ID: 958896708

View in Genome Browser
Species Human (GRCh38)
Location 3:99837668-99837690
Sequence CAGGTCAGAAGGAGAAGTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 339
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 313}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958896708_958896714 17 Left 958896708 3:99837668-99837690 CCAACACTTCTCCTTCTGACCTG 0: 1
1: 0
2: 1
3: 24
4: 313
Right 958896714 3:99837708-99837730 TATTTCTAAAAAATGATTTTGGG 0: 1
1: 1
2: 12
3: 211
4: 1581
958896708_958896713 16 Left 958896708 3:99837668-99837690 CCAACACTTCTCCTTCTGACCTG 0: 1
1: 0
2: 1
3: 24
4: 313
Right 958896713 3:99837707-99837729 TTATTTCTAAAAAATGATTTTGG 0: 1
1: 1
2: 12
3: 179
4: 1527

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958896708 Original CRISPR CAGGTCAGAAGGAGAAGTGT TGG (reversed) Intronic
900236795 1:1596926-1596948 CAGGTCAGAAGGAGGGGTTGGGG + Intergenic
900906399 1:5562683-5562705 CAGTGCAGAGGGGGAAGTGTGGG - Intergenic
901147212 1:7073363-7073385 GAGTTCAGAGGGAGAAGTTTAGG + Intronic
901646301 1:10718555-10718577 CAGGGCAGAACCAGAAGTGGGGG - Intronic
902700141 1:18166836-18166858 CAGGTAGGAAGGAGGGGTGTGGG + Intronic
902719139 1:18292464-18292486 CAGGTCAGAAGCAGCAGGGTGGG + Intronic
903065196 1:20695762-20695784 CAGCACAGAAGGAGAAGTCGAGG - Intronic
903273573 1:22207232-22207254 CAGGACAGAAGGCTAAGTGGAGG - Intergenic
903391043 1:22963719-22963741 CAGGCGAGAAGGTGAAGTGCTGG + Intronic
903467781 1:23564282-23564304 GAGGGCAGAAGGAGAAGCATAGG - Intergenic
903581197 1:24372416-24372438 CAGAACAGGAGGGGAAGTGTGGG - Intronic
904876367 1:33657635-33657657 CAGGTCAGAAGGAGGACAGTGGG - Intronic
904922878 1:34022527-34022549 CATGATAGAAGGAGAAGTGCAGG + Intronic
906693818 1:47810859-47810881 CAGGGAAGGAGGAGAAGGGTGGG + Intronic
906746523 1:48225925-48225947 GTGGTGAGAAGGAGAAGGGTGGG - Intronic
906899605 1:49819793-49819815 AAGGTCAGGAAAAGAAGTGTTGG - Intronic
906936006 1:50214623-50214645 CAGGATAGAAGGAGAAATGAGGG + Intergenic
907188375 1:52629425-52629447 CAGGGCAGGAGGAGAAGAGGAGG + Intergenic
910708296 1:90153193-90153215 CAGGGCAGAATGATATGTGTTGG - Intergenic
912689319 1:111792431-111792453 AAGGACAGAAGGGGAAGTGAGGG + Intronic
912936374 1:114006973-114006995 CATGGCAGAAGGAGAAGGGGAGG + Intergenic
913369678 1:118084089-118084111 TAAGCCAGAAGGAGAAGTGGAGG + Intronic
914331143 1:146671816-146671838 AAGGTCATAATCAGAAGTGTGGG - Intergenic
915102953 1:153513824-153513846 CTGGGCAGAGGGAGAAGTGATGG - Intergenic
915470547 1:156123401-156123423 AAGGTCAGGAGAAGAAGTGAGGG - Intronic
915799095 1:158769586-158769608 GAGGGCAGAAGGAGAAGACTCGG - Intergenic
916062689 1:161111261-161111283 CAGGTCAGAATAAGAAGTTTGGG - Intronic
918113420 1:181477598-181477620 CAGGTCAGAAAGAGGAATGGAGG - Intronic
918288561 1:183083117-183083139 CAGGTAAAGAAGAGAAGTGTTGG + Intronic
918294453 1:183143026-183143048 CAAATCAGAAGGGAAAGTGTGGG - Exonic
919299333 1:195740437-195740459 CATGACAGAAAGGGAAGTGTTGG + Intergenic
919789269 1:201279777-201279799 CAGGAGAGAAGGAGAAGGCTGGG - Intergenic
921164997 1:212500508-212500530 CTGGTCACAATGAGAAGTGCGGG + Intergenic
922528534 1:226325272-226325294 AAGGACAGGAGGAGAAGAGTAGG + Intergenic
922861236 1:228818454-228818476 CTGCTCTGCAGGAGAAGTGTGGG - Intergenic
924355171 1:243165629-243165651 CAGGTCAGACAGATAAATGTAGG - Exonic
924717458 1:246590488-246590510 GAGGGCAGCAGGAGAAGTGGTGG + Intronic
1063074027 10:2696345-2696367 CAGGACAGAGGGTGAAGAGTAGG - Intergenic
1063107050 10:3001487-3001509 CAGGTCATGAGGGGAAGTGGGGG - Intergenic
1063224986 10:4007318-4007340 CAGGTCTCCAGGAGAACTGTTGG - Intergenic
1065492710 10:26297982-26298004 CATGTCAAAAGGTGAACTGTAGG + Intronic
1066224566 10:33369694-33369716 CATGGCAGAAGGCGAAGTGGTGG + Intergenic
1066457769 10:35586569-35586591 CAGATCAGAAGCAGAACTGGTGG - Intergenic
1067832778 10:49620010-49620032 CAGGGCAGAAGGAGAGATGAGGG + Intronic
1068151243 10:53135177-53135199 TAAGCCAGAAGGAGAAATGTGGG - Intergenic
1069726932 10:70586173-70586195 CAGGTAAAAAGGAGAAGAGCTGG + Intergenic
1070154240 10:73823985-73824007 CAGGTCAGCAGGAGACAGGTGGG - Intronic
1070745039 10:78928571-78928593 CATGGCACAAGGAGAAGAGTTGG + Intergenic
1071353625 10:84771036-84771058 GAGGACAGAAAGTGAAGTGTGGG + Intergenic
1072247314 10:93555002-93555024 CAGGTCTGATGGAAGAGTGTAGG - Intergenic
1072735030 10:97873502-97873524 CATGGCAGAAGGACAAGTTTAGG - Intronic
1074035370 10:109733211-109733233 CAGGACAGGAGGTAAAGTGTAGG + Intergenic
1074080233 10:110162801-110162823 CTGTTCAGAAGCGGAAGTGTGGG + Intergenic
1075515952 10:123108420-123108442 CAGGTCAGAAGGGGCAGTGCTGG + Intergenic
1075966571 10:126616925-126616947 CTGGTTAGAAGGGGAGGTGTGGG - Intronic
1076558227 10:131344255-131344277 CAGCTCAGAGGGAGAAGCATCGG + Intergenic
1077063200 11:626633-626655 CAGGACAGAAGGAGGGGTCTGGG + Intronic
1077129785 11:965299-965321 CAGGACAGCGGGAGATGTGTAGG + Intronic
1078389587 11:10925396-10925418 CAGGTGAAAATGAGAAGTTTTGG + Intergenic
1078827395 11:14942244-14942266 CAAGTCAGAATGAGAAGAGCTGG - Intronic
1079489566 11:20972464-20972486 GATGTCTGATGGAGAAGTGTGGG + Intronic
1079845976 11:25468175-25468197 GAGGGCAGCAGGAGAAGTGGTGG + Intergenic
1080886000 11:36368999-36369021 CAGGAAAGAAGTCGAAGTGTAGG + Intronic
1080999292 11:37648012-37648034 CAGCTCAGTAAGAGAAGAGTGGG + Intergenic
1081535015 11:43989951-43989973 CAGGTCAGCAGAGGAAGTGGTGG + Intergenic
1081576768 11:44323614-44323636 CAGGTCAGAAGGAAAGGTGAGGG + Intergenic
1081984174 11:47289619-47289641 CAAGCCAGAATGAGAAGTGCTGG - Intronic
1083191040 11:61052690-61052712 CTGGTCAGGAAGGGAAGTGTGGG - Intergenic
1083420480 11:62549794-62549816 GCGGGCAGAAGGAGAAGAGTTGG - Intronic
1083826785 11:65208416-65208438 CAGGTCAGGAGGAGGAGTATGGG - Intronic
1083897283 11:65626229-65626251 CAGGGCACGAGGAGAAGAGTCGG - Intronic
1084394745 11:68901864-68901886 CATGTGAGAGGGAGGAGTGTGGG - Intronic
1084405152 11:68967805-68967827 GAGGTCATATGGAGAAGTGAGGG - Intergenic
1084974014 11:72786634-72786656 CAGGACATTAGGAGAAGTGCAGG - Intronic
1085517969 11:77122352-77122374 CCGGGCAGAGGGAGCAGTGTGGG + Intronic
1086022630 11:82250163-82250185 CAGGTTAGAAGGAAAGGTGAAGG - Intergenic
1088028719 11:105219669-105219691 CAGGTTATAAAGAGAAGTGGGGG + Intergenic
1088150964 11:106744525-106744547 AAGGTCAAAAGGATAAGGGTGGG - Intronic
1089205704 11:116760771-116760793 CAGGTCAGAATCAGAAGATTTGG + Exonic
1089309319 11:117547446-117547468 CAGGGCAGGAGCAGAAGGGTGGG - Intronic
1091135866 11:133188849-133188871 CAGGCCTGGATGAGAAGTGTGGG - Intronic
1091330158 11:134725648-134725670 CAGGACATGAGGATAAGTGTGGG + Intergenic
1092156500 12:6285226-6285248 CAGGCCAGAGGAAGAAATGTAGG + Intergenic
1096070947 12:48775268-48775290 CAGGGCAGAAGGACAAGGGCTGG - Intronic
1096228388 12:49883694-49883716 CAGGGTAGAAAGAGAAGAGTCGG + Intronic
1097226677 12:57480754-57480776 TAAGGCAGAAGCAGAAGTGTGGG - Intronic
1098804780 12:75009849-75009871 AAGTTCAGATGGAGAAGAGTTGG + Intergenic
1100217798 12:92470419-92470441 CTCGTCAGAAGGAAAAGTGTGGG - Intergenic
1105577199 13:21664925-21664947 CAGAGCAGAAGCAGAAGAGTAGG - Intergenic
1105968399 13:25405192-25405214 CAGTGCAGAAGGAGAAGAGGAGG + Intronic
1106265107 13:28102561-28102583 TAGGTCAGAAACAGAAGTGAAGG + Intergenic
1106734098 13:32571697-32571719 CAGGACAGAAAAAGAAGTGAGGG - Intergenic
1106801290 13:33259065-33259087 CAGGACAGAAGTACAAGGGTAGG - Intronic
1111750644 13:92327506-92327528 TAGGTCAGAAGGACAAGTTCAGG + Intronic
1111878434 13:93924747-93924769 CAACTCAGAAGGAAAAGTATAGG - Intronic
1112444656 13:99453324-99453346 CAGGGCAGGAGGAGGAGCGTGGG - Intergenic
1113984561 13:114303483-114303505 CTGGTAAGAAGCAGAATTGTCGG + Intronic
1114387514 14:22270328-22270350 CAGGCCAGAATGGGAAGTGGGGG - Intergenic
1114757825 14:25280327-25280349 CAGGTAAGGAAGAGGAGTGTTGG - Intergenic
1115854498 14:37616161-37616183 AAGGTCAGTCGGAGACGTGTGGG + Intronic
1115881655 14:37926082-37926104 AAGATCAGAAGCAGATGTGTTGG - Intronic
1116783338 14:49261054-49261076 CAGGTCAGGAGGACAACTCTAGG + Intergenic
1117525579 14:56599216-56599238 AAGGACAGAAGGACAAGAGTGGG - Intronic
1118793854 14:69121680-69121702 GAGGTCAGAACTAGAAATGTGGG + Intronic
1118919180 14:70134145-70134167 CAGGACAGAAAGAGCAATGTAGG - Intronic
1119191603 14:72686431-72686453 CAACTAAGAAGCAGAAGTGTAGG + Intronic
1119892673 14:78194651-78194673 TGGGTTAGAAGGAGAAGGGTGGG + Intergenic
1120618990 14:86739652-86739674 CAGGCCATGAGGAGAAGTGAGGG - Intergenic
1121444822 14:93972263-93972285 CAGATCAGAAAGATAAGTTTTGG - Intronic
1121560232 14:94869276-94869298 CAGGTCAGAAAGCCAAGTATGGG + Intergenic
1122443734 14:101753921-101753943 AAGGTCAGCAGGAGAAGTAGTGG - Intergenic
1126075076 15:44901314-44901336 CAGGCCACAAGGACAAATGTTGG - Intergenic
1126645359 15:50869930-50869952 CAGGTTGGAAAGAGGAGTGTGGG + Intergenic
1126655373 15:50971545-50971567 CATTTCAGAAGGAGAAGAGAAGG - Intronic
1129131871 15:73505830-73505852 AGGGTAAGAAGGAGAAGTGCAGG - Intronic
1130038809 15:80386426-80386448 TAGGTCAGAGGGAGAAGGTTCGG + Intronic
1130088096 15:80795395-80795417 CAGTGGGGAAGGAGAAGTGTGGG + Intronic
1130776741 15:86992108-86992130 CATGGCAGAAGGGGAAGTGGGGG + Intronic
1131375136 15:91916871-91916893 CAGCTCAAAAGGAGAGGTGATGG + Intronic
1131617430 15:94031444-94031466 CAGGCCAGAAGGAGAAGAGATGG + Intergenic
1133353661 16:5120033-5120055 CAGGTAATAAGGAGAGGTCTGGG + Intergenic
1133404744 16:5514525-5514547 CAGGGCAGAAGGCATAGTGTGGG + Intergenic
1133905738 16:10020967-10020989 GAGGTGAGAGGGAGAAGTTTGGG - Intronic
1134741484 16:16550995-16551017 TAGGGCAGAAGGGGAAGTGGAGG + Intergenic
1134926074 16:18161437-18161459 TAGGGCAGAAGGGGAAGTGGAGG - Intergenic
1135610240 16:23859955-23859977 CAGGTGAAAATGAGAAGTGATGG + Intronic
1136142550 16:28296815-28296837 CAGGTCAGGAGGGGAAGGGAAGG - Intronic
1137263712 16:46851901-46851923 GAGGGCAGGAGGAGAAGTGGGGG - Intergenic
1138583482 16:57956419-57956441 CAGGTCTGATGGAGAGGCGTGGG - Intronic
1139381446 16:66534519-66534541 CAGGCCAGAGGGAGATGGGTAGG - Intronic
1139515956 16:67452502-67452524 CAGGTCCCAAGGAAAAGAGTGGG + Intronic
1139768593 16:69253973-69253995 TAGGTCAGTAGGAGGAGTGAAGG + Intronic
1140002410 16:71039088-71039110 AAGGTCATAATCAGAAGTGTGGG + Intronic
1141146064 16:81530920-81530942 CAGTTCAGCAGGAGAAGGGCGGG - Intronic
1141368807 16:83468419-83468441 CAGGTCAGAAGTCAAGGTGTGGG - Intronic
1142645062 17:1306164-1306186 CAGATCAGAAGGTGAAGAGATGG + Intergenic
1144036011 17:11366653-11366675 CAGGACAGATGGAGAAGAGTGGG + Intronic
1146127597 17:30241100-30241122 AAGGGCAGCAGGAGAAGTGGTGG + Intergenic
1146559731 17:33857764-33857786 AAGGTCTGAAGGAGATATGTTGG - Intronic
1146616420 17:34360471-34360493 CAGGGCAGAAGGAATGGTGTAGG + Exonic
1148199316 17:45739629-45739651 CAAGGCAGAAGGAGTAGTGGGGG + Intergenic
1148904810 17:50905303-50905325 CAGGTCAGAGGCAGAGGTGATGG - Intergenic
1150221364 17:63497462-63497484 CAGGGCAGGAGGAGCAGGGTGGG - Intronic
1150867930 17:68874041-68874063 CAGTTCACAAGGAGAACTGGGGG + Intronic
1151556987 17:74851642-74851664 CAGGGCTGAAGGAGAAGTCTCGG + Exonic
1152005102 17:77675695-77675717 CAGGCTAGAAGGAACAGTGTGGG - Intergenic
1153643751 18:7176474-7176496 TAGATCAGAACGAGAAATGTGGG - Intergenic
1153688006 18:7566468-7566490 CAGGGGAGAAAGAGAAGTGGGGG - Intergenic
1156065834 18:33141423-33141445 CAGATCAGAAGCAGAAGAGCTGG + Intronic
1156121251 18:33845443-33845465 CAGTTCAGCAGCTGAAGTGTTGG - Intergenic
1156138705 18:34078555-34078577 CATTTCAAAAGGGGAAGTGTAGG + Intronic
1157090727 18:44633731-44633753 CAGATCACAAGGTGAAGAGTTGG - Intergenic
1157448948 18:47771422-47771444 CTGGTCAGAAATAGAATTGTTGG - Intergenic
1157814273 18:50719699-50719721 CAGGCCAGACGGAGAAGAGCTGG + Intronic
1157970043 18:52256564-52256586 CAGCTAAGAAGGTGACGTGTTGG - Intergenic
1159069220 18:63604907-63604929 CTGGTCAGAAGCAGAAGAGCTGG - Intergenic
1159590628 18:70331710-70331732 CAGATTGGATGGAGAAGTGTTGG + Intergenic
1164844732 19:31422318-31422340 CAGGCGAGAAGGACAAGTTTGGG - Intergenic
1164917648 19:32064961-32064983 CCTGTCAGAAGGTGAAGTGTGGG - Intergenic
1165332945 19:35151437-35151459 CAGGCAAGAAGGTGAAGTGCAGG + Exonic
1165544110 19:36519408-36519430 GAAGTCAGAAGGGGAAGTATGGG + Intronic
1165749745 19:38252636-38252658 CAGCTCAGAAGGAGCAGAGCTGG - Intronic
1166481067 19:43174872-43174894 CATGGCAGAAGGGGATGTGTTGG + Intronic
925414555 2:3660217-3660239 CAGGGCAGAAGAGGAAGCGTGGG - Intronic
925883136 2:8369597-8369619 CCAGTCAGAAGGAGAAGTGGAGG + Intergenic
926316865 2:11716238-11716260 CGGGATAGAAGGAGAGGTGTGGG - Intronic
926996728 2:18743155-18743177 CAGGAGAGAAGGAGCAGGGTGGG + Intergenic
927197422 2:20558190-20558212 CAGTTCTGAAGGAGAAGAGGTGG + Intergenic
927217657 2:20677480-20677502 CTGGTCAGATGGAGCAGTGCAGG - Intergenic
928519277 2:32072518-32072540 CAGGCCATAATGAGAAGTGGGGG - Intronic
929547047 2:42862675-42862697 CAGGTAGGAAGGAGGTGTGTTGG + Intergenic
930535696 2:52643564-52643586 AAGGTCATAAGGAGTAGGGTGGG - Intergenic
932103604 2:68923496-68923518 CAGGACAGAATAAGAAGTGTGGG - Intergenic
934761522 2:96859474-96859496 CTGGCCAGAAGGAGAAGTCAGGG - Intergenic
935131652 2:100265288-100265310 CTGGGGAGAAGGAGAAGGGTGGG - Intergenic
935135348 2:100295658-100295680 CAGGTAAGAAGGAAAAGGGATGG + Intronic
936081092 2:109432826-109432848 CAGCTCAGAAGGTGAAATGTGGG - Intronic
938234916 2:129698344-129698366 GAGATCTGAAGGAGAAGGGTGGG + Intergenic
938762308 2:134436893-134436915 CAAGTCAGAAGGAGCAGACTGGG - Intronic
939436720 2:142186231-142186253 GGGGTCAGAAGGAAAAGTCTAGG + Intergenic
939459420 2:142480127-142480149 AATGTCAGATGGAGAAGAGTTGG + Intergenic
939760257 2:146167484-146167506 CATGGCAGAAGGCGAAGTGGGGG + Intergenic
941482430 2:166033372-166033394 CATGTCAGAGGGAGAAGTCCTGG - Intronic
941972089 2:171361973-171361995 CAGGTTAGGAGGAAAAGTGGTGG + Intronic
942323145 2:174753533-174753555 CAGTTAAGAAGGAGAAGAGCAGG + Exonic
945333583 2:208566431-208566453 TAGATGAGAAAGAGAAGTGTCGG + Intronic
946901060 2:224371948-224371970 CATATCAGAGGGTGAAGTGTGGG + Intergenic
947151876 2:227123744-227123766 CAGGTCTGAGGAAGACGTGTGGG + Intronic
947651506 2:231790288-231790310 TAGGCCAGTGGGAGAAGTGTTGG + Intronic
947842822 2:233219319-233219341 CCAGACAGAAGGAGATGTGTAGG + Intronic
947998424 2:234547766-234547788 AAGGGCAGAAGGAGGAGTGTTGG + Intergenic
948494481 2:238338059-238338081 CAGGTCAGAAGAGGAAGAGGAGG + Intronic
1172263002 20:33584986-33585008 CAGCTCAGATGGAGAAGGGCTGG + Intronic
1174396105 20:50247751-50247773 CAGGTAAGGAGGTGAAGGGTCGG + Intergenic
1174424052 20:50419639-50419661 GAGGTGAGAAGTCGAAGTGTTGG - Intergenic
1174716122 20:52760903-52760925 CTGGTCAGAGGGAGAATTGGTGG + Intergenic
1176984773 21:15422983-15423005 TAGCTCAGAAAGAGGAGTGTGGG + Intergenic
1177320889 21:19519054-19519076 CAGGGCAAAAACAGAAGTGTAGG - Intergenic
1178374535 21:32056078-32056100 CAGGTGAGAAGGACAAGTTGGGG - Intergenic
1179381262 21:40901478-40901500 CAGGTGAGAAACAGAAGGGTTGG + Intergenic
1185343899 22:50303127-50303149 CAGGCCAGAAGCAGGAGTGTGGG - Intronic
1185418670 22:50723140-50723162 CAGGACAGACGGGGAAGTGGTGG - Intergenic
951068177 3:18292505-18292527 GAGGTCAGAAAGAGCAGAGTTGG + Intronic
951153202 3:19317395-19317417 CAGGTCTGAAAGAAAAGTATTGG - Intronic
951934292 3:28004168-28004190 CAGGGCAAAAGGCAAAGTGTTGG - Intergenic
952139490 3:30462348-30462370 CAGAGAAGAAGGAGAAATGTGGG + Intergenic
953497811 3:43403482-43403504 CAGGGCAGCAGGAGAAGGGCCGG + Intronic
953752244 3:45617767-45617789 CAAGTCAGAAGCAGAAGGCTTGG - Intronic
953913470 3:46904320-46904342 CAGGCCAGCAGGTGAAGGGTGGG + Intergenic
954039110 3:47870876-47870898 CAGATCAGGAGCAGAAGTATTGG + Exonic
954195741 3:48995967-48995989 CAAGTCAGAAGGATACGTGGAGG - Intronic
954915980 3:54149022-54149044 CAGATCACAGGGAGAAGTGAGGG + Intronic
955523895 3:59801801-59801823 CAGGCCAGAAGGGTAAGTGGAGG - Intronic
957849179 3:85783369-85783391 CAAATAAGAAGCAGAAGTGTTGG - Intronic
957966631 3:87329921-87329943 CAGGTGGGGAGGAGAAGTGGGGG + Intergenic
958016616 3:87945467-87945489 CAGGTCAGAAGGAAAGGTAGGGG + Intergenic
958896708 3:99837668-99837690 CAGGTCAGAAGGAGAAGTGTTGG - Intronic
959582067 3:107992434-107992456 CATGTCAGGAGGAGAGGAGTAGG - Intergenic
961234467 3:125353267-125353289 CAGGGTACAAGGAGGAGTGTTGG + Intronic
961322444 3:126084873-126084895 CAGGCCATAAGGGGAAGTGGAGG + Intronic
961543821 3:127618340-127618362 CAAGTCAGAGGCAGAAGTGAGGG - Intronic
962964237 3:140338757-140338779 GAGACCAGAAGGGGAAGTGTTGG + Intronic
964035805 3:152195197-152195219 CAGGTTAGAAGAAGAAATGAAGG + Intergenic
964633236 3:158834862-158834884 CAGGTGAGAAGGTGCAGGGTTGG + Intergenic
965323315 3:167273103-167273125 AAGCTCAGAAGGAGAAGAGAAGG - Intronic
966895755 3:184443819-184443841 CATGTCAGAAGGAGAGGGGCTGG + Intronic
968153244 3:196356428-196356450 TAGGTAAGAAAGAAAAGTGTGGG + Exonic
968594033 4:1473226-1473248 GAGGTCAGAAGGTCAAGAGTTGG + Intergenic
969935296 4:10674208-10674230 CCAGGCAGAAGGAGACGTGTTGG + Intronic
970006027 4:11411780-11411802 AATGTCAGAAGGAGAAGTTCAGG + Intronic
971179528 4:24316037-24316059 AAGGTCAGAATGAAAAGTCTTGG - Intergenic
971646316 4:29209228-29209250 GAGGGCAGAAGGAGAAGAGGAGG - Intergenic
974344150 4:60657153-60657175 GAGGGCAGAAGGTGAAGTGAGGG - Intergenic
977002914 4:91525899-91525921 CAGGCCACAAGGGGAAGTGGGGG + Intronic
977363115 4:96031886-96031908 GAGGTTAGAAGTACAAGTGTGGG + Intergenic
979246627 4:118513999-118514021 CAGGTCAGACAGATAAATGTAGG + Intergenic
979269715 4:118745587-118745609 GAGGCCAAAAGGAAAAGTGTGGG + Intronic
980494497 4:133574371-133574393 CAAGTCTGAAGGAGAAGTGCTGG + Intergenic
982808494 4:159796355-159796377 CATGACAGATGGAGAAGTGAGGG - Intergenic
983249909 4:165331639-165331661 AAGGTCAGTTTGAGAAGTGTTGG + Intronic
984862385 4:184252479-184252501 CAGGACTGAAGTAAAAGTGTTGG - Intergenic
985015872 4:185635425-185635447 CACCACAGAAGCAGAAGTGTAGG + Intronic
985205887 4:187536486-187536508 TAGGGCATAAGGAGAAGTCTCGG + Intergenic
986270274 5:6224116-6224138 GAGGTCATAAGGATGAGTGTGGG - Intergenic
987049296 5:14136022-14136044 CTGGGCAGCAGGGGAAGTGTGGG - Intergenic
988986203 5:36621344-36621366 CAGGTGAGAGGGAGCAGAGTAGG + Intronic
990203045 5:53399184-53399206 GTGGTCAGAAGGAGAATTGAGGG + Intergenic
990527127 5:56638952-56638974 AAGATCAGCAGGAGAAGGGTTGG - Intergenic
992554288 5:77888323-77888345 CAGGGCAGGAGGTGAGGTGTTGG - Intergenic
992809426 5:80371875-80371897 AAGGGCAGCAGGAGAAGTGGTGG - Intergenic
993664428 5:90678193-90678215 CAGGGCAAAAGGAGAAGAGAGGG + Intronic
994907707 5:105862149-105862171 AAACTCTGAAGGAGAAGTGTGGG - Intergenic
995010946 5:107256586-107256608 AAGGACAGAAGCAGAAGTATTGG - Intergenic
996075241 5:119185208-119185230 AAGGGCAGAAGGAGAAGGGAAGG - Intronic
998585038 5:143418645-143418667 CAGGTCAGAAGGTGAAGGCAGGG + Intronic
999195812 5:149780876-149780898 GAGGTCAGAAGGGGAAGTTCTGG + Intronic
999500430 5:152141569-152141591 CTGGGCAGATGGAGAACTGTGGG + Intergenic
999773570 5:154793509-154793531 CAGGGCAGAAGAAGAGGAGTTGG + Intronic
1000748136 5:165061358-165061380 CAGGCCAGAAGGACAAGGGCAGG + Intergenic
1000846706 5:166290788-166290810 CTGGGCAGAAAGAGAAGAGTGGG + Intergenic
1001309852 5:170602976-170602998 CAGATCAGAAAGAGAAGTCCCGG + Intronic
1002446834 5:179295255-179295277 CAGGGCAGAAGGTGAAGGGGTGG - Intronic
1002526832 5:179819841-179819863 CAGGTGCGAAGGTGATGTGTGGG - Intronic
1003024620 6:2543104-2543126 GAGATCAGAAGGTGAAGTGGAGG - Intergenic
1004757233 6:18624845-18624867 CAGGCAAGATGGAGAAGTATGGG + Intergenic
1005602747 6:27444329-27444351 CAGGCCACAAGCAGAAGGGTTGG - Intergenic
1006562748 6:34927798-34927820 CTGGTCAGAGGGAGGAGAGTGGG + Intronic
1006680646 6:35794876-35794898 CAGGTCAGAAGAACAAGGGATGG - Intergenic
1007960386 6:45953568-45953590 CAGGTCACGGTGAGAAGTGTTGG + Intronic
1010346159 6:74813462-74813484 CATATCAGAAGGTGAAGGGTGGG + Intergenic
1015630790 6:135230039-135230061 AAGGACACAAAGAGAAGTGTGGG + Intergenic
1016759938 6:147725836-147725858 CAGGACAAAAGGAGAAATGATGG + Intronic
1017049490 6:150377029-150377051 CAGGTCAGAGGGAGACCTGGAGG + Intronic
1017100043 6:150840587-150840609 CAAGTCAGAAGAAGATGAGTCGG + Exonic
1020034055 7:4953151-4953173 CAGGTGAGATGGGGAACTGTAGG - Intronic
1020855375 7:13415018-13415040 CATGTCAGTAGGAGAGATGTTGG + Intergenic
1021397539 7:20168666-20168688 CAAGTCAGGTGGAGAAGAGTGGG + Intronic
1021763474 7:23923971-23923993 CAGTGCAGGATGAGAAGTGTTGG + Intergenic
1022694562 7:32691650-32691672 CAGGTGAGAGGCAGAGGTGTGGG + Intergenic
1024632627 7:51262222-51262244 CAAGGCAGAAGAAGAAGTGCAGG + Intronic
1026041494 7:66872036-66872058 TAGGGCAGAAGGAGGACTGTAGG + Intergenic
1026049393 7:66932267-66932289 CAGGTGAAAGGGAGAGGTGTGGG - Intronic
1026681772 7:72472404-72472426 CAGGTGAGAATGAGAAGTGTTGG - Intergenic
1027349124 7:77292643-77292665 GAGGTAAGAAGGAGAGGTGAAGG - Intronic
1028018043 7:85739470-85739492 AAGCTCAGAAGGAGAAGAGAGGG + Intergenic
1028323512 7:89493012-89493034 CAGTTCTGAATGAAAAGTGTGGG - Intergenic
1028453809 7:91016622-91016644 CAGGTCTTAAGCAGAATTGTAGG + Intronic
1029493612 7:100885397-100885419 CAGGGCTGATGGAGAAGTGGAGG + Intronic
1030828220 7:114187542-114187564 CAGCTCAGAAGAAGAGTTGTAGG - Intronic
1032438362 7:131920961-131920983 CAGGTAAGAAGGTAAAGTGAAGG + Intergenic
1032476020 7:132211923-132211945 GAGGTCAGAAGAAGGAGGGTGGG + Intronic
1033231671 7:139603174-139603196 TAGGTCAGAATAAGAACTGTGGG + Intronic
1033370006 7:140698733-140698755 CAGGTCACAGGGACAAGTGTGGG + Intronic
1034262204 7:149764253-149764275 CAGGACAGAAGGGGAAGTGGAGG + Intronic
1035149029 7:156851037-156851059 CATGACAGAAGGTGAAGTGGCGG - Intronic
1035442902 7:158918295-158918317 CAGGGCAGAAAGAGAAGATTGGG - Intronic
1037508555 8:19557502-19557524 CAAGGCAGCAGGGGAAGTGTGGG - Intronic
1038621641 8:29149094-29149116 CAGGACAGAGGGAACAGTGTGGG + Intronic
1039434690 8:37551957-37551979 CAGGTCAGGAGCTGCAGTGTGGG + Intergenic
1039802700 8:40973809-40973831 CAGGTTAGAAGAAGGGGTGTAGG - Intergenic
1039962682 8:42261819-42261841 CCAGACAGAAAGAGAAGTGTGGG - Intergenic
1041956562 8:63562620-63562642 CAAGTCATATGGAGAAGGGTGGG - Intergenic
1042999872 8:74744861-74744883 GAAGTGAGAAGGAGAACTGTGGG + Intronic
1046020306 8:108657147-108657169 CAGGTTAGAGGGAGAATTCTTGG + Intronic
1046117279 8:109799398-109799420 CAATTCAGAAAGAGATGTGTAGG + Intergenic
1047184414 8:122618995-122619017 AAGGTTTGAAGGAGAAGTGGGGG + Intergenic
1048305975 8:133285055-133285077 CAGGGCAGGTGCAGAAGTGTGGG + Intronic
1048599294 8:135902074-135902096 AAAGTGAGAAGGAGATGTGTAGG - Intergenic
1048944376 8:139430819-139430841 CAGCTGAGAAGGTGAAGTCTGGG + Intergenic
1049854899 8:144855266-144855288 GAGGGCAGTAGGAGAAGTGGTGG + Intergenic
1050471371 9:5994737-5994759 CTGCTCAGTAGGAGAAGTATAGG - Intronic
1051836208 9:21340842-21340864 CAGGGCAGAGGCAGAAGAGTTGG + Intergenic
1051860519 9:21620254-21620276 CAAAGCAGAAGGAGAAATGTGGG + Intergenic
1052988109 9:34502462-34502484 CAGGTCTGAAGCAGGGGTGTAGG + Intronic
1055413447 9:76056405-76056427 GAGGGCAAAAGGAGAAGTGAAGG + Intronic
1058842619 9:108924805-108924827 CAGGGAAGATGGAGAAGTGCTGG - Intronic
1059425350 9:114217557-114217579 CAGGACAGAGGGTCAAGTGTGGG + Intronic
1061746095 9:132741250-132741272 CAGGCATGAAGGAGCAGTGTCGG - Intronic
1062218912 9:135403915-135403937 CAGGGCAGGAGGAGAGGGGTGGG - Intergenic
1185596021 X:1307540-1307562 AAGGTCCAAAGGAGAAGCGTGGG - Intronic
1185647979 X:1628606-1628628 CAGGACAGAAGGAGAAGAGAGGG - Intronic
1186546008 X:10450255-10450277 AAGGTCAAAAGGAGAAGTCTAGG - Intronic
1186705611 X:12137372-12137394 CAGGAGAGGAGCAGAAGTGTGGG + Intergenic
1186895269 X:13998896-13998918 CAAGTCAGAAGGGAAAGTGAAGG - Intergenic
1187269339 X:17765573-17765595 CAAGGCAGAAGGAGGAGTGTAGG - Intergenic
1188142584 X:26570121-26570143 CAGGTGAGAAAGAGAAATGAGGG - Intergenic
1190536829 X:51437330-51437352 AAGGTGAGAAGGAGCAGTGTGGG + Intergenic
1190765149 X:53470043-53470065 AAGGACAACAGGAGAAGTGTTGG - Intergenic
1191037139 X:56038372-56038394 CCTGTCAGAAGGTGATGTGTGGG - Intergenic
1194644209 X:96438737-96438759 TTGGTCAGAAGGATAAGTGGTGG - Intergenic
1194997555 X:100608065-100608087 CAGGTCAAAAGGCTAAGGGTGGG + Intergenic
1195737063 X:108022938-108022960 CATGGCAGAAGGTGAAGTGGGGG - Intergenic
1197193954 X:123679573-123679595 CAGGCCAGAAATAGAAGTGTGGG - Intronic
1199758974 X:150890808-150890830 CAGGACTGGAGGAGAAGGGTGGG + Intronic
1199847255 X:151700406-151700428 CAAGTCAGATGGGGAAGGGTAGG + Intronic
1200184864 X:154175621-154175643 CCCTTCAGGAGGAGAAGTGTAGG - Intergenic
1200190517 X:154212759-154212781 CCCTTCAGGAGGAGAAGTGTAGG - Intergenic
1200196268 X:154250561-154250583 CCCTTCAGGAGGAGAAGTGTAGG - Intergenic
1200201923 X:154287679-154287701 CCCTTCAGGAGGAGAAGTGTAGG - Exonic