ID: 958905208

View in Genome Browser
Species Human (GRCh38)
Location 3:99934473-99934495
Sequence TGTTCCACACAGGACTATGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 98}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958905208 Original CRISPR TGTTCCACACAGGACTATGT GGG (reversed) Intronic
902005553 1:13229188-13229210 TCTTCCACTCAGGACTAGGAAGG + Intergenic
902024873 1:13375465-13375487 TCTTCCACTCAGGACTAGGAAGG + Intergenic
906120158 1:43384304-43384326 TCTGCCAGGCAGGACTATGTGGG - Exonic
909927492 1:81455384-81455406 AGTGCCACACAGCACAATGTTGG - Intronic
912019253 1:105085244-105085266 TGTTTCTCATAGAACTATGTTGG + Intergenic
918879378 1:190096299-190096321 TGTTCCAGAGAAGTCTATGTTGG + Intergenic
920490855 1:206413843-206413865 TGGTACACACAGGACCATCTGGG + Intronic
920534724 1:206730077-206730099 TGTTATACACCGTACTATGTGGG + Exonic
1062869881 10:891533-891555 TCTTCCTCAAAGTACTATGTGGG + Intronic
1068790364 10:61023744-61023766 TTTGCCACACAGGAATCTGTAGG + Intergenic
1069870367 10:71529286-71529308 TGTTCAACACAGGACTCAGCTGG + Intronic
1070822677 10:79370770-79370792 TATTACAAACAGGACAATGTAGG + Intergenic
1071434791 10:85637773-85637795 TGTTCCTAACATGACTATCTTGG + Intronic
1074312437 10:112333757-112333779 TCTTCCCCACAGGAGTCTGTTGG + Intergenic
1075498436 10:122949560-122949582 TGTTCCAGACAGGACTGAGCAGG + Intronic
1076216995 10:128702919-128702941 TGTTCCACAGACGACTATCTTGG + Intergenic
1078393709 11:10958660-10958682 TGTTACACACAGGAACATGTAGG - Intergenic
1079247466 11:18763232-18763254 TGTTCCAGACAGGAGTTTGGAGG - Intronic
1080775667 11:35384059-35384081 TGTTCCAGCCAGGACTTTTTTGG + Intronic
1082735496 11:56851166-56851188 GGTTCCACACAGGAAGATGAGGG - Intergenic
1082762147 11:57137390-57137412 TGTTCCAAACTGGATAATGTAGG - Intergenic
1085743993 11:79099309-79099331 TGTTCCACAGAAGACTATATGGG - Intronic
1088842771 11:113640569-113640591 TGCTCCACACAGCCCTCTGTGGG - Intergenic
1095950204 12:47777563-47777585 TGTTCCTCACTGGACTGTCTGGG + Intronic
1098041981 12:66361828-66361850 CGTTCCTCTCAGGACCATGTGGG + Intronic
1101979049 12:109389465-109389487 GGTTCCCCAAAGGACTCTGTTGG + Intronic
1105316237 13:19266885-19266907 GGTTCCACACAGGACACTGCAGG + Intergenic
1111715497 13:91874505-91874527 TGTTCATCACAGCACTATTTTGG - Intronic
1114158211 14:20131589-20131611 TATTCCACACTGGACCATGAGGG - Intergenic
1117659120 14:57985936-57985958 TTTTCCACACAGAACTTTGTGGG + Intergenic
1125102226 15:35927450-35927472 TGTTCCACACAGGGGGATTTTGG - Intergenic
1130094557 15:80846239-80846261 TGTCCCACACGGGCCTATGTGGG - Intronic
1131429092 15:92372034-92372056 GCTTCAACACAGGAATATGTGGG + Intergenic
1135148790 16:19987258-19987280 TGTTCGAAACAGTGCTATGTGGG + Intergenic
1138651179 16:58462715-58462737 TTTTCCATGCAGGACTCTGTTGG - Intergenic
1140952883 16:79836093-79836115 TGTTTAACACAGGACTACTTCGG - Intergenic
1142008580 16:87702116-87702138 TGTTCCACACACGATCATGCGGG - Intronic
1142125510 16:88408450-88408472 TGTTCCAGAAAGTACTAAGTGGG - Intergenic
1146301452 17:31692900-31692922 TATTACACACAGGACTTTGGGGG + Intergenic
1146837882 17:36126773-36126795 TGTTCCACACAAGCCTGAGTAGG - Intergenic
1148188434 17:45661512-45661534 TGTTTCACACAGGACTGTCACGG - Intergenic
1153003825 18:480169-480191 TGTGGCACAAAGGACTTTGTAGG - Intronic
1156309314 18:35907982-35908004 GGTTCCCCTCAGGACCATGTTGG - Intergenic
1157152094 18:45228462-45228484 TCTTCCAGACTGGACTCTGTAGG + Intronic
1164837339 19:31365422-31365444 TGTTCCACCCAGGACAATCCAGG - Intergenic
925342847 2:3148889-3148911 GGTTTCACACATGGCTATGTCGG - Intergenic
927511271 2:23645284-23645306 TGTTCCTGACAGGACCAGGTGGG + Intronic
931726415 2:65115830-65115852 TGTTCTAAACAGAACTATATTGG - Intronic
933412268 2:81941007-81941029 GGTTCCAGACAGCACTCTGTGGG - Intergenic
937154158 2:119706845-119706867 TGTTTCACACAGAAAGATGTGGG + Intergenic
944176151 2:196831127-196831149 TTTTCCCCAAAGGACTATCTGGG + Intergenic
944946829 2:204697658-204697680 TGTATCACAACGGACTATGTAGG - Intronic
946890613 2:224272284-224272306 TTTTCCACACATGCCTATTTAGG - Intergenic
1172978498 20:38923955-38923977 TGTCCCACACAGAACTTTGTTGG + Intergenic
1177689953 21:24493152-24493174 TTTTCCAAACAGGAGGATGTTGG + Intergenic
1179457492 21:41508926-41508948 TGTGCCAAAGAGGACTATGTTGG - Intronic
950137398 3:10591271-10591293 TGTTCCACAACGCACTCTGTGGG + Intronic
951905967 3:27707888-27707910 TCTTCCTCACAGGAGTATTTTGG + Intergenic
952975997 3:38696954-38696976 TGCTCCACAGAGGACTACCTTGG + Exonic
954979442 3:54731026-54731048 TCTACCACACAGAACTAGGTTGG + Intronic
955634129 3:61007719-61007741 TGTTCCACTCAGATCTCTGTAGG + Intronic
957488041 3:80888410-80888432 TGTTCAACACAGAATTATTTAGG - Intergenic
957881536 3:86220121-86220143 TCTTTCACACAGGACTGTGGGGG + Intergenic
958088621 3:88846997-88847019 TCTTCCACACAGGATGATGTGGG + Intergenic
958905208 3:99934473-99934495 TGTTCCACACAGGACTATGTGGG - Intronic
970790680 4:19854439-19854461 TGTTCCAGTGAGGACTCTGTAGG + Intergenic
971864786 4:32155504-32155526 TCTTCAACACAGAACTATCTTGG + Intergenic
975351085 4:73347561-73347583 TGTTCCTCTCTGGAGTATGTGGG - Intergenic
975440430 4:74404264-74404286 TGTTCTCCCCAGGACTCTGTGGG + Intergenic
980722413 4:136716194-136716216 TGTTCCACACAGGAAAAGGAGGG - Intergenic
981783019 4:148446157-148446179 TGTTTAACACGGGTCTATGTGGG - Intergenic
983170816 4:164534554-164534576 TCTTCCACAGAGCACTGTGTAGG + Intergenic
983888630 4:173008165-173008187 TGTTCCGCACAGAACCATGCAGG + Intronic
987158121 5:15111683-15111705 TGTTACAATCAGGACAATGTGGG - Intergenic
990661005 5:58015010-58015032 TCATCCACACAGGAATAAGTGGG - Intergenic
993039251 5:82793838-82793860 AATTCCACCCAGGGCTATGTAGG - Intergenic
993877977 5:93330227-93330249 CGTTCCACAATGGACCATGTTGG + Intergenic
1000643625 5:163735226-163735248 GGTTCCACACAGGAAGAGGTGGG + Intergenic
1007331069 6:41109259-41109281 TGTTCATCACAGTATTATGTTGG - Intergenic
1009908360 6:69895594-69895616 TGTTCCACACAGGAAGAGGAAGG + Intronic
1016517614 6:144912896-144912918 TGTTTAACACAGCACAATGTTGG + Intergenic
1017208425 6:151828619-151828641 TGTTCCAGAGAGCAATATGTAGG + Intronic
1017941457 6:159056841-159056863 TGTCCCACTCAGGACTCTCTGGG - Intergenic
1018684103 6:166289961-166289983 TGGTCCACAGATGACTATGGTGG + Intergenic
1023164248 7:37327473-37327495 ATTTCCACACAGGACTATGAAGG + Intronic
1031477949 7:122245497-122245519 TGTTCATCACAGAATTATGTAGG - Intergenic
1032705956 7:134421597-134421619 GGATACACACAGGACTATCTGGG + Intergenic
1037762980 8:21754391-21754413 TGATCAACACAGGACCATGTGGG + Intronic
1040533421 8:48284439-48284461 TGTACCACACTGTACTATGCTGG - Intergenic
1043464320 8:80489419-80489441 TTTTCCAAATAGGGCTATGTTGG + Intronic
1044567203 8:93677383-93677405 AGTTTCACATAGCACTATGTTGG + Intergenic
1047417781 8:124679593-124679615 TGTTCCACAGAGGACTGGGCTGG - Intronic
1048688888 8:136936119-136936141 TGTTCCATGTAGGACTATGCAGG + Intergenic
1049134309 8:140881109-140881131 AGTTCCACATAGGAGTCTGTAGG - Intronic
1050376723 9:4982052-4982074 TGCACTACACAGGACTGTGTGGG - Intergenic
1050530738 9:6586846-6586868 TGTTCCTTACAGCACAATGTCGG - Intronic
1051806993 9:21005711-21005733 TATTGCCCCCAGGACTATGTTGG - Exonic
1052832718 9:33229028-33229050 TGGTCCACACTCGACTATTTTGG + Intronic
1056652254 9:88476136-88476158 TGTTCCACACAGTGTAATGTAGG + Exonic
1056812032 9:89772384-89772406 TGTTCCCCCCAGAACTATCTGGG - Intergenic
1057186052 9:93058247-93058269 GGGTCCACACAGGACTCTGGGGG + Intergenic
1060299263 9:122365010-122365032 TGTTCCAAACAGGAAAAGGTTGG - Intergenic
1187439549 X:19305786-19305808 TGTTCAACTCAGAACTATTTTGG + Intergenic
1188042120 X:25380543-25380565 AGGTCCACACAGGACTCTATGGG + Intergenic
1190550472 X:51574708-51574730 TGATCCACACAGAAATATGTTGG - Intergenic
1191129311 X:56991361-56991383 CGTTCCACACAGCAAGATGTGGG - Intronic
1193228683 X:79016335-79016357 TTTTCCACTCAGTATTATGTTGG - Intergenic
1194469721 X:94278158-94278180 AGTACCTCACAGGACTATGGAGG + Intergenic
1195565873 X:106338796-106338818 TGCTCCACAAAGGGCTATGAAGG + Intergenic
1198501725 X:137256296-137256318 TGCTGAACACAGGACTCTGTGGG - Intergenic