 ATATGCTATCAGAACTGGCAAGG + Intergenic
987515944 5:18907992-18908014 ATGGGTTATCATGACAGGAATGG + Intergenic
987629075 5:20444064-20444086 CTAAGCTATTAGAACTGGAAAGG - Intronic
988861078 5:35280025-35280047 ATAAGTCATCAAAATTGGAAAGG + Intergenic
989123270 5:38026018-38026040 ATAGAGTATCAGAACTTGAAGGG - Intergenic
989334185 5:40296046-40296068 ATAAGCCATTAGAACTGGAATGG - Intergenic
990470060 5:56107108-56107130 ATAGGGTTTCAAAAATGGAAAGG - Intronic
991028376 5:62055410-62055432 AAAGGGTATCTGAATTGGAAAGG - Intergenic
991402409 5:66266179-66266201 ATTGGTAACCAAAACTGGAAAGG - Intergenic
991523406 5:67527724-67527746 AAAGGATATAAGAATTGGAAAGG - Intergenic
992809034 5:80367727-80367749 ATAAATTCTCAGAAGTGGAATGG - Intergenic
993760504 5:91790754-91790776 ATCGTTTATAAGAATTGGAAAGG + Intergenic
994110148 5:95993440-95993462 TTTGGTTATCACAACTGGAGTGG + Intergenic
994703997 5:103176827-103176849 ATAGAGCATCAGAACTGAAAAGG - Intronic
994988693 5:106970677-106970699 ATAAATTATCAGAACTGGGCTGG - Intergenic
995199133 5:109407592-109407614 ATAAGTTATAAAAACTGAAAAGG + Intronic
995514996 5:112945243-112945265 AAAGGTCATCCAAACTGGAAAGG + Intergenic
995551683 5:113287958-113287980 GTAGGTGATCAGAACTGGGATGG - Intronic
996901094 5:128542363-128542385 ATAGGTAACCAGATCTAGAATGG + Intronic
998049986 5:139024096-139024118 AGAGCTTATCATACCTGGAAGGG - Intronic
998137617 5:139682355-139682377 ATAGGAGAGCAGAAATGGAAGGG - Intronic
998179038 5:139923598-139923620 ATAGGACATGAGAGCTGGAAGGG - Intronic
999059617 5:148619272-148619294 ATAGATTATTAAAACTGGAAGGG - Intronic
999604486 5:153299438-153299460 ATAGAATGTCAGAACTGAAAAGG - Intergenic
999643490 5:153695646-153695668 CTAGAATGTCAGAACTGGAAGGG - Intronic
1001252522 5:170158122-170158144 ATAGATCAACAGAACTGAAATGG - Intergenic
1001429228 5:171646333-171646355 ACAGGTTTTTAGAACAGGAATGG + Intergenic
1003214562 6:4097595-4097617 CTATGTTATCAGAAATGGAATGG - Intronic
1003865197 6:10356726-10356748 ACCAGTTATCAGAACTTGAAGGG - Intergenic
1005681404 6:28212204-28212226 TGAGGTTGTCAGAGCTGGAAGGG + Intergenic
1006798964 6:36747525-36747547 CTGGGCTATCAGAGCTGGAAGGG - Intronic
1009635107 6:66254830-66254852 ATAGGTCATCTAAATTGGAAAGG + Intergenic
1010024612 6:71201025-71201047 AAAGGATTTCAGAATTGGAAGGG + Intergenic
1010657779 6:78532429-78532451 TTTGGTTTTCAAAACTGGAAGGG - Intergenic
1011033569 6:82949043-82949065 AAAGGGTATCTAAACTGGAAAGG + Intronic
1011322443 6:86111268-86111290 AAAGGTTATCCAAATTGGAAAGG - Intergenic
1012892653 6:104914320-104914342 AAAGGGCATCAAAACTGGAAAGG + Intergenic
1014186228 6:118437287-118437309 ATAGGGAATCCGAACTGGAAAGG - Intergenic
1014659694 6:124153975-124153997 TTAGAATATCAGAAATGGAAGGG - Intronic
1015249029 6:131107428-131107450 ATAGAATAACAGAACTGGAAGGG + Intergenic
1015496033 6:133884298-133884320 ATAGTTTGTCAGAATTGGATGGG - Intergenic
1015991763 6:138952226-138952248 AAAGGGCATCTGAACTGGAAAGG + Intronic
1016033286 6:139359641-139359663 ATAGGTACTCAGAACAGGAAAGG + Intergenic
1016852422 6:148634655-148634677 AGAAATTATTAGAACTGGAAAGG - Intergenic
1017072399 6:150587179-150587201 AAAATTTTTCAGAACTGGAAAGG - Intergenic
1017508171 6:155087968-155087990 ATAGGATATCAGGATTGGGATGG - Intronic
1019760789 7:2811095-2811117 AAAGGAGATCAGAATTGGAAAGG + Intronic
1020771803 7:12404362-12404384 ACAGGTTTTCAGAAGTGGAAAGG + Intergenic
1021107030 7:16648823-16648845 ATAGTTCATCAGATCTGGAGAGG - Intronic
1021850840 7:24807011-24807033 ATATTTTAACAGAAATGGAAGGG - Intronic
1022189499 7:28003666-28003688 ATAGGTTATAGGAAATGGAGAGG - Intronic
1022609917 7:31860242-31860264 ATTGGTTGTCATAACTGGAGTGG + Intronic
1023546903 7:41327410-41327432 AAACGTTGTCAGAACTGAAAGGG - Intergenic
1023664588 7:42509699-42509721 ATTTGTTATCAGAAATGCAAAGG + Intergenic
1023706536 7:42947222-42947244 ATAGGTAATAATAACTTGAAAGG + Intronic
1024019679 7:45355347-45355369 ATAGGTTAAAAGAAAAGGAATGG + Intergenic
1036030879 8:4971142-4971164 ATAGATTATGAGAGTTGGAAGGG - Intronic
1037631037 8:20656696-20656718 ACAGATTATCAGAGCTGAAAGGG - Intergenic
1044791974 8:95857340-95857362 AGAAGCTATCAGCACTGGAATGG + Intergenic
1045421785 8:102023648-102023670 ATATATTCTTAGAACTGGAAGGG - Intronic
1045635921 8:104189855-104189877 ATAGAATATCAGAGCTGGAAGGG + Intronic
1047187712 8:122649304-122649326 CTTGGTTATCACAACTGGAGCGG - Intergenic
1047800837 8:128307820-128307842 TTAGGATTTCAGAACTGGAAGGG - Intergenic
1047858195 8:128935747-128935769 AGAATTCATCAGAACTGGAATGG + Intergenic
1048054258 8:130848396-130848418 ATAGATTATGATAACTGAAATGG - Intronic
1048332582 8:133480797-133480819 AGAAGTTATCAGAAAGGGAATGG - Intronic
1049110374 8:140638556-140638578 ATAGACTATTAGAGCTGGAAGGG - Intergenic
1049148417 8:141018989-141019011 ATAGGATTTGAGAGCTGGAAGGG + Intergenic
1049928729 9:435073-435095 TTTGGTTATCACAACTGGGATGG + Intronic
1050126816 9:2365260-2365282 ATTGGTTAACATAACTGCAATGG + Intergenic
1050740423 9:8813318-8813340 ATAGCTTATCAGAATTCAAAAGG + Intronic
1051105094 9:13570287-13570309 ATAGTGTTTCAGAGCTGGAAGGG - Intergenic
1051665728 9:19465492-19465514 TTAGGTTGTCACAACTGGAAGGG - Intergenic
1051780186 9:20681572-20681594 ATAGGCTTTTAGAACTAGAAAGG - Intronic
1052473595 9:28930525-28930547 ATTGGATATCAGAACTTCAAGGG + Intergenic
1052960275 9:34289840-34289862 ATAGGTCAAAAGAACAGGAAGGG + Intronic
1052960425 9:34291491-34291513 ATAGGGCATCACAACTGGAAGGG - Intronic
1053256458 9:36620463-36620485 ATAGCTACTCAGAGCTGGAATGG - Intronic
1055180814 9:73384188-73384210 AAAGGATATCCAAACTGGAAAGG - Intergenic
1055569881 9:77605865-77605887 ATAGGATCTTAGAACTCGAAAGG - Intronic
1056061675 9:82889697-82889719 ATAGAATATCAGAAGAGGAAGGG - Intergenic
1058201609 9:102049062-102049084 ATAGTGAATCAGAATTGGAAAGG + Intergenic
1059454942 9:114394449-114394471 ATAGGATGTCAGAGCTGTAAAGG - Intergenic
1059815140 9:117903747-117903769 ATATGTTAGCAGATTTGGAAAGG - Intergenic
1059975424 9:119711332-119711354 ATAGGGTAGCAGCACTGAAATGG - Intergenic
1060289723 9:122290346-122290368 ACAGATTATTAGAGCTGGAAGGG - Intronic
1061453076 9:130679055-130679077 ACAGGTTGTCAGAACCAGAAGGG - Intronic
1061598799 9:131651293-131651315 GTAGGATGTGAGAACTGGAAAGG + Intronic
1186601764 X:11045787-11045809 AAAGGGCATCAAAACTGGAAAGG - Intergenic
1186637408 X:11421407-11421429 TTTGGTTATCATAACTGGCAGGG - Intronic
1186946170 X:14570072-14570094 AGAGGTTACCAGAAGTGGCAGGG + Intronic
1186999346 X:15159129-15159151 TTCGGTTGTCACAACTGGAAGGG + Intergenic
1187841784 X:23496077-23496099 ATAGGTTATCTGGACTTGGAGGG - Intergenic
1188618774 X:32193522-32193544 ATATGTTAGCAGAACAGCAAAGG - Intronic
1189662624 X:43318213-43318235 ATATGTTATCATAACTGAAAGGG - Intergenic
1191858167 X:65644297-65644319 CTAGGATATCAGAGCTGGAAGGG + Intronic
1192794402 X:74414229-74414251 ATAGCGCATCAGAGCTGGAAGGG - Intergenic
1194246672 X:91520963-91520985 AAAGGATATCTGAATTGGAAAGG - Intergenic
1194273860 X:91855965-91855987 AAAGGTTATCCAAATTGGAAAGG - Intronic
1195519469 X:105814299-105814321 ATAATTTCTCAGAATTGGAAAGG + Intergenic
1195666478 X:107435638-107435660 ACTGATTATCAGAATTGGAAAGG + Intergenic
1197581567 X:128290140-128290162 ATAGGGCATCTGAATTGGAAAGG + Intergenic
1197976900 X:132175431-132175453 ATAGGATGTCAGTACTGGAAGGG + Intergenic
1198322957 X:135537465-135537487 ATAGGATATAAAAACTGCAAGGG + Intronic
1199265235 X:145820420-145820442 ATTGGATATCAGAGCTGGGAGGG + Exonic
1199700107 X:150369313-150369335 ATAGTGTTTTAGAACTGGAAGGG - Intronic
1200565631 Y:4762231-4762253 AAAGGATATCTGAATTGGAAAGG - Intergenic
1200591097 Y:5077382-5077404 AAAGGTTATCCAAATTGGAAAGG - Intronic
1200983027 Y:9279423-9279445 ATAACTTATCAGGACTGAAATGG + Intergenic
1201863261 Y:18622856-18622878 TTAACTTATCAGAACTGAAATGG + Intergenic
1201870061 Y:18697522-18697544 TTAACTTATCAGAACTGAAATGG - Intergenic