ID: 958907926

View in Genome Browser
Species Human (GRCh38)
Location 3:99962144-99962166
Sequence CTGGAAAGGCTGAAGGTGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 536
Summary {0: 1, 1: 0, 2: 6, 3: 58, 4: 471}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958907921_958907926 -5 Left 958907921 3:99962126-99962148 CCAGGAAGGACTGGCTTGCTGGA 0: 1
1: 0
2: 1
3: 24
4: 217
Right 958907926 3:99962144-99962166 CTGGAAAGGCTGAAGGTGAGGGG 0: 1
1: 0
2: 6
3: 58
4: 471

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958907926 Original CRISPR CTGGAAAGGCTGAAGGTGAG GGG Intronic
900140037 1:1135971-1135993 TGGGCAAGGCTGAGGGTGAGGGG + Intergenic
900951559 1:5860899-5860921 TTGGAAAGACTGAAGGAGTGAGG - Intergenic
901217470 1:7562848-7562870 GTTGACAGGCTGCAGGTGAGTGG - Intronic
901920886 1:12536792-12536814 CTGGAAAGGGTGAGGTTGTGGGG - Intergenic
902645283 1:17793593-17793615 CTGGAAAAGCTGTAGGGGAAGGG - Intronic
902837819 1:19058184-19058206 CTGGAAAGGGGGAGGGGGAGGGG + Intergenic
903157739 1:21459668-21459690 CTGGGAACGCTGAAGATGGGAGG + Intronic
903232712 1:21931595-21931617 CTGGATTGGGTGAAGGGGAGGGG + Intronic
903687486 1:25142537-25142559 CTGGAAAGGCTGGAGGAGGAAGG + Intergenic
904102703 1:28046305-28046327 CAGGAAAAGATGAAGGTGATGGG + Intronic
904603239 1:31684813-31684835 CTGAAGGGGCAGAAGGTGAGAGG - Exonic
905490609 1:38340646-38340668 CTTGTAAGGCTGGAGTTGAGTGG + Intergenic
906154240 1:43604824-43604846 CTGGAAGGGTGGAAGGTGAATGG - Intronic
906510479 1:46407881-46407903 TTGGAAAGGCTGAGGGTTTGTGG + Intronic
906564779 1:46791153-46791175 CTGGATATGGTGAAAGTGAGGGG - Intronic
907039080 1:51241792-51241814 CAGGAAAGGCTGAAGAAGGGAGG + Intronic
907077716 1:51593471-51593493 CAGGAAAGTGTGAAGGGGAGGGG - Intronic
907101310 1:51839267-51839289 CTTGACAGGCTGAAGATGGGAGG - Intronic
907617013 1:55935951-55935973 AAGGAATGGCTGAAGGAGAGAGG + Intergenic
908259777 1:62331084-62331106 CTTGGAAGGCTGAGGTTGAGAGG - Intergenic
908457251 1:64315783-64315805 CAGGACAAGCTGAAGTTGAGGGG + Intergenic
910026413 1:82660214-82660236 CTGGAAAGGAGAAAGGTCAGAGG - Intergenic
910130639 1:83901170-83901192 CTTAAAAGGCAGAAGTTGAGAGG - Intronic
910792941 1:91069876-91069898 CTTGAAAGGCTGAAGGTGGGAGG - Intergenic
911769850 1:101726422-101726444 CTGAAAAGGTTAGAGGTGAGTGG - Intergenic
912472588 1:109915794-109915816 CTGGAAAGGGTGAGAGTGTGAGG + Intronic
913544483 1:119853720-119853742 CTGGGAACGCTGAAGGTGGGAGG - Intergenic
913602316 1:120433658-120433680 CTGGGAACGCTGAAGGTGGGAGG + Intergenic
913991862 1:143620499-143620521 TTGGGAACGCTGAAGGTGGGAGG - Intergenic
914084730 1:144442979-144443001 CTGGGAACGCTGAAGGTGGGAGG - Intronic
914190742 1:145408145-145408167 CTGGGAACGCTGAAGGTGGGAGG - Intergenic
914363490 1:146957264-146957286 CTGGGAACGCTGAAGGTGGGAGG + Intronic
914488187 1:148129870-148129892 CTGGGAACGCTGAAGGTGGGAGG - Intronic
914588551 1:149084990-149085012 CTGGGAACGCTGAAGGTGGGAGG - Intronic
914684070 1:149962550-149962572 ATGGAAAGGCTGACTTTGAGAGG + Intronic
915507153 1:156365143-156365165 CTTGGGAGGCTGAAAGTGAGAGG + Intronic
915861290 1:159447388-159447410 ATGGAAAGGGTAAAGGTGACTGG - Intergenic
916059976 1:161091704-161091726 ATGGATAGGCTGAAGGAGATTGG - Intergenic
916247486 1:162703816-162703838 CTGGAAAGGCTGGGGTTGGGTGG - Intronic
916317758 1:163469406-163469428 ATGGGAAGGCTGAAGCTTAGAGG + Intergenic
916426961 1:164689855-164689877 CTGAAAAAGCTCAAGGGGAGGGG - Intronic
916764012 1:167842925-167842947 CTGGAATTACTGAAGGTGTGTGG + Intronic
917124071 1:171670521-171670543 CTGGGAACGCCGAAGGTGGGAGG + Intergenic
917481945 1:175419826-175419848 CTGCAAAGGCTGAGGGAGAAAGG - Intronic
917783073 1:178420484-178420506 AAGGAAAGGCAGAAGGTGATGGG - Intronic
917877025 1:179295174-179295196 CTGGAAAGCCAGAAGGAAAGTGG - Intronic
917932345 1:179831516-179831538 CTGCAAAGGCTCAAGGGAAGGGG + Intergenic
919788380 1:201274697-201274719 CTGGAAAGAGTGGAGGGGAGCGG + Intergenic
920214381 1:204351454-204351476 CAGGAAGGGCGGAGGGTGAGAGG - Intronic
920307951 1:205031054-205031076 CAGGAAAGGGGGAAGGAGAGAGG + Intergenic
920788153 1:209062561-209062583 CTGGAAAGGCTTTGGGGGAGGGG - Intergenic
920982984 1:210855691-210855713 ATAGAAAGGCAGCAGGTGAGTGG - Intronic
921364388 1:214359978-214360000 ATGGACATGGTGAAGGTGAGGGG - Intronic
922722703 1:227906699-227906721 CAGGAAAGGAGGAAGGAGAGTGG - Intergenic
922722723 1:227906776-227906798 CAGGAAAGGAGGAAGGAGAGTGG - Intergenic
923311397 1:232739027-232739049 TTTGGGAGGCTGAAGGTGAGAGG - Intergenic
923401112 1:233615664-233615686 CTGTAAAGGTTGAGGGTGGGGGG - Intronic
924289784 1:242524908-242524930 CTGGAAAGCCGGCAGGCGAGGGG + Intergenic
924499128 1:244619716-244619738 CTGGAAAGTTTGAAGGTAAGAGG + Intronic
1063101021 10:2950381-2950403 CTGGAAAGGCTCCAGGTGCACGG - Intergenic
1063204114 10:3814405-3814427 CTGGCAGGGCTGGAGGGGAGGGG - Intergenic
1063657178 10:8003021-8003043 ATAGAAGGGCTGAAAGTGAGAGG - Intronic
1063789711 10:9428929-9428951 CTGGGAAGGGTGATGGTAAGGGG - Intergenic
1063849428 10:10168173-10168195 GATGAAAGGCTGAAGATGAGGGG - Intergenic
1065036565 10:21645002-21645024 CAGGAAAAACTGAAGGCGAGAGG - Intronic
1065045320 10:21742853-21742875 ATGGGAAGGCTGCAGGTGACGGG - Exonic
1069770948 10:70899567-70899589 CTGGACAGGCTGCAGATGACAGG + Intergenic
1070305572 10:75237145-75237167 CTGGCAAGGCTGAAGTGCAGTGG + Intergenic
1070601792 10:77871279-77871301 ATGAAAAGCCTGAGGGTGAGGGG + Intronic
1070789587 10:79181326-79181348 CTGAGGAGGCTGGAGGTGAGCGG + Intronic
1072548810 10:96461378-96461400 ATGGAAAGGCAGGAGGGGAGTGG + Intronic
1073043471 10:100622603-100622625 CTGGAAAGACTCAAGGAGGGAGG - Intergenic
1073073537 10:100809443-100809465 CTGGAAAGGCTGATGCTAGGAGG + Intronic
1073250821 10:102119578-102119600 CAGGAAAAGTTGAAGGTGGGGGG + Intronic
1073606572 10:104901593-104901615 CTGGAGAGACTGTAGGTGAGGGG - Intronic
1073842476 10:107513804-107513826 GTGACAAGGCTGATGGTGAGTGG - Intergenic
1074379220 10:112965037-112965059 ATGGGAAGGCTTAAGGGGAGAGG + Intronic
1075573358 10:123560822-123560844 CTGGAATGCCTGAAGATGTGAGG - Intergenic
1076500251 10:130931035-130931057 CTGGAAAGCCTCAGGGAGAGTGG + Intergenic
1076920993 10:133454593-133454615 CAGGAGAGGCTGGAGGTGAGAGG + Intergenic
1077035121 11:490709-490731 CTGGCGAGGCTGAAGGCGAGGGG + Exonic
1077530533 11:3092759-3092781 GGGGACAGGCTGAAGGTGAGAGG + Intronic
1078268962 11:9776952-9776974 CTGGAAAGGCAGAAGCTTACAGG + Intergenic
1078555516 11:12322301-12322323 CTGGAAAGGCTCTAGGGAAGAGG - Intronic
1078816130 11:14823870-14823892 CTTGATAGCCTGGAGGTGAGGGG - Intronic
1080651980 11:34230090-34230112 CTGGGAAGCCTGTAGGTGGGAGG + Intronic
1080795500 11:35559377-35559399 TTGGAAGGGCTGAAGGAGCGGGG - Intergenic
1081061042 11:38477917-38477939 CTGAAACAGCTGGAGGTGAGTGG + Intergenic
1081699816 11:45146115-45146137 CCGCGAAGGCTGAGGGTGAGGGG - Intronic
1082109305 11:48256613-48256635 CTGGACAGGATGAATTTGAGGGG + Intergenic
1084072302 11:66744534-66744556 CGGCCAAGGCTGGAGGTGAGCGG - Intronic
1084188779 11:67489441-67489463 ATGGAGATGCTGAAGGTGAGGGG + Exonic
1084697196 11:70762753-70762775 CTGGAGAGGCAAGAGGTGAGGGG + Intronic
1084765043 11:71302745-71302767 CTGGAAAGGCTGAAGTGGGAGGG - Intergenic
1084765566 11:71305959-71305981 CTGGAAGGGCTGTGGGTGGGGGG + Intergenic
1084791670 11:71478780-71478802 CAGGAAGGCCTCAAGGTGAGGGG + Intronic
1084921869 11:72477466-72477488 CTGAAGAGGCTGAAGGAGGGCGG + Intergenic
1085126807 11:74007537-74007559 CTCGGGAGGCTGAAGGTGGGAGG - Intronic
1085260069 11:75199563-75199585 CTGCCAGGGCTGGAGGTGAGAGG + Intronic
1085503792 11:77044037-77044059 CTGGACAGGCGGGAGGTGATTGG + Intergenic
1085699017 11:78729743-78729765 AGGGAAAGGCAGAAGGAGAGAGG + Intronic
1086166799 11:83788801-83788823 CTGGAAATGGAGATGGTGAGGGG - Intronic
1086490850 11:87356539-87356561 CGGGGCAGGCTGAAGTTGAGGGG + Intergenic
1086903221 11:92390783-92390805 CTGGGAGGACTGAGGGTGAGAGG + Intronic
1087016540 11:93559751-93559773 AGGAAAAGACTGAAGGTGAGTGG + Intergenic
1087339336 11:96882649-96882671 CTGGCAAGGCTGCAGGGGAAAGG - Intergenic
1087618816 11:100519341-100519363 CTGTCATGGCAGAAGGTGAGGGG + Intergenic
1087751169 11:102009019-102009041 CTGGAAAGGCAGACTTTGAGGGG - Intergenic
1089266302 11:117264726-117264748 ATAGAAAGGCTGAAGGGGAAAGG - Intronic
1089299634 11:117490824-117490846 CTGGGGAGAGTGAAGGTGAGTGG + Intronic
1089737002 11:120556514-120556536 CTGGAGTGGCAGGAGGTGAGTGG - Intronic
1090532899 11:127609614-127609636 CAGGAAAGGGCGTAGGTGAGAGG + Intergenic
1090844480 11:130519358-130519380 CAGAGAAGGCTGAAGGGGAGGGG + Intergenic
1091773227 12:3167573-3167595 CTGGAAGGGATGATGGTGATGGG + Intronic
1092961236 12:13598461-13598483 CTGAGAAGACTGAAGGTGACAGG - Intronic
1093091763 12:14929312-14929334 CTGGAGAGACTGCAGGAGAGTGG - Intronic
1093113668 12:15182970-15182992 CCTGAAAGGCTAAAAGTGAGAGG + Intronic
1093768959 12:22997961-22997983 CGGGAAAGGGTGAAGCAGAGAGG - Intergenic
1095381931 12:41605283-41605305 CTTGAAAGGATGAAGGAGAAAGG + Intergenic
1095468055 12:42508713-42508735 GTGGAAAGGAAGAAGGGGAGAGG + Intronic
1095705131 12:45228785-45228807 CTGGCAAGGTGGAACGTGAGTGG - Intronic
1096518074 12:52169100-52169122 CAGTAAAGGCGGAAGGTGAAGGG + Exonic
1096975711 12:55698347-55698369 CTGGAAAGGCTCAGGGAGGGAGG - Intronic
1097130384 12:56806902-56806924 CTGGAAAGGCTAAGAGGGAGGGG - Intergenic
1097405385 12:59183105-59183127 TTTGAGAGGCTGAAAGTGAGGGG + Intergenic
1098850248 12:75587647-75587669 CAGGAAAAGCTGAAGGTTAATGG + Intergenic
1100275072 12:93064293-93064315 CTGGTGAGGCTGAAGCCGAGTGG - Intergenic
1100504533 12:95206580-95206602 CTTGGGAGGCTGAAGGTGGGTGG + Intronic
1100540663 12:95554301-95554323 CTGGAAAGGCAGAGGGAGAGAGG + Intergenic
1101038885 12:100733903-100733925 CTGGAAAAGCTGGAGGTCAAGGG + Intronic
1101347758 12:103902067-103902089 CCAGAAAGCCTGCAGGTGAGCGG - Intergenic
1101467647 12:104964029-104964051 CTGGAAAGTCTGAGATTGAGGGG - Intergenic
1102197763 12:111036538-111036560 CTGGAAAGGATAAAGGTAGGGGG + Intronic
1102607016 12:114075670-114075692 CTTAAAAGGCTGAAGGTGCAGGG - Intergenic
1102731970 12:115119405-115119427 CTGGGAAGGATGAAAGAGAGTGG + Intergenic
1104121682 12:125805937-125805959 CTGCATTGGCAGAAGGTGAGGGG + Intergenic
1104169528 12:126266678-126266700 CTGGAAAGGGTGAGTGGGAGGGG + Intergenic
1104410153 12:128551068-128551090 CTGGAAAGGGAGAAGGGGAGAGG - Intronic
1104516422 12:129431322-129431344 CTGGAAAATCTGAAGCAGAGAGG - Intronic
1104648476 12:130514004-130514026 CTGGGGAGGCTGAAGGTGTGGGG - Intronic
1105486105 13:20834462-20834484 CTCAAGAGGCTGAAGTTGAGAGG + Intronic
1105631306 13:22171704-22171726 CTGGGAAGGGTAAAGGGGAGGGG - Intergenic
1105859306 13:24395132-24395154 GTGGAAAGGCTGACGGTGGCAGG - Intergenic
1105916198 13:24919014-24919036 CTGGAAAGAAGGAGGGTGAGGGG + Intronic
1106005833 13:25769525-25769547 ATGCAGAAGCTGAAGGTGAGAGG - Intronic
1106311285 13:28556768-28556790 CTGGGAAGGCTGCAGGGAAGAGG + Intergenic
1106366500 13:29085917-29085939 TTGGCAAGGCTGAAGATGAAAGG - Intronic
1106466681 13:30019965-30019987 CTGGAAAGGCTGGGGGTGCTGGG - Intergenic
1107880681 13:44829571-44829593 CTGTAAAGGCAGAAGGGCAGGGG - Intergenic
1108000831 13:45904465-45904487 CTGGACAGGTTGGAGCTGAGTGG + Intergenic
1108082468 13:46750913-46750935 GTGGAAAGGATGAAGGAGGGTGG - Intronic
1108363342 13:49687393-49687415 TTGGAAAGGATGGAGTTGAGGGG - Intronic
1108713394 13:53056114-53056136 CTGGAAAGGCTGAAGGTGCAGGG + Intergenic
1112288412 13:98124213-98124235 CTGGAAATGGTGGAGGTGACGGG - Intergenic
1112370982 13:98793071-98793093 CTGGAAAGCCAGTAAGTGAGGGG + Intergenic
1112400437 13:99072888-99072910 CTTGCAAGGCTGAAGATGGGAGG + Intronic
1112580976 13:100675628-100675650 CTGGAAAAACAGAAGGTGGGGGG - Intergenic
1112956069 13:105059697-105059719 CTGGAAAGGGAGAAAGGGAGTGG - Intergenic
1113432447 13:110262318-110262340 CTGGGAAGGCTGATGGTGGAGGG - Intronic
1113757401 13:112822804-112822826 CTGGAAAGGCTAAAGAGGGGTGG - Intronic
1116862702 14:50007387-50007409 CTGGACAGCCTGCAGTTGAGGGG - Exonic
1117588811 14:57243090-57243112 CTCTAAAGGCGGAAGTTGAGAGG + Intronic
1117646631 14:57860070-57860092 CAGGGAAGGCAGAAAGTGAGAGG + Intronic
1117969815 14:61240646-61240668 CTGGAAAGGGTGAAGGTTCTCGG - Intronic
1119512875 14:75225506-75225528 CTCAGAAGGCTGAGGGTGAGAGG + Intergenic
1121145891 14:91582048-91582070 ATGGAAAGAATGAATGTGAGGGG - Intronic
1121304716 14:92898888-92898910 CTGGGAAGGCTGGAGGTGGGTGG - Intergenic
1121316457 14:92963888-92963910 CAGGAAAGGCTGAGTGTGAGCGG + Intronic
1121397294 14:93637325-93637347 CTGTAAAAGCTGAAGGAGACTGG + Intronic
1121699222 14:95939564-95939586 CTGGATACGCTGGAAGTGAGTGG - Intergenic
1122244951 14:100395835-100395857 CTGCACAGACTGGAGGTGAGGGG - Intronic
1122375456 14:101254070-101254092 CTGAGAAGGCTGAATGTGATAGG - Intergenic
1122822473 14:104354469-104354491 CTGGAAGGGCTGAGGGCCAGCGG - Intergenic
1122874507 14:104657459-104657481 CTGGCCAGGCTCAAGGGGAGGGG - Intergenic
1123836808 15:24203188-24203210 CTGAAAAGGCTGAGGTTGAGAGG + Intergenic
1124633403 15:31350088-31350110 CTGGAATGGCCGAGGGTTAGGGG - Intronic
1125460349 15:39900723-39900745 CTGAAATGGCTGAAGGGGAGAGG + Intronic
1125502501 15:40248330-40248352 CTGGACAGCCTGGAGGAGAGGGG + Intronic
1125882642 15:43207677-43207699 CTGGACAGGCAGAAGCTCAGAGG + Intronic
1125920213 15:43520949-43520971 CTGGAATGGAAGAAGGGGAGTGG - Intronic
1127585702 15:60376050-60376072 CTGTAAAGGCTGAAGCAGGGAGG + Intronic
1127627629 15:60795769-60795791 CTGGTAGGGATGGAGGTGAGGGG - Intronic
1127903447 15:63358553-63358575 CTGGGAAGGCGGATGGGGAGAGG - Intronic
1128812547 15:70583252-70583274 CTGGAAAGGCAGGAGCTGAGAGG + Intergenic
1129117588 15:73373793-73373815 CTGGAAGGGTGGAAGGGGAGGGG + Intergenic
1131467458 15:92667297-92667319 CCAGAAAAGCTGAGGGTGAGAGG + Intronic
1132956295 16:2595836-2595858 GTGGATAAGCGGAAGGTGAGTGG + Exonic
1133176855 16:4021900-4021922 CTGATAGGGCTGAGGGTGAGTGG - Intronic
1133911545 16:10070643-10070665 CTGGAAAATCTGATGATGAGAGG - Intronic
1134618098 16:15667425-15667447 CTGGAAACCATCAAGGTGAGGGG + Exonic
1135698469 16:24610773-24610795 GTGGAAAGGGGGAAGGTGAGAGG - Intergenic
1135909323 16:26544821-26544843 ATGGAAAGGAAGACGGTGAGAGG + Intergenic
1136103124 16:28010047-28010069 CAGGAAAGGCTTCAGGGGAGAGG + Intronic
1136403209 16:30029538-30029560 CTAGAAAGGCAGAAGGGAAGAGG + Intronic
1136484452 16:30562279-30562301 CAGCAAAGGCTGCAGGGGAGGGG + Intergenic
1137018508 16:35399113-35399135 CTGGAAGGTATGAATGTGAGAGG + Intergenic
1137056479 16:35748738-35748760 CTGGAAAGGGCAAAGGTGGGCGG - Intergenic
1137846606 16:51695962-51695984 CTGGAGAGGCTGAAGTGGAAGGG + Intergenic
1137856118 16:51796341-51796363 CTGGAAAGGATGGAGGAGAGGGG - Intergenic
1137930025 16:52578239-52578261 TTGGAAAAGCTGAAAGAGAGGGG - Intergenic
1138262405 16:55634527-55634549 CTTGATGGTCTGAAGGTGAGAGG - Intergenic
1138604956 16:58082661-58082683 CTGTAATTGCTGAAGATGAGGGG - Intergenic
1139282820 16:65784804-65784826 CTGTAAAGGCAGAAGCAGAGTGG + Intergenic
1139532147 16:67547641-67547663 CTGGAAGTGCTGAGGGAGAGGGG - Intergenic
1141043230 16:80690349-80690371 GTGGAAAGGCTGAGGAGGAGGGG - Intronic
1141196064 16:81862198-81862220 GAGGAAAGACTGAAGGCGAGAGG + Intronic
1141819015 16:86432323-86432345 CTGGGAAGGGTGAGGGTCAGAGG + Intergenic
1142218971 16:88843668-88843690 CTGGAGAGCCTGAGGGGGAGGGG + Intronic
1142234309 16:88914747-88914769 CTGGAAAGGCTGGGGGAGAGTGG + Intronic
1143090733 17:4447946-4447968 CTGGAAAGGCTGCAGTGGTGAGG + Intronic
1143173950 17:4945906-4945928 CTGGGAACGCCGAAGGTGGGAGG + Exonic
1143286520 17:5793948-5793970 AAGGCAAGTCTGAAGGTGAGAGG - Intronic
1143772312 17:9176508-9176530 CTGGAAAGGGAGAATGTGACTGG - Intronic
1145261183 17:21355711-21355733 CTGGAAAGCGGGATGGTGAGAGG + Intergenic
1146085227 17:29822162-29822184 CTGGAGATGCTGAAGGGGATGGG - Intronic
1146322520 17:31858263-31858285 CAGGAAAGGATCAAGGTGAGAGG - Intronic
1146694416 17:34897895-34897917 CTGGAAAGGCTCAAGCCCAGTGG - Intergenic
1148002047 17:44394600-44394622 CTTGAAAGGCTGAGGTTGAGAGG + Intergenic
1148546430 17:48522566-48522588 CTGGAGAGGATGAAGGAAAGGGG + Intergenic
1148806651 17:50267196-50267218 CAGGGAAGGCTGATGGGGAGGGG + Intergenic
1150682147 17:67292844-67292866 CTGGGAAGGCTGAGGCTGAGGGG + Intergenic
1151160781 17:72163702-72163724 CAGGATAAGCTGAAGGTGGGTGG - Intergenic
1151226217 17:72650212-72650234 CTGCAGAGGCAGGAGGTGAGAGG - Intronic
1151714325 17:75823703-75823725 GTGAAAAGGCTGGGGGTGAGGGG + Intronic
1152231040 17:79114350-79114372 CTGGAAAGGCTGATGGTCTCGGG + Intronic
1153391238 18:4562141-4562163 GTGGAAAGGTAGAAAGTGAGTGG - Intergenic
1154075069 18:11192444-11192466 CTGGAAAGGATGGGGGTGAGTGG - Intergenic
1154309374 18:13255419-13255441 GTGCAAAGGCTGTGGGTGAGCGG + Intronic
1155229296 18:23757423-23757445 CTGGAGAGGAGGAAGGGGAGGGG - Intronic
1155491252 18:26404133-26404155 CTTGGAAGGCTGAAGTTGGGGGG - Intergenic
1156060600 18:33070510-33070532 ATGGAAAGGGTGAAGGTGTAGGG + Intronic
1156395240 18:36693350-36693372 CTTGAGAGTCTGAAGATGAGGGG - Exonic
1157602109 18:48900201-48900223 CTGGAAAGGCTGAGAGGGAGAGG + Intergenic
1157898087 18:51487337-51487359 CTGGAGAAGCTGAGGCTGAGTGG - Intergenic
1158727139 18:59983838-59983860 CTTGGGAGGCTCAAGGTGAGAGG - Intergenic
1159908236 18:74118103-74118125 CTTGAGAGGCTGAGGGTGGGAGG - Intronic
1160064565 18:75562698-75562720 CTAGAAAGGCTGACAGGGAGGGG + Intergenic
1160348444 18:78153565-78153587 GTGGAAATGCTTAAAGTGAGTGG + Intergenic
1161124085 19:2546299-2546321 CTGGAGAGGCTGCAGGTGCAGGG - Intronic
1161284894 19:3463905-3463927 GTGGAGAGGCTGGAGGGGAGGGG - Intronic
1161500885 19:4614902-4614924 CTGGAGAGGCTCAAGGTAAGGGG + Intergenic
1161733222 19:5974992-5975014 CTGGAAAGGCAGAAGCCAAGAGG + Intronic
1161840175 19:6675247-6675269 CAGGTAAGGATGCAGGTGAGAGG + Intergenic
1161991629 19:7687475-7687497 CTGGACAGGCTGATGGGGAGTGG - Exonic
1162017371 19:7852911-7852933 ATGGAAAGACTGAGCGTGAGGGG - Intronic
1162246711 19:9407242-9407264 CGGGAAAGGCAGAAGGGGCGGGG + Intergenic
1162429315 19:10617832-10617854 CTAGAATGGCAGAGGGTGAGCGG - Intronic
1162749693 19:12821307-12821329 CTTGGGAGGCTGAAGGTGGGAGG - Intronic
1162973199 19:14193477-14193499 CTGGGAAGGCTGAAGGGGGAGGG + Intronic
1163050499 19:14679747-14679769 GTGGAAAGGCTGAAGCAGAAGGG - Intronic
1163270026 19:16247576-16247598 CTGGAGTGGCTGGAGGGGAGGGG - Intergenic
1163529520 19:17841603-17841625 GGGGTAAGGCTGAAGGGGAGGGG + Intronic
1165410172 19:35655067-35655089 CTGGAAAGGCTGGAGTGCAGTGG + Intronic
1165504212 19:36214614-36214636 CAGGGGAGGCAGAAGGTGAGGGG - Exonic
1166066967 19:40365843-40365865 CTGGACAGGCTGAACGAGGGTGG - Exonic
1166190690 19:41174747-41174769 CTGAAAACCCTGGAGGTGAGGGG - Intergenic
1166431391 19:42730726-42730748 CTAGAAAGAGTGAAGGTGACAGG + Intronic
1167724273 19:51200134-51200156 CTGGATGGGCTGAAAGTGAGGGG - Intergenic
1168059798 19:53884401-53884423 CTGGAAAGGGGGAATGCGAGGGG + Intronic
1168316194 19:55485766-55485788 CTGGAGATGCTGAAGGTGAGAGG + Exonic
1168519195 19:57035196-57035218 CTGCAGAGCCTGAGGGTGAGGGG - Intergenic
925699782 2:6624748-6624770 CTGGAAAGGCTGAGGCAGATGGG + Intergenic
926150383 2:10422667-10422689 CTGGGAATGCTGAGGGAGAGTGG - Intronic
926419535 2:12682901-12682923 TTGGAAAGGCTGAAGGGAAGAGG - Intergenic
927483766 2:23474634-23474656 CTGGAAAAGCTTAGGTTGAGAGG + Intronic
928232933 2:29515508-29515530 CTGGATAGGATGAAGGGTAGGGG + Intronic
928296730 2:30090200-30090222 CTGCTAAGGGTGAAGGTGAAGGG - Intergenic
929588449 2:43130520-43130542 TTGGCAAGGGTGAAGGTGAGGGG + Intergenic
929689802 2:44064731-44064753 CTAGAGAGGCTGAGGGGGAGAGG + Intergenic
930532364 2:52605783-52605805 CTGGGAAGGGTAATGGTGAGAGG - Intergenic
930660031 2:54044237-54044259 GTGGAAAGTCTGGAGCTGAGAGG - Intronic
930776968 2:55182668-55182690 CTGGAAAGTTTAAAGGTGAAAGG + Intronic
930828857 2:55721689-55721711 CTGGAAAGGCATAGGGGGAGGGG - Intergenic
931350685 2:61485478-61485500 CTCGAAAGGCTGAAGTGGGGGGG - Intronic
932451351 2:71812727-71812749 CTGGAAGAGCTGTAGGTGGGAGG + Intergenic
932722528 2:74148128-74148150 CTGGGGAGACTGAAGGAGAGCGG - Intergenic
932953650 2:76324952-76324974 CTGCAAAGGGTGAAGTGGAGTGG + Intergenic
934047337 2:88183612-88183634 ATGGAAAGGAGGAAGGAGAGAGG - Intronic
934052009 2:88219107-88219129 CAAGAATGGCTGAATGTGAGGGG + Intergenic
934589002 2:95529536-95529558 TTGGCAAATCTGAAGGTGAGAGG + Intergenic
934687695 2:96333794-96333816 CTGGAGAGGCTGCAGGGGTGGGG + Intergenic
935329381 2:101965360-101965382 CTGGAAACTCTGGAGGTGGGTGG + Intergenic
936156027 2:110048010-110048032 CAGGAACTGCTGATGGTGAGTGG + Intergenic
936188661 2:110323418-110323440 CAGGAACTGCTGATGGTGAGTGG - Intergenic
937974460 2:127573906-127573928 TTCCAAAGGCTGAAGGTAAGCGG - Exonic
938041788 2:128082244-128082266 CTGGAGAGGCTGAAGTGCAGTGG + Intergenic
938689438 2:133774053-133774075 TTGCAAAGGCTGAGGGTGTGTGG + Intergenic
939162635 2:138607954-138607976 CTGGAAGGGATGAAGGGGAGAGG + Intergenic
939467137 2:142572261-142572283 CTGGGAAGGGTGAGGGAGAGGGG - Intergenic
940242917 2:151582627-151582649 CTGGAATGGCTGAAGGGTATTGG - Exonic
940243872 2:151593179-151593201 CTGGAATGGCTGAAGGGTATTGG - Exonic
940244831 2:151603732-151603754 CTGGAATGGCTGAAGGGTATTGG - Exonic
940848723 2:158668138-158668160 CTGGAGAGGCAGAAGGCCAGTGG - Intronic
941223358 2:162813145-162813167 TTGGAAATGTTGAAGGTGAGAGG + Intronic
941852439 2:170197216-170197238 CTTGAAAGCTTGAAGGTTAGGGG - Intronic
942964246 2:181871132-181871154 AGGGAAAGTCTGAAGGCGAGGGG - Intergenic
943101067 2:183487150-183487172 CTGGGAAGGCTAAAGTTGAGGGG + Intergenic
945599069 2:211835636-211835658 TTTGAAAGAATGAAGGTGAGTGG - Intronic
945717475 2:213377702-213377724 CTGGCAAGGTTGAAGGTGCAAGG + Intronic
946475778 2:220005209-220005231 CAGGAAAGGCTGAGGCTGAGTGG + Intergenic
946587031 2:221201229-221201251 TTGAGAATGCTGAAGGTGAGTGG + Intergenic
947392820 2:229656425-229656447 CTGGAAAAGTGCAAGGTGAGGGG + Intronic
948100755 2:235370891-235370913 CTGGGAAGTCTGGAAGTGAGAGG - Intergenic
948664497 2:239526655-239526677 CTGGAGGGGCTGAGGGTGAATGG - Intergenic
1168890415 20:1292370-1292392 TTGGAAAGGTTGTAGATGAGAGG + Intronic
1168967145 20:1905579-1905601 CTGGAGAGGCTGAGGTTGGGAGG - Intronic
1169424563 20:5485853-5485875 CTGGCGGGGCTGAAGGTCAGTGG - Intergenic
1169670483 20:8094733-8094755 CTGGGTAGGTTCAAGGTGAGAGG - Intergenic
1169823092 20:9735502-9735524 CTGGAAAGGCCGAAGATCCGTGG + Intronic
1171487453 20:25494805-25494827 CTGGAAGGCCTGAAGGAGAGTGG + Intronic
1173737763 20:45373828-45373850 CTGGGAAGGATGAAGGAAAGAGG - Exonic
1174167103 20:48592789-48592811 CAGGACAGGCTGCAGGTGAGAGG + Intergenic
1175998363 20:62821320-62821342 CCGGAGAGGCTGCAGATGAGAGG - Intronic
1178503587 21:33145434-33145456 CTGGAAGGGCTGGAGGGGAGAGG + Intergenic
1179052373 21:37898653-37898675 CTAGAAAGGCTGTAGGTGGTGGG + Intronic
1179253529 21:39695350-39695372 CTGGACTGGCTGAAGGTAAAGGG + Intergenic
1181161701 22:20963595-20963617 CTGGGAAGGCTGGAGCAGAGGGG + Intergenic
1181275468 22:21685111-21685133 CTGAGAAGGCAGAAGGGGAGGGG + Intronic
1181606284 22:23981861-23981883 CAGAAAAGGCTGAAGATGAGAGG - Intronic
1181932742 22:26415763-26415785 CTAGAAATGCAGAAGGTGGGTGG - Intergenic
1181937479 22:26449188-26449210 GTGGAATGGCTGAAGCAGAGAGG - Intronic
1182123016 22:27799067-27799089 CTGGGTAGGCGGAAGGGGAGAGG + Exonic
1182306383 22:29371907-29371929 CTGTAAATGCTGAAATTGAGGGG - Intronic
1183083760 22:35474112-35474134 CTGGACAGGCTGGTGGTGAGAGG + Intergenic
1183703183 22:39461329-39461351 ATGGGAGGGCTGGAGGTGAGGGG + Intronic
1183888943 22:40909308-40909330 TTGTGAAAGCTGAAGGTGAGAGG - Intronic
1184393606 22:44219645-44219667 CTGGACAGGCGGGAGGTGACCGG + Intergenic
1184608487 22:45587697-45587719 CTGGAGTGGCTGAAGCAGAGCGG - Intronic
1184666691 22:45992985-45993007 ATGGGAAGGCAGAAGGTGTGTGG - Intergenic
1184687981 22:46104975-46104997 CTGGAATGGCTGAGGTTGCGGGG - Intronic
949843880 3:8351180-8351202 CTGGTAAGGCTTAAGGTCATAGG + Intergenic
949934479 3:9106319-9106341 TTGGAAAGGCAGGATGTGAGGGG + Intronic
950109823 3:10411910-10411932 CTGGAAATGCAGATGGTGGGTGG - Intronic
950199724 3:11034508-11034530 CTGGAGAGGGTGGAGGGGAGGGG - Intronic
951565866 3:24012070-24012092 CTGGAGAGGCTGAAGGCGGGAGG - Intergenic
951595549 3:24314733-24314755 CTGTAGAGGCTGAAGGTTTGGGG - Intronic
951863867 3:27285116-27285138 CTGGAAGAGGTGGAGGTGAGGGG + Intronic
952117306 3:30198191-30198213 TTGGCAAGGCTGAAAGTCAGAGG + Intergenic
953664267 3:44914869-44914891 CTGGAAAGGCAGAGGATGACAGG - Exonic
954992204 3:54851259-54851281 AAGGAAAGGATGAAGGGGAGGGG + Intronic
955097446 3:55813584-55813606 CTGGAAAGGTACAAGGTGACTGG + Intronic
956134867 3:66088732-66088754 TGGAAAAGCCTGAAGGTGAGAGG + Intergenic
956286384 3:67614622-67614644 CTTCACAGGCTGAAGGTGAAGGG + Intronic
956980801 3:74634976-74634998 CTGGAGAGGCTGAAACTGGGAGG - Intergenic
958049264 3:88323655-88323677 CTGTGAAGGTTGAAGGTGAATGG + Intergenic
958907926 3:99962144-99962166 CTGGAAAGGCTGAAGGTGAGGGG + Intronic
960096987 3:113698481-113698503 TTGCCAAGGCTGAAGGTCAGTGG + Intergenic
960252466 3:115471083-115471105 CTGGAAAGGGTGAATGAGAGTGG - Intergenic
960707810 3:120497381-120497403 CAGAAAAGGGGGAAGGTGAGTGG - Intergenic
961509790 3:127393808-127393830 GAGGAAAAGCTGAAGGTGATAGG + Intergenic
962035608 3:131648262-131648284 CTTGGGAGGCTGAAGGTGGGAGG + Intronic
962469565 3:135693770-135693792 TGCGAAAGGCTTAAGGTGAGGGG - Intergenic
962975362 3:140441610-140441632 GTGCAGAGGCTGAAAGTGAGGGG - Intronic
963672610 3:148270771-148270793 CTGGGAAGTCTGAAATTGAGGGG - Intergenic
964525941 3:157615412-157615434 GTGGAAAAGCTGAAAGAGAGAGG - Intronic
964994579 3:162860674-162860696 CTGGGAAGGATGATGGAGAGGGG + Intergenic
965463194 3:168994317-168994339 ATGGAAAGGGTAAAGATGAGTGG + Intergenic
965757353 3:172040106-172040128 CTGGGAAGGCTGGGGGTGGGGGG - Intronic
966135502 3:176693715-176693737 CTTGAAAGGCAGAAGAGGAGTGG - Intergenic
966750610 3:183318060-183318082 CGGGACAAGCTGCAGGTGAGCGG - Exonic
966782369 3:183594937-183594959 CTTGATGGCCTGAAGGTGAGAGG - Intergenic
967741726 3:193010441-193010463 CTGTCAAGGCTGAAGGGGACAGG + Intergenic
968280392 3:197472625-197472647 CTGGAAAGGGGGAAGAAGAGTGG - Intergenic
968549817 4:1216470-1216492 GTGGACAGGCTGCAGGGGAGTGG - Intronic
969081769 4:4624640-4624662 CTGGGAAGGCAGAAGGTGAAAGG + Intergenic
969153165 4:5187463-5187485 CTGGAAAAGCTGAAGACTAGTGG + Intronic
969160372 4:5252493-5252515 CTGGGAAGGCAGATGATGAGTGG + Intronic
969660867 4:8526663-8526685 CAGGAAAAGCTGAATGTGGGAGG + Intergenic
969864122 4:10062418-10062440 CTGGGAAGGATGATGGGGAGAGG - Intergenic
970289542 4:14556058-14556080 CAGGAAAGGCTTAAGCTGTGTGG - Intergenic
970875330 4:20862479-20862501 CAGGAAAGGCAAAAGCTGAGAGG + Intronic
971730944 4:30379124-30379146 CTACCAAGGATGAAGGTGAGAGG + Intergenic
972735898 4:41840967-41840989 CTTGAAGGGCTGGAGATGAGAGG - Intergenic
972972980 4:44600205-44600227 GTGGGAAGGATGAATGTGAGAGG - Intergenic
974689697 4:65280869-65280891 AAGGCAAGGGTGAAGGTGAGTGG + Intergenic
975353588 4:73373097-73373119 CTGGAAAGGGTGAGGGTGAGAGG + Intergenic
975758239 4:77592660-77592682 CTGGCAAGGCTGAAGGACTGAGG + Intronic
976408389 4:84684975-84684997 CTGTAAAGGATGAAAGTGAGGGG + Intronic
977006431 4:91573009-91573031 CTGGAAAACATGGAGGTGAGAGG + Intronic
977324030 4:95552382-95552404 CTTGAGAGGCTGAAGAGGAGAGG - Intergenic
977451831 4:97208647-97208669 GTTGAAAGGCTGACAGTGAGGGG + Intronic
979093209 4:116514403-116514425 CTTGATGGCCTGAAGGTGAGAGG + Intergenic
979454872 4:120915904-120915926 CTGGGTGGGCTGATGGTGAGGGG - Intronic
981044054 4:140250378-140250400 CTAAAAAGGCTGCAGGTGAACGG - Intergenic
981525773 4:145705773-145705795 CTTGATGGCCTGAAGGTGAGAGG + Intronic
981892907 4:149760071-149760093 ATGGCAAGGCTGAAGATGATGGG + Intergenic
982161953 4:152579293-152579315 CTGCACAGGCTGAAGCTCAGGGG - Intergenic
982946098 4:161625678-161625700 CTAGAAATGATGAAGGTAAGTGG + Intronic
984797048 4:183671399-183671421 CTGAAAAGGCTGGAGGAGAAAGG + Intronic
985068742 4:186147273-186147295 CTAGAGAGGCTGAAGGTGGGAGG + Intronic
985643501 5:1074453-1074475 CCTGAGCGGCTGAAGGTGAGAGG + Intronic
985913510 5:2900766-2900788 CTGGAGAGGATGAAGGTGGAGGG - Intergenic
986054412 5:4121607-4121629 CTTGTAAGGTAGAAGGTGAGAGG - Intergenic
986914049 5:12594714-12594736 CTGACAAGGCAGAAGGTGAAGGG + Intergenic
987062812 5:14258660-14258682 CTGGGGAGGTAGAAGGTGAGAGG - Intronic
987142462 5:14960120-14960142 CTGGAAAGGCCTGAGGAGAGGGG - Intergenic
987394825 5:17413203-17413225 CTGGGAAGGATAAAGGGGAGAGG - Intergenic
988564679 5:32312141-32312163 GTGGAAAGGATGATGGTGAGGGG + Intronic
989506215 5:42229961-42229983 CTTGATGGCCTGAAGGTGAGAGG + Intergenic
990020191 5:51117097-51117119 CTGGACAGGCTGGAGTTCAGTGG - Intergenic
991037911 5:62146360-62146382 CAGGTAAGGCTGATGGTGATTGG - Intergenic
992163856 5:74029130-74029152 AGGGATAGGCTGAAGATGAGAGG - Intergenic
992633102 5:78700638-78700660 GTGGGAAGGCTGATGGGGAGGGG - Intronic
992787918 5:80187395-80187417 CTGGAAAGTTTGAAGATGAGTGG - Intronic
993326353 5:86542698-86542720 GGGGACAGGCTTAAGGTGAGAGG - Intergenic
993720518 5:91317140-91317162 CTGCAAAGGTTGGAGGTAAGTGG - Intergenic
994939665 5:106305998-106306020 TTGGAAACTCTGAAAGTGAGTGG - Intergenic
996075821 5:119192458-119192480 TTTGAAAAGCTGAATGTGAGTGG - Intronic
997572282 5:134940041-134940063 ATGGGAAGGCTGAGGCTGAGAGG + Intronic
997926049 5:138032487-138032509 CTGGAGGGGCTGGAGGTGAGGGG + Intronic
999068544 5:148717497-148717519 CAGGAGAGGCAGAAGGTGAAGGG - Intergenic
999623172 5:153492212-153492234 CTGGAGAGGCTGAAAGAGATGGG - Exonic
1000142272 5:158417026-158417048 TTGGAATGGCTTATGGTGAGGGG - Intergenic
1001565211 5:172695684-172695706 CTGGGAAGGCCCAAGCTGAGAGG - Intergenic
1002868551 6:1145827-1145849 CTGGAAAGAGTTAACGTGAGGGG + Intergenic
1003298661 6:4856646-4856668 CTGGAAAGACTGAACCTGGGTGG + Intronic
1003358305 6:5396811-5396833 CTTGAAGAGGTGAAGGTGAGGGG - Intronic
1003497347 6:6675901-6675923 CTGGAAAGGCTGAGGGAGGAGGG + Intergenic
1005705773 6:28451256-28451278 CTGGGAAGGATGTAGGTGTGGGG - Intergenic
1006914462 6:37585459-37585481 CTGGGGAGGCTGAAGGCAAGGGG - Intergenic
1007473616 6:42105646-42105668 GTGGGAAGGCTGCAGATGAGCGG + Exonic
1007546527 6:42698711-42698733 CTGGAAAGGGAGGAGGAGAGGGG - Intronic
1007671688 6:43559922-43559944 CTGGGGAGGCTTAAGGTGGGAGG - Intronic
1007673685 6:43577579-43577601 CTGCAAAGCAGGAAGGTGAGTGG - Intronic
1008678266 6:53844678-53844700 AAGGAAAGGTTGAAAGTGAGCGG - Intronic
1009661640 6:66620093-66620115 CTGGGAAGGCTACTGGTGAGAGG - Intergenic
1009764291 6:68049195-68049217 TTCGAGAGGCTGAAGGTTAGAGG + Intergenic
1009898578 6:69783480-69783502 CTTGGAAGCCTGAAGGTGGGAGG - Intronic
1010496104 6:76535337-76535359 GTGGGAAGACTGAAAGTGAGGGG + Intergenic
1010524491 6:76884104-76884126 CTGGAATTAATGAAGGTGAGAGG + Intergenic
1010676731 6:78754086-78754108 CTGGAACTGCTTAAGGTGTGGGG + Intergenic
1011271961 6:85588915-85588937 CTGGGTAGGCTGAAGAGGAGGGG + Intronic
1011487555 6:87858379-87858401 CTGGTCAGCATGAAGGTGAGAGG + Intergenic
1012627238 6:101419228-101419250 CTGGAAAGGTGAAAGGTGTGAGG - Intronic
1013533537 6:111041958-111041980 TTGTAAAGGCTAAAGGAGAGGGG + Intergenic
1014398432 6:120955971-120955993 CTGGGAAGGTTGAAGGCCAGAGG + Intergenic
1014453914 6:121615085-121615107 GGGGAAGGGCTGAAGGTGTGAGG + Intergenic
1016682965 6:146851804-146851826 CTGAAAAGTCAAAAGGTGAGAGG + Intergenic
1017441697 6:154470307-154470329 CTTGGGAGGCTGAAGGTGGGAGG - Intronic
1017702676 6:157090872-157090894 CTGGAGAGGGAGAAGGGGAGGGG - Intronic
1018517991 6:164609172-164609194 CTGGCAAGGATGCAGATGAGAGG + Intergenic
1019152410 6:170017534-170017556 CTGTAAAAGCTGTTGGTGAGAGG + Intergenic
1019795993 7:3049140-3049162 CTGGAAAGAATGCAGGTAAGAGG + Intergenic
1020826000 7:13029332-13029354 CTGGAAAGGGTGGAGGGGAGAGG - Intergenic
1021512726 7:21451740-21451762 CTGGATGGCCTGAAGGTGAGAGG + Intronic
1022015204 7:26343643-26343665 CTGGAAAGGGTGAAAGTATGAGG + Intronic
1022089394 7:27097694-27097716 GAGGAAAGGCTGAAGAGGAGTGG - Intergenic
1022167548 7:27784673-27784695 ATGAAAAGTCTGAAGGTGGGGGG + Intronic
1022545123 7:31180066-31180088 CTGGAAATGCTGGTGGGGAGAGG + Intergenic
1022569676 7:31439525-31439547 CTGGAATGGCTAAAGATGACAGG - Intergenic
1024351041 7:48364557-48364579 CTGGGAAGGGTAAAGGGGAGGGG - Intronic
1025199856 7:56955474-56955496 CTGGGGAGGCAGAAGGAGAGGGG + Intergenic
1025672090 7:63621458-63621480 CTGGGGAGGCAGAAGGAGAGGGG - Intergenic
1027585977 7:80059038-80059060 ATGGAAAGGCTTAGAGTGAGGGG - Intergenic
1029125461 7:98292198-98292220 ATGGCAAGGCTAAAGGAGAGGGG + Exonic
1029630014 7:101744204-101744226 GAGGAAGGGCTGAAGGTGATGGG - Intergenic
1029662129 7:101969550-101969572 CTGGAAAGGCTGAAAGTGCAGGG - Intronic
1029695356 7:102209428-102209450 TTGAAAAGGCGTAAGGTGAGCGG + Intronic
1031226371 7:119042714-119042736 CTGGAAAGGCCAAAGTTAAGGGG - Intergenic
1032013958 7:128364413-128364435 CTGAAAATGCTGAAAATGAGGGG + Intergenic
1032407674 7:131668443-131668465 CTGGCAAGTCTGAGGGTCAGTGG - Intergenic
1032412315 7:131705139-131705161 CTAGTAGGGGTGAAGGTGAGGGG + Intergenic
1032612365 7:133429012-133429034 TTGGAAAGGCTGAAGTTGCAGGG + Intronic
1032844673 7:135742210-135742232 CTGGAGAGGCTGGAGGTGGTGGG + Intronic
1033287703 7:140056836-140056858 CTGGTAAGGCTGGTGGGGAGTGG - Exonic
1034439422 7:151079013-151079035 ATGGAAAGCCTGAGGGGGAGAGG + Exonic
1034490562 7:151391094-151391116 CTAGAAAGGCAGATCGTGAGCGG + Intronic
1034977119 7:155455219-155455241 CTGGAAAGGAGGAAGGTGAGAGG - Intergenic
1035285907 7:157807130-157807152 CTGGCAAAGCTGTAGGTGAACGG + Intronic
1035774018 8:2173585-2173607 CTCGAATGGCTGAATGTCAGGGG + Intergenic
1036009140 8:4701432-4701454 CTGGAGAGTCTGATGGGGAGGGG + Intronic
1036987547 8:13553593-13553615 TTTGGGAGGCTGAAGGTGAGAGG - Intergenic
1037499065 8:19468365-19468387 CTGGAAAGGCCGACGTGGAGCGG + Intronic
1037584767 8:20268828-20268850 ATGGAAAGGCAGAAAGTGAAAGG + Intronic
1038674576 8:29612229-29612251 GAGGAAAACCTGAAGGTGAGAGG + Intergenic
1039757258 8:40536865-40536887 CTGAAAAGGGTGAATGTCAGCGG + Intronic
1040876435 8:52157260-52157282 ATGGAGAATCTGAAGGTGAGAGG + Intronic
1041419568 8:57651227-57651249 ATGGTAAGTCTGATGGTGAGAGG + Intergenic
1042510336 8:69604597-69604619 CTGGGTAGGATGAAGATGAGAGG - Intronic
1045270781 8:100659303-100659325 CTGGAGAGGCTGGAGGGCAGTGG - Intronic
1045642163 8:104262615-104262637 CTTGAAAGGGTCAAGGAGAGGGG + Intergenic
1045854599 8:106749417-106749439 ATGGCAAGCCTGAAGGTCAGAGG + Intronic
1046510860 8:115200675-115200697 CTGAAAAGGCAGAGGGTAAGAGG - Intergenic
1046555673 8:115769391-115769413 CTGTAAATGCGGAAGGTGTGAGG + Intronic
1046937108 8:119895123-119895145 CCTGAAAGTCTGAAGGAGAGGGG - Intronic
1047715794 8:127594017-127594039 CTGTAAATGTTGAAGCTGAGAGG - Intergenic
1048015825 8:130496838-130496860 CTAGCAGGGCTGAAGATGAGGGG + Intergenic
1049473807 8:142787788-142787810 CTGGCTAGGCTGAAGGTGAGTGG + Intergenic
1049484132 8:142842894-142842916 CAGGTAAGGCTGAAGATCAGAGG - Intronic
1049818878 8:144622179-144622201 CTGCACAGGCCCAAGGTGAGGGG + Intergenic
1049861631 8:144902469-144902491 CGGGGAAGGCTTAAGGTTAGGGG + Intergenic
1049961153 9:739543-739565 CTAGAAAGCCTGAAGAGGAGGGG - Intronic
1050643741 9:7696194-7696216 CTGGGAAGGCAGAGGGGGAGTGG - Intergenic
1052404582 9:28043445-28043467 CTGCAGTGGTTGAAGGTGAGGGG + Intronic
1054629849 9:67434371-67434393 CTGGAAAGGAGAAAGGAGAGTGG + Intergenic
1055910718 9:81347773-81347795 CTGGAAAGGGTGGGGGTGGGTGG - Intergenic
1056164934 9:83931758-83931780 CTTGGGAGGCTGAGGGTGAGAGG + Intergenic
1056174012 9:84016669-84016691 GTGGAAAGGCTGGGGGAGAGTGG - Intergenic
1056447313 9:86678399-86678421 CTGTAAATGTTGAAGGTTAGGGG + Intergenic
1056662187 9:88552192-88552214 CTGTAAAAGCGGAAGGGGAGTGG - Intronic
1057757586 9:97850168-97850190 CTTGAAGGGCTGAAGATCAGTGG + Intergenic
1057861651 9:98645490-98645512 GAGGAAAGGCTGAAGGTGCAGGG - Intronic
1059309254 9:113377081-113377103 CGGGAGAGGGCGAAGGTGAGGGG - Intergenic
1059429875 9:114243546-114243568 CTGGATGGCGTGAAGGTGAGGGG + Exonic
1059911280 9:119046839-119046861 GAGGCAAGGCTGAAGGTCAGAGG - Intergenic
1060102329 9:120851489-120851511 CTGTAGAGGCTGAAGGTCTGAGG + Intergenic
1061598281 9:131646936-131646958 CTGGAAGAGCTGAAGGGGAAAGG + Intronic
1061858723 9:133457017-133457039 CTTGAAAGGCTGGAGGGGTGGGG - Intronic
1061901703 9:133675983-133676005 CTTGGAAGGCTGAAGGGGGGAGG + Intronic
1062107992 9:134766158-134766180 CTGGGAAGGCTGAAGGGGGCAGG - Intronic
1185943065 X:4342640-4342662 CTTGGAAGGCTGAGGGTGGGAGG + Intergenic
1186380411 X:9052930-9052952 CTGGAAGGGATGAAGGTGATAGG - Intronic
1186380613 X:9054824-9054846 CTGGAAGGGATGAAGGTGATAGG + Intronic
1186881602 X:13872276-13872298 CGTGGAAGGCTGAAGGTGGGAGG - Intronic
1186976979 X:14917914-14917936 CTGAGAAGGCTGAAAGTGCGGGG + Intronic
1187621022 X:21054977-21054999 CTGGAAAGGCTGAAGAAAAAAGG + Intergenic
1188546013 X:31308124-31308146 CTGGAACAGCAGGAGGTGAGTGG - Intronic
1190282379 X:48939588-48939610 CAGGAAAGACTGAAGATGTGAGG + Intronic
1192449558 X:71235424-71235446 GTGGAAAGGCTGAGGGTGGTGGG - Intergenic
1192587858 X:72334130-72334152 CTGGAAAAGCTAGATGTGAGGGG - Intronic
1193120254 X:77815910-77815932 CTTGAGAGTCTGAAGGTGGGAGG - Intergenic
1194850629 X:98864597-98864619 CTTGAAGGCCTGAAGGTGAGAGG - Intergenic
1194992939 X:100564153-100564175 AAGGAAAGGCAGAAGGGGAGGGG + Intergenic
1195306112 X:103585661-103585683 CTGGAATGGCGGAAGGGGAACGG + Intronic
1195341485 X:103911175-103911197 TTGCAAAGGCTGAAGGACAGAGG - Intergenic
1195633527 X:107087077-107087099 CTGGAAAGGATAAAGGAGAATGG + Intronic
1196126177 X:112101948-112101970 CTTGAAAGGCTGTAGGGGAAGGG - Intergenic
1196141281 X:112265930-112265952 CTGGAGAGGGTGACTGTGAGGGG - Intergenic
1196572335 X:117280321-117280343 CTGCTAAGGGTGAAGGAGAGGGG - Intergenic
1197239992 X:124113894-124113916 CTGGACAGGCTGAATGTGGAAGG - Intronic
1199489208 X:148380158-148380180 CTGAAAAGGAAGAAGGTGAAGGG + Intergenic
1199997794 X:153037378-153037400 CTGGACTGGCTGATGGTGAAGGG - Intergenic
1200097449 X:153670834-153670856 GGGGAAAGGCTGAAGGTCAGGGG + Intronic
1200275096 X:154724533-154724555 CAGGAAAGGCTGATGGGAAGTGG - Intronic
1201379872 Y:13363291-13363313 CTGGGAAGGCTGAGGTTGTGAGG - Intronic
1201727986 Y:17174576-17174598 CTTGGAAGGCTGAGGGTGGGAGG + Intergenic