ID: 958908522

View in Genome Browser
Species Human (GRCh38)
Location 3:99967957-99967979
Sequence GTACTTCAGCACATCTACTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 149}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958908522 Original CRISPR GTACTTCAGCACATCTACTT GGG Intronic
900726087 1:4217200-4217222 GTACTGCAACACATCTTTTTTGG - Intergenic
902992803 1:20201199-20201221 TTAATTCAGCCCATCTGCTTTGG + Intergenic
904892051 1:33786905-33786927 GAACTTCAGCACGTCTTTTTGGG - Intronic
905740358 1:40364967-40364989 GGACTTCACCTCATCCACTTTGG - Intronic
906762359 1:48387511-48387533 GTACTTCTGCCCTGCTACTTGGG - Intronic
908190619 1:61699857-61699879 GTACTTCATGACTTTTACTTAGG + Intronic
909838969 1:80293970-80293992 GGACTTCAGCATATCTTTTTAGG - Intergenic
910776653 1:90883278-90883300 GTACTTCAGGAGCTGTACTTAGG + Intergenic
911489338 1:98542984-98543006 CTCTCTCAGCACATCTACTTTGG - Intergenic
911953998 1:104212956-104212978 GTGCTTCAGCATATAAACTTTGG + Intergenic
915873751 1:159590024-159590046 GTACTTCAGCAAATCTTCCCAGG - Intergenic
917480964 1:175411814-175411836 GGACTTCAACACGTCTTCTTTGG + Intronic
922181602 1:223239743-223239765 GTACTTGATCACATATACTTAGG - Intronic
923493500 1:234505240-234505262 GGACTTCAGCATTTCTTCTTGGG - Intergenic
923614834 1:235528434-235528456 TTACTTCAACACAGCTATTTAGG - Intergenic
923714317 1:236411977-236411999 GGACTTCAACACATCTGGTTTGG + Intronic
924817248 1:247453266-247453288 GTTCTTCAGAACATCAACTGGGG - Intergenic
1065619164 10:27561332-27561354 GTATTTCTGCTCATCTACTGAGG + Intergenic
1065970581 10:30803103-30803125 GGACTTCAACACATGAACTTGGG - Intergenic
1066255190 10:33671804-33671826 GTATTTTAAAACATCTACTTGGG + Intergenic
1066706174 10:38180969-38180991 GTACTTGAGCACATTTTCCTGGG + Intergenic
1066784257 10:38985374-38985396 GTACTTAAGCACATTTTCCTGGG + Intergenic
1066983790 10:42445097-42445119 GTACTTGAGCACATTTTCCTGGG - Intergenic
1067458474 10:46440332-46440354 GGATTTCAGCACATGCACTTTGG - Intergenic
1067628724 10:47944303-47944325 GGATTTCAGCACATGCACTTTGG + Intergenic
1068312397 10:55294458-55294480 TTACTTCAGAACATCTCCCTGGG - Intronic
1070532880 10:77352803-77352825 GTACTGTAGAACATCTACTAGGG + Intronic
1074988320 10:118677922-118677944 GTAAATCTGCACTTCTACTTTGG - Exonic
1076183572 10:128429798-128429820 GGGCTTCAGCACATCTGCGTGGG + Intergenic
1080063303 11:27980706-27980728 GGACTTCAACACATTTTCTTGGG + Intergenic
1086184017 11:83991800-83991822 GAACTTCAGCACATCTTTCTGGG - Intronic
1086407038 11:86507378-86507400 GTACTCCAACACATCTACTCTGG - Intronic
1096915714 12:55030331-55030353 GTTGTTCAGCCCACCTACTTTGG - Intergenic
1101300110 12:103470785-103470807 GTAAATCAGCACATCTACTCAGG - Intronic
1102864848 12:116366324-116366346 CAACTTCAGCTCATCTACTTGGG + Intergenic
1109446954 13:62452729-62452751 ATATTTCAACACATCTACATAGG + Intergenic
1112089466 13:96067863-96067885 GAACTTCAGCATATCTTTTTGGG - Intergenic
1113484364 13:110643504-110643526 GGCCTTCAGCACACCTGCTTGGG + Intronic
1118034653 14:61853402-61853424 GGATTTCAACACATGTACTTGGG - Intergenic
1119667498 14:76495657-76495679 GTCCTTCATCACAGGTACTTTGG - Intronic
1119796881 14:77406558-77406580 GTACTGCAGGAGAGCTACTTAGG - Intronic
1123130508 14:105981882-105981904 GGACTTCAGCACATGAATTTAGG + Intergenic
1123580747 15:21713103-21713125 GGACTTCAGCACATGAATTTAGG + Intergenic
1123617396 15:22155726-22155748 GGACTTCAGCACATGAATTTAGG + Intergenic
1126672312 15:51127532-51127554 GTACTTCAACATATCTTTTTGGG + Intergenic
1127772029 15:62240193-62240215 GTTCCTCATCACATCTTCTTTGG + Intergenic
1127823307 15:62679976-62679998 CTAGTTCAGCACATCTATATGGG + Intronic
1128535845 15:68489640-68489662 GTCCTTCAGCACAGCTACCCTGG - Intergenic
1131770410 15:95730572-95730594 GTAGTTCAGCTCTTCCACTTAGG + Intergenic
1131975400 15:97941015-97941037 GTACTTCAGAAACTCTTCTTGGG + Intergenic
1202989617 15_KI270727v1_random:447348-447370 GGACTTCAGCACATGAATTTAGG + Intergenic
1133339352 16:5026830-5026852 GTACTACAGCACTTCTGCCTGGG + Intronic
1133449289 16:5890163-5890185 GTACTTAAGCACATACACCTGGG - Intergenic
1136711863 16:32244235-32244257 GTTCTTCTCCACAGCTACTTTGG + Intergenic
1136756053 16:32685172-32685194 GTTCTTCTCCACAGCTACTTTGG - Intergenic
1136812060 16:33185201-33185223 GTTCTTCTCCACAGCTACTTTGG + Intergenic
1136818536 16:33295281-33295303 GTTCTTCTCCACAGCTACTTTGG + Intronic
1136825100 16:33351814-33351836 GTTCTTCTCCACAGCTACTTTGG + Intergenic
1136830166 16:33450585-33450607 GTTCTTCTCCACAGCTACTTTGG + Intergenic
1138861320 16:60761763-60761785 GTAATTCAGCAAATCCACATAGG - Intergenic
1139332817 16:66207043-66207065 GAACTTCAGCATATCTTTTTAGG + Intergenic
1140614975 16:76651209-76651231 GGACTTAAACACATCTTCTTGGG - Intergenic
1202990638 16_KI270728v1_random:8171-8193 GTTCTTCTCCACAGCTACTTTGG + Intergenic
1203058191 16_KI270728v1_random:945524-945546 GTTCTTCTCCACAGCTACTTTGG - Intergenic
1150288031 17:63964842-63964864 GAACTTCAAAATATCTACTTGGG + Intronic
1151597365 17:75086786-75086808 TTACAGCACCACATCTACTTAGG - Intergenic
1153480840 18:5544174-5544196 GTACTTCAGGACAGTTACATGGG + Exonic
1156544202 18:37947351-37947373 GGACTTCAACACATCATCTTTGG - Intergenic
1157002290 18:43541830-43541852 GAACTTCAACAAATCTCCTTAGG - Intergenic
1159589857 18:70322185-70322207 CTAATTCAGAACATTTACTTAGG + Intronic
1163865290 19:19768762-19768784 GAACTTCACCTCATCCACTTTGG - Intergenic
1165583474 19:36890966-36890988 GGACTTCAGCATATCTTTTTAGG - Exonic
929122426 2:38494465-38494487 GAATTTCAGCTCATTTACTTGGG - Intergenic
934886859 2:98032609-98032631 GAACTTCAACACATCTTTTTTGG + Intergenic
935466146 2:103400309-103400331 GTAGTTCAGGACAACTACTCAGG + Intergenic
940393373 2:153159339-153159361 GTACTTCACCTCTTCTAGTTGGG - Intergenic
944084152 2:195824900-195824922 GTAATTAAGCAAATCTAATTAGG - Intronic
946465676 2:219909880-219909902 GGACTTCAGCATATCTTCTTGGG + Intergenic
947132351 2:226941614-226941636 GTACTTGAGCTCATCTATTCTGG + Intronic
947133932 2:226957752-226957774 GGACTTCTGTACATCTTCTTTGG - Intronic
1170757932 20:19221258-19221280 GTATTCCAGCACGTCTTCTTTGG + Intronic
1173302933 20:41819758-41819780 GTACATCAACACAACAACTTGGG - Intergenic
1174797977 20:53538546-53538568 GTAGCTCAGCACATCTAGTCTGG - Intergenic
1177087361 21:16723174-16723196 GAACTTCATGACATATACTTTGG + Intergenic
1178175093 21:30087535-30087557 GGACTTCTGCATATCTATTTGGG + Intergenic
1178308493 21:31510054-31510076 GGACTTCAGCATATCTTTTTGGG - Intronic
1178635244 21:34296742-34296764 GAACTTCAGCATATCTTTTTTGG + Intergenic
1179568720 21:42265294-42265316 GAACTTCAACATATCTATTTGGG - Intronic
1181322226 22:22016810-22016832 GGACTTCATTACATCTGCTTTGG + Intergenic
1181881412 22:25983219-25983241 GCACATCACCACATCCACTTAGG - Intronic
1182514856 22:30850262-30850284 GTACTACAGCACTTCAACCTGGG + Intronic
1184249375 22:43251439-43251461 GTCCTTCAGCACATCTGCAGAGG - Intronic
952462015 3:33537406-33537428 GTGCTTCAGCACATCTCCAAAGG - Intronic
952571586 3:34724146-34724168 GAACTTCACCACATCTGATTTGG + Intergenic
952928161 3:38336992-38337014 GGACTTGAGCACATCTTTTTGGG + Intergenic
955836899 3:63065838-63065860 GTTCTTCAGCTCATCCACCTTGG + Intergenic
956334016 3:68143493-68143515 CAACTTCAGCATATTTACTTTGG + Intronic
958492398 3:94793929-94793951 GAACTTCAGCATATATACTTTGG - Intergenic
958908522 3:99967957-99967979 GTACTTCAGCACATCTACTTGGG + Intronic
962206800 3:133441482-133441504 GGATTTGGGCACATCTACTTGGG + Intronic
962968977 3:140381355-140381377 GGACTTCAACACATCTTTTTTGG + Intronic
965465114 3:169019888-169019910 GTTCTTTAGAAAATCTACTTTGG + Intergenic
967726152 3:192864285-192864307 GTACTTCAGCACAGCTCTTGAGG - Intronic
970402478 4:15731169-15731191 GGACTTCATCTCATCCACTTTGG + Intronic
970535748 4:17028220-17028242 GAACTTCAGAACATGAACTTTGG + Intergenic
970606613 4:17687486-17687508 AGACTTCAGCATATCTTCTTAGG - Intronic
971937727 4:33173956-33173978 GGACTTCAGCACGTATATTTGGG + Intergenic
973566642 4:52195334-52195356 TTAAATCAGCACATCTGCTTTGG + Intergenic
973589740 4:52428929-52428951 GTAGTACACCACATCTACTTAGG + Intergenic
975804145 4:78095482-78095504 GGACTTCAGCACATGAATTTGGG - Intronic
978131699 4:105206116-105206138 GTGCTTCAGCCCATCTGGTTGGG + Intronic
979301735 4:119094616-119094638 GTATGTCAGGACATCTACTTTGG - Intergenic
983793596 4:171829802-171829824 GTACATGAGCATATCTTCTTAGG - Intronic
984856909 4:184203401-184203423 GAACTTCAGTATATCTTCTTGGG - Intronic
985063601 4:186101539-186101561 GGACTTCAACACATCTTCTGGGG + Intergenic
985901271 5:2796599-2796621 GAGATTCAGCACATCTGCTTGGG + Intergenic
990813544 5:59756089-59756111 GTTCTTCTGAAGATCTACTTTGG + Intronic
992846269 5:80751783-80751805 GGACTTCAGCATATCTTTTTAGG + Intronic
993354075 5:86884423-86884445 GAACTTCACCTCATCCACTTTGG + Intergenic
995630328 5:114125938-114125960 GAACTTCAGCACATGAATTTTGG + Intergenic
996723887 5:126656992-126657014 GTACTTCAAAGCATCAACTTGGG + Intergenic
997631810 5:135374371-135374393 CTACATCAGGACATCTCCTTTGG - Intronic
997671637 5:135679448-135679470 GTACTTCAGCCCTGCTACTGGGG + Intergenic
1000149174 5:158482845-158482867 GTAGTTCAGCACATCCCCGTGGG + Intergenic
1002007202 5:176245087-176245109 GAACTTCAGCACATCTTTTTAGG - Intronic
1002219177 5:177665535-177665557 GAACTTCAGCACAGCTTTTTAGG + Intergenic
1003253118 6:4450045-4450067 GTAATTCTGTACATCTGCTTGGG + Intergenic
1005036075 6:21555985-21556007 GGACTTCAGCATATCTTTTTCGG - Intergenic
1006637398 6:35470305-35470327 GGACTTCACCTCATCCACTTTGG - Exonic
1009508839 6:64521688-64521710 ATAATGCAGCACATCTAATTTGG + Intronic
1011179781 6:84607131-84607153 GGACTTCAGAGCATCTGCTTTGG + Intergenic
1011524157 6:88245160-88245182 GTAAATCAGCACATCTTCCTGGG - Intergenic
1011526543 6:88271633-88271655 GTTATTCAGCACTTCTCCTTTGG - Intergenic
1012055433 6:94401643-94401665 ATACTTCAGCATTTCTCCTTGGG + Intergenic
1013342344 6:109227437-109227459 TTGTTTCAGCACATCTGCTTAGG + Intergenic
1015027543 6:128555149-128555171 GGACTTCAGCATATCTTTTTTGG - Intergenic
1016458191 6:144253884-144253906 GTACAACAGTACATCCACTTTGG - Intergenic
1016551303 6:145283268-145283290 GGACTTCAGCATATCTTTTTGGG - Intergenic
1017817311 6:158025308-158025330 GTACTTCAGCATATTAACTTGGG + Intronic
1027571992 7:79880934-79880956 TTACTTCAGCAAATCAACTCAGG - Intergenic
1029891535 7:103935110-103935132 GTACTTCAACACAAATTCTTGGG - Intronic
1030427475 7:109397553-109397575 GTAATTGAGGACATCTATTTCGG - Intergenic
1033286366 7:140044226-140044248 GACCTTCAGCATATCTTCTTGGG - Intronic
1037313627 8:17581098-17581120 GGACTTCAGCATATCTTTTTAGG + Intronic
1040803326 8:51367544-51367566 GTACCTCAGCAACTTTACTTTGG + Intronic
1041385628 8:57298870-57298892 GGAATTCAGCTCATATACTTGGG - Intergenic
1041769780 8:61460093-61460115 GTACTTCAACATATGAACTTGGG + Intronic
1042117705 8:65450231-65450253 ATACTACAGCAAATCTACTCTGG - Intergenic
1045707492 8:104943087-104943109 CTACCTCAGCACATCTACTTTGG + Intronic
1048265420 8:132981236-132981258 GAGCTACAGCACATCTACTGGGG - Intronic
1055816676 9:80213946-80213968 GGCCTGCAGCACCTCTACTTGGG - Intergenic
1059474514 9:114533751-114533773 GTATTTCAGCACATGAATTTTGG + Intergenic
1060165349 9:121409251-121409273 GAACTTCAGCACATCTTTTTTGG + Intergenic
1060714695 9:125913676-125913698 GTACTTCACCACATGTCCATAGG + Intronic
1188968481 X:36583461-36583483 GTATTGCAGTACATCCACTTGGG - Intergenic
1189230338 X:39447294-39447316 GGACTTCAGCACACCTTCTCTGG + Intergenic
1189851576 X:45182453-45182475 GGAAATCAGCACAACTACTTTGG + Intronic
1189897302 X:45668835-45668857 TTAGTTCACCACATCCACTTGGG + Intergenic
1192025629 X:67448167-67448189 ATACTTCAGGACATTTGCTTAGG + Intergenic
1194802866 X:98293422-98293444 GTATTTAATCCCATCTACTTTGG - Intergenic
1196009838 X:110875061-110875083 ATACTACAGCAGATTTACTTTGG + Intergenic
1198843482 X:140883729-140883751 GTACTTCAACATAGCTTCTTGGG + Intergenic