ID: 958912972

View in Genome Browser
Species Human (GRCh38)
Location 3:100015577-100015599
Sequence CATTGCTTCTAGAATTCTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 285
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 262}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958912970_958912972 25 Left 958912970 3:100015529-100015551 CCATTTATTTGTGGGACAATATT 0: 1
1: 0
2: 1
3: 25
4: 349
Right 958912972 3:100015577-100015599 CATTGCTTCTAGAATTCTGATGG 0: 1
1: 0
2: 0
3: 22
4: 262

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958912972 Original CRISPR CATTGCTTCTAGAATTCTGA TGG Intronic
900959287 1:5909105-5909127 AATTGACTCTGGAATTCTGAAGG + Intronic
902131165 1:14261824-14261846 CCTTGCTTCTGGAATTCAGTGGG + Intergenic
904352183 1:29915726-29915748 CACTGCTTCAAGACTTCTAAAGG + Intergenic
905413228 1:37786553-37786575 AATTTCTTCCAAAATTCTGAGGG - Intergenic
906255914 1:44350044-44350066 CCTTGCTTGTAGAAGACTGATGG - Intronic
906294166 1:44638924-44638946 TATTTCTTCTAGAATTGGGAAGG - Intronic
908969817 1:69814516-69814538 CATTTCTTGTTGAATTCAGAGGG - Intronic
910145051 1:84070203-84070225 TATGGCTTATAGAATTCTGCAGG + Intergenic
912719604 1:112008657-112008679 CATTGCTTTTAGAGTTACGAGGG - Intergenic
913017082 1:114748906-114748928 CCTTGCTTATAGACATCTGATGG + Intronic
913390861 1:118310577-118310599 CTTTCCTTCTGGAATTCAGATGG + Intergenic
916733558 1:167587408-167587430 CATGGCTTCTATAATGCTTATGG - Intergenic
917033904 1:170725469-170725491 CAGCACTTCTAGAATGCTGAAGG - Intronic
918528765 1:185494375-185494397 TATTACTTCTAGACTTCTCAAGG - Intergenic
918724961 1:187909174-187909196 CTTTGCTTCTCAAATTCTCATGG - Intergenic
918994329 1:191736814-191736836 AATTGCTGTTAGAATTTTGATGG + Intergenic
918997796 1:191784545-191784567 CAGTTCTTTTAGGATTCTGAGGG - Intergenic
919348685 1:196419687-196419709 CAATGCTTTCAAAATTCTGAAGG - Intronic
919987385 1:202685356-202685378 CATTGCTAATGGAATTCTGTTGG - Intronic
920362268 1:205427180-205427202 CATTCCTTCCAGAATTTTTAAGG + Intronic
920974357 1:210771780-210771802 TATTGCTTCTATAATTCTGGAGG - Intronic
922658828 1:227410936-227410958 CATTGCTGCTGGAATTCTCCTGG + Intergenic
923397218 1:233578713-233578735 CAATGCTTCTTGAAATCTCAAGG - Intergenic
923546662 1:234928345-234928367 GATTTCTCTTAGAATTCTGAAGG + Intergenic
1063903331 10:10758355-10758377 AATTCCTTATAGAACTCTGAAGG - Intergenic
1065620466 10:27575982-27576004 CATTCTTTTTACAATTCTGAAGG + Intergenic
1067259247 10:44673538-44673560 CATTCCATCTAGATTTTTGAAGG - Intergenic
1068202759 10:53804494-53804516 TATAGCTTCTAGTATCCTGATGG - Intronic
1069655899 10:70088339-70088361 CATTCCTTCTAGCTTTCTAAGGG + Intronic
1070267033 10:74913573-74913595 AATTGCTTCTAGAATTCACAAGG + Intronic
1070304207 10:75228772-75228794 CTTTGCTTTCAGCATTCTGAGGG - Intronic
1071080345 10:81802965-81802987 AAGTGATTCTAGAATTCAGAGGG + Intergenic
1071168397 10:82833707-82833729 TAGTGCTTCAAGAATTGTGAAGG - Intronic
1072269122 10:93758093-93758115 CAGGGCTTCTGGAATTCAGATGG - Exonic
1075882636 10:125866923-125866945 CTTAGGTTCTACAATTCTGAAGG - Intronic
1079985648 11:27197751-27197773 CATTGCTTTTATCATTCTTACGG - Intergenic
1080212955 11:29808169-29808191 CATTCCTTTTAGTATTCTGATGG - Intergenic
1080828499 11:35868508-35868530 CAGTGCTTTTAAAATTCAGAAGG + Intergenic
1082581986 11:54882416-54882438 CAGTGTTTCCAGAATGCTGAAGG - Intergenic
1083799367 11:65037667-65037689 CCTTGCCTCGAGAATTCTGGTGG - Intronic
1085739055 11:79063695-79063717 CCTTGCTGGCAGAATTCTGAGGG - Intronic
1086151050 11:83611338-83611360 CACTGCTTCCAGGATTCTGTAGG + Intronic
1086382639 11:86273633-86273655 CATTTCTTCTTTATTTCTGAAGG + Intronic
1087529337 11:99358850-99358872 CATTGCATACATAATTCTGAGGG - Intronic
1087629645 11:100635511-100635533 CAGTCCTTCCAGAGTTCTGAGGG + Intergenic
1090889811 11:130914041-130914063 CAGGGCTGCTAGAATGCTGAGGG - Intronic
1091196348 11:133734075-133734097 CTTACCTTCTAGAATTCTAAAGG - Intergenic
1092965643 12:13639216-13639238 CATTGCTCCTGAAATTCTGCTGG - Intronic
1095144320 12:38706870-38706892 CAGTGCTTCTAGGAAGCTGACGG - Intronic
1095197741 12:39342186-39342208 GATGGCTTCTAAAAATCTGAGGG - Intronic
1096966376 12:55631430-55631452 CATAGCCTCTAGAATTCTCCAGG + Intergenic
1096988190 12:55776062-55776084 CATTACTTCTTGGATACTGAGGG - Intronic
1098925052 12:76340318-76340340 CAATGCTACTTAAATTCTGAAGG - Intergenic
1099019259 12:77382727-77382749 CAATGATTCTAAAATTCTCAAGG + Intergenic
1099564899 12:84230559-84230581 CATTGCTTCTTGAATGCAGTGGG - Intergenic
1100959903 12:99951041-99951063 CAATGCTTTCAAAATTCTGAGGG - Intronic
1101073150 12:101097475-101097497 CATAGCTTCTGGAATTCTCCAGG - Intronic
1102112791 12:110377571-110377593 CATTGCTTCTCGAATACTGTTGG + Exonic
1102362491 12:112300358-112300380 CAGTACTTTCAGAATTCTGAGGG - Intronic
1103430259 12:120878418-120878440 CATTGCTTTTAGTATTCAGTAGG - Intronic
1107579391 13:41766132-41766154 CATGACTTTAAGAATTCTGAGGG + Intronic
1107715879 13:43199053-43199075 CATTGCTTCTCGTTTTCTGGAGG + Intergenic
1108085663 13:46789358-46789380 CAGTGCTTTCAGGATTCTGAAGG - Intronic
1108087875 13:46814255-46814277 CATTTCTTCTAGTACTTTGATGG - Intergenic
1108879610 13:55094017-55094039 AATTTCTTCTTGAATACTGAGGG - Intergenic
1108929416 13:55797699-55797721 TTTTGCTTTTAGAATCCTGAAGG + Intergenic
1110760789 13:79228307-79228329 CATTGATTTTATAATTTTGATGG - Intergenic
1112223002 13:97510203-97510225 GTTTTCTTCTAGAATTCTTATGG + Intergenic
1113462642 13:110492643-110492665 CATTCCCTCTGGATTTCTGAGGG - Intronic
1113473606 13:110563827-110563849 CATTGATTCCAGAATTCATATGG - Intergenic
1115270004 14:31540917-31540939 CAATGCTTTTAAAATCCTGAGGG - Intronic
1115392129 14:32865956-32865978 CACTGCTGCTCGAATTCTGGGGG - Intergenic
1115853743 14:37607895-37607917 GATTACTTATAGATTTCTGAGGG - Intronic
1119939534 14:78625665-78625687 CATTTCTTCTACACCTCTGATGG - Intronic
1120060060 14:79971723-79971745 TATTGCATCTAGAAGTATGAGGG + Intergenic
1120446775 14:84608032-84608054 CATTACTTCTAGCTTTCTCAAGG + Intergenic
1121023309 14:90595576-90595598 CATTGCTACTAAAAATCTCAGGG - Intronic
1125053046 15:35323811-35323833 CATTGCTATCAGAATTCTGCCGG + Intronic
1125758591 15:42082374-42082396 CATTGCTTCTGGAGCTCTGAAGG + Exonic
1126443147 15:48713294-48713316 CAGTGCTTTTACACTTCTGATGG - Intronic
1127692733 15:61413910-61413932 CAGTGCTTTCAAAATTCTGAAGG + Intergenic
1128743831 15:70100262-70100284 CACTCCTTCTAGACTTCTGGAGG - Intergenic
1129777632 15:78247107-78247129 CTTTGTTCCTAGAATTCTCATGG - Intergenic
1134488159 16:14675359-14675381 GTTTTCTTCTAGAATTCTTATGG - Intronic
1138250546 16:55498637-55498659 CATTGCTGATATAATTCTGGTGG + Intronic
1139031786 16:62892528-62892550 CATTTCTTCTTTATTTCTGAAGG + Intergenic
1142931744 17:3291164-3291186 TTTTGCTTTTAGAGTTCTGATGG + Intergenic
1143198547 17:5096265-5096287 CATAGCTTCAAAAATTCTGAAGG - Exonic
1143570039 17:7751777-7751799 AATTGATTCTAAAATTCTTATGG - Intronic
1143676624 17:8437829-8437851 GATTGTTGCTAGATTTCTGAAGG + Intronic
1143757683 17:9078996-9079018 CATGGCTTCTACAATCCTAATGG + Intronic
1144197846 17:12912756-12912778 CAGTGCCTTTAAAATTCTGAAGG + Intronic
1144768723 17:17747207-17747229 CATTTCTTCTAGAAACCTCAGGG - Intronic
1145413958 17:22697438-22697460 CTTTTCTTCTAGAATTGTTATGG + Intergenic
1149398126 17:56265625-56265647 CAATCCTTCTTGAATACTGAAGG - Intronic
1151115801 17:71733548-71733570 CATTGCTCCTGAAATTCTGCTGG + Intergenic
1153555786 18:6311702-6311724 GTTTGCTTCTGTAATTCTGAAGG - Intronic
1153856789 18:9157101-9157123 CCGTGCTTCTAGAATTAGGATGG + Intronic
1155180552 18:23341905-23341927 CTTTTCTTCTTAAATTCTGAGGG - Intronic
1155260373 18:24036597-24036619 CATTCCTTGTAGAATTTTTAGGG + Intronic
1155441449 18:25866668-25866690 CAGTTCTTTTAGAATTCTTATGG - Intergenic
1155843345 18:30673546-30673568 CAATGCATTTAAAATTCTGATGG - Intergenic
1156592541 18:38507762-38507784 CATTGCTTTTAGATTTGTAAAGG + Intergenic
1157724724 18:49955214-49955236 CACTGCATTAAGAATTCTGAAGG + Intronic
1159349140 18:67249192-67249214 CATTGCTCCTAGAATAACGACGG - Intergenic
1159653846 18:71008463-71008485 CATTGCATCAGAAATTCTGAAGG - Intergenic
1160105325 18:75969135-75969157 CATTTCTTCTATCATTCTGTGGG - Intergenic
1162175876 19:8829793-8829815 CATTCCTTCAAGAATGCTGTAGG + Intronic
1164290209 19:23861410-23861432 CATGGATTCTACAATTCTGTTGG - Intergenic
1164353003 19:27375695-27375717 GATTTCTTCTAGAGTTCTTATGG + Intergenic
1164736997 19:30548941-30548963 AACTGCTTGTAGAAGTCTGATGG - Exonic
1165123053 19:33574972-33574994 CAATGCTTTTAAAATTCTGAGGG + Intergenic
925492937 2:4415361-4415383 GATTGCTTCTCCAACTCTGATGG + Intergenic
926267274 2:11335773-11335795 CATTTCATTTGGAATTCTGATGG - Intronic
928095467 2:28402199-28402221 AATTGGTTCTAGGATTCTGGAGG - Intronic
929099499 2:38296855-38296877 CATTGATTCTAGGATTTTGGAGG - Intronic
929630440 2:43454849-43454871 CATTGCCTTCAAAATTCTGAGGG - Intronic
929866336 2:45720358-45720380 CATTGCTTCTAGGGATTTGAGGG + Intronic
929908251 2:46065301-46065323 AATTCCTCCAAGAATTCTGACGG + Intronic
930451720 2:51547617-51547639 AATTTCTTCTAGAATTCTGGGGG + Intergenic
930861260 2:56075922-56075944 GTTTGCTTCTACAGTTCTGAAGG + Intergenic
931528698 2:63187930-63187952 CATTTCTTCTTCATTTCTGAAGG + Intronic
932884345 2:75534852-75534874 GTTTTCTTCTAGAATTCTTATGG + Intronic
933000817 2:76920436-76920458 AATTTCCTATAGAATTCTGAAGG + Intronic
933481211 2:82859149-82859171 CTTTCTTTCTAGAATTCTGAAGG - Intergenic
935386973 2:102510067-102510089 TCTTGCTTATAGAATTGTGAGGG + Intronic
935476878 2:103533294-103533316 AGTTTCTTCTAGAATTTTGATGG + Intergenic
935745864 2:106189763-106189785 CAATGCTTCAAAAATTCTAAAGG + Intronic
936819725 2:116505327-116505349 GTTTTCTTCTAGAATTCTTATGG + Intergenic
940679693 2:156770568-156770590 CATTTCTCCTTCAATTCTGAAGG - Intergenic
941845182 2:170125493-170125515 TAATGCTTTGAGAATTCTGATGG - Intergenic
942474477 2:176303045-176303067 CATTTCCTCTAAAATTCTGCAGG - Intronic
944620803 2:201514152-201514174 AAATTCTTCTAGAATACTGAAGG + Intronic
945802052 2:214446551-214446573 TATCGCTTCTAGAATTATTAGGG + Intronic
947131434 2:226930527-226930549 GTTTTCTTCTAGAATTCTTATGG - Intronic
948590085 2:239043791-239043813 CATTACTTGTAGAATTCTCCTGG + Intergenic
1169633015 20:7654682-7654704 CATTTCTTTTTTAATTCTGAAGG - Intergenic
1172489978 20:35328469-35328491 CATCGCTTGTAGCATTGTGAGGG - Intronic
1173108799 20:40165284-40165306 CATTTCTTCTAGAAGTTTTAAGG + Intergenic
1173179937 20:40798458-40798480 TATGGCCTCTAGAATTCTGGAGG - Intergenic
1177411426 21:20734889-20734911 CATTGTTTCTGGGGTTCTGAGGG - Intergenic
1177869446 21:26553418-26553440 CCTTTCTTCTGGGATTCTGATGG + Intronic
1177901262 21:26918240-26918262 CATTGCTTCTGGAAAATTGAGGG + Exonic
1177925168 21:27205075-27205097 CATTTCTTCTATATTTATGAAGG - Intergenic
1178080600 21:29059964-29059986 AATTACTTCTAGAATTTTGTGGG + Intronic
1180111082 21:45651729-45651751 GATTGCTTCTAAATTTCTAAAGG + Intronic
1180610186 22:17091321-17091343 CAATGCTTTCACAATTCTGAGGG - Intronic
1184547870 22:45184409-45184431 TATAGCTTCTATAATTTTGATGG + Intronic
951361264 3:21727209-21727231 CTTTTCTTCTAGAATTTTTATGG - Intronic
953596894 3:44324385-44324407 TATGGTTTCTAGAAGTCTGAAGG - Intronic
955492688 3:59499028-59499050 AATTGCATTTTGAATTCTGATGG + Intergenic
956198180 3:66674729-66674751 CATTTTGCCTAGAATTCTGATGG + Intergenic
956421063 3:69086511-69086533 CATTGCTTAAGGAATTCTTAAGG + Intronic
956614882 3:71160748-71160770 CATCTGTTCTAGAATACTGAAGG + Intronic
957279080 3:78126788-78126810 CATTTATTATACAATTCTGAGGG - Intergenic
958686553 3:97405590-97405612 AATTGTTTCTAAAATTCAGATGG + Intronic
958791468 3:98656340-98656362 CATTTCTTCTCAAATTCTGATGG + Intergenic
958912972 3:100015577-100015599 CATTGCTTCTAGAATTCTGATGG + Intronic
962617274 3:137139203-137139225 CACTGCCTTTAAAATTCTGAAGG - Intergenic
964046786 3:152338209-152338231 CATTGCTTCTTGTGTTCTGGCGG + Intronic
964770143 3:160216041-160216063 CATTGCTTCAAGATTTTTCAGGG - Intergenic
964811629 3:160670604-160670626 CGTTTCTTCTAGAAATATGACGG - Intergenic
965100373 3:164290459-164290481 GATTCCTTTTAGAATTCTTATGG - Intergenic
965927075 3:173994850-173994872 CATTTCTTCTAGAACGCTGTTGG - Intronic
966280108 3:178216065-178216087 CATTTGTTTTAGAACTCTGAGGG + Intergenic
966415186 3:179681866-179681888 TCTTTCTTCTAGAATTCTGAAGG + Exonic
968348444 3:198031592-198031614 AAATGCTTTCAGAATTCTGATGG - Intronic
969953128 4:10860615-10860637 AATAGCTTCCAGAATTCTGATGG - Intergenic
970199112 4:13584152-13584174 CATTTCTTCTCACATTCTGATGG + Intronic
970646326 4:18125043-18125065 CATTGATTCTAGAATTTATATGG - Intergenic
972559215 4:40211887-40211909 CCTTCCTTCTCGAATTGTGATGG + Intronic
973146681 4:46834259-46834281 CATTGATTCTGGAGTTCAGATGG + Intronic
974572956 4:63678532-63678554 CAATGCTTCTTAAATGCTGAAGG + Intergenic
977321157 4:95518147-95518169 CCTTAGTTCTGGAATTCTGATGG - Intronic
977435056 4:96984282-96984304 CATTTCTTCTAGGATTCTTGTGG - Intergenic
979326032 4:119380814-119380836 GTTTTCTTCTAGAATTTTGATGG + Intergenic
979572513 4:122245013-122245035 CATTGCTTCAATATATCTGAGGG - Exonic
980587970 4:134843514-134843536 CATAGCTTTTAGAATTATAAAGG + Intergenic
981816705 4:148839333-148839355 CAGTGCATCTAGAATTGTGGTGG + Intergenic
982635655 4:157893637-157893659 CAATGCTTCTATAACTGTGAGGG + Intergenic
983243892 4:165265480-165265502 GTTTTCTTCTAGAATTTTGATGG + Intronic
983302711 4:165947714-165947736 GGGTGCTTCTAGAAATCTGAAGG + Intronic
983815377 4:172120348-172120370 GATTCCTTCTGGAATTTTGAAGG + Intronic
983848301 4:172546296-172546318 CATAGCTGCTAGAATACTGTAGG - Intronic
984059404 4:174973705-174973727 CTTTGCTTTTTTAATTCTGAAGG + Intronic
984569242 4:181371577-181371599 CATTGGTTTAAGAATTCTTAAGG - Intergenic
985824517 5:2182333-2182355 CTGGGCTTCTAGAATTCTCAGGG + Intergenic
986428875 5:7662289-7662311 CCTTGCTTCCAGAACACTGATGG - Intronic
987761585 5:22170138-22170160 AATTGTTTCTACTATTCTGAGGG - Intronic
988879205 5:35482102-35482124 CATTGCTCCTAGACTCCTGGAGG - Intergenic
988890154 5:35608027-35608049 TAAGGCTTCTGGAATTCTGAGGG - Intergenic
990275622 5:54193009-54193031 CATGGCTTCTACTATTTTGATGG + Intronic
990643735 5:57819278-57819300 GATGGCTGCTAGAATTCTGTTGG + Intergenic
991490144 5:67174646-67174668 CAATGCTTCTCAAATTTTGAAGG - Intergenic
991896374 5:71403604-71403626 AATTGTTTCTACTATTCTGAGGG - Intergenic
993153253 5:84188274-84188296 TCTAGCTTCTAGAACTCTGAAGG - Intronic
994394508 5:99217066-99217088 TATTGTTTCTAATATTCTGAGGG - Intergenic
994398731 5:99251976-99251998 CATGTCTTCTAGAATTTTCATGG + Intergenic
994910188 5:105895001-105895023 CTTTTGTTCTTGAATTCTGAAGG - Intergenic
994925955 5:106117652-106117674 AATTGCTTGTATAATTCTGTTGG - Intergenic
994944921 5:106375276-106375298 CCTTGCTTCAACAATTCTAAGGG + Intergenic
996303367 5:122016398-122016420 TAATGCTTCTAAAATTATGAAGG - Intronic
998137169 5:139680164-139680186 CACTGCTTCTAGAGTTCTTGTGG + Intronic
999224128 5:150005971-150005993 CTTTGCTTCCAGGTTTCTGAAGG + Intronic
1000508267 5:162149011-162149033 CATTGTTTCATGACTTCTGATGG - Intronic
1002109616 5:176899554-176899576 CATTCCCTCTACAATGCTGAGGG + Intergenic
1002503443 5:179662590-179662612 AATTGCTTCTATCTTTCTGAGGG + Intergenic
1006053705 6:31364567-31364589 CTTTCTTTCTGGAATTCTGAAGG + Intergenic
1007095647 6:39211068-39211090 CATTCCTTCTAGATTTGTGGTGG + Intronic
1007296451 6:40825750-40825772 CATTTCTTGAAGATTTCTGAAGG + Intergenic
1007854749 6:44844276-44844298 TATTTCTTCTAGAATTTTTATGG - Intronic
1008681942 6:53881805-53881827 CATTGCATCTAAAATGCTGAAGG - Intronic
1009049386 6:58259779-58259801 TATTGTTTCTAAAATTCAGAGGG - Intergenic
1009262151 6:61506039-61506061 CATTGTTTCTAAACTGCTGAAGG + Intergenic
1009347675 6:62636390-62636412 CAATTATTCTTGAATTCTGAAGG - Intergenic
1012101923 6:95100773-95100795 CAATGCTTATAGAATTCTAGGGG - Intergenic
1012124971 6:95417802-95417824 CATTGATTATAGAAATCTAAAGG - Intergenic
1012316969 6:97792571-97792593 CTTTTATTCTGGAATTCTGAGGG - Intergenic
1012424294 6:99097110-99097132 CTTTTCTTCTAGAATTTTTATGG - Intergenic
1012789893 6:103679882-103679904 TATTACTTCTTGAATTCTGCAGG - Intergenic
1014443443 6:121499216-121499238 CATTTCTTTTATATTTCTGAAGG + Intergenic
1015998533 6:139019141-139019163 CATTATTTCTAGAATTTTCATGG - Intergenic
1017445522 6:154503949-154503971 CAGTGCTTCTCTAATTGTGATGG + Intronic
1017611150 6:156187723-156187745 CATTTCATCTTGCATTCTGATGG - Intergenic
1017745314 6:157442039-157442061 CACTGTTTCTATTATTCTGAGGG - Intronic
1018693383 6:166368606-166368628 CATTGTTAATAGAATTCTGCAGG - Intronic
1019053725 6:169205000-169205022 AATTGCTTTCAAAATTCTGATGG - Intergenic
1022965905 7:35471349-35471371 GATTGTTTATAAAATTCTGAAGG + Intergenic
1024381408 7:48701298-48701320 CATTGCTTGTAGAAATTTGGAGG + Intergenic
1024776775 7:52797073-52797095 CAATGCTTTTAAAATTCTGAGGG - Intergenic
1024926668 7:54623000-54623022 CATCTCTTCTGGAACTCTGATGG - Intergenic
1025582207 7:62734187-62734209 CAGTGTTTCCAGATTTCTGAAGG - Intergenic
1028441493 7:90867823-90867845 CCTTGCTTTTATATTTCTGATGG - Intronic
1028609580 7:92695310-92695332 CATTGCTTCTTGATTTTTGTTGG - Intronic
1029578317 7:101418885-101418907 CCTTGCTTCTTGTACTCTGAAGG + Intronic
1029789110 7:102823967-102823989 CCTTTCTTCTACAATTCTGTGGG - Intronic
1029880953 7:103809145-103809167 CATTGCCTTTCCAATTCTGAGGG + Intronic
1030521309 7:110601537-110601559 CACTGCTTCTAGAAGTCTTTTGG + Intergenic
1031671424 7:124551970-124551992 CATTGCTTTTAGAAGTCAAAGGG - Intergenic
1034143539 7:148847295-148847317 CATTGCTTTTAGAATAATCATGG - Exonic
1035138885 7:156737248-156737270 CAATGCCTTCAGAATTCTGAAGG - Intronic
1035518278 8:255259-255281 CATTCCCTCTAGGATTCTGAGGG - Intergenic
1037270518 8:17124784-17124806 CAATGCTTTCAGAATTCTGAGGG - Intergenic
1038580424 8:28743942-28743964 CAGAACTTCTAGAATTCTGAGGG - Intronic
1041525556 8:58801417-58801439 CATTAATTTTGGAATTCTGATGG + Intergenic
1042265545 8:66905572-66905594 CATTGCTTAAAGAATTCTGGGGG + Intronic
1043135201 8:76514400-76514422 CATTACTTTGATAATTCTGAAGG - Intergenic
1044195310 8:89369518-89369540 CATTTCTTTCAAAATTCTGAAGG + Intergenic
1050232610 9:3543407-3543429 CATTGATTCTAAAATTCATATGG - Intergenic
1050531646 9:6595414-6595436 CATTGCTTCTCAATGTCTGATGG - Intronic
1050854272 9:10331604-10331626 CTATGCTTCTAGAATCCTGTGGG + Intronic
1050878067 9:10666390-10666412 CTTAGCTTCTGGAATCCTGAAGG - Intergenic
1051750119 9:20332455-20332477 CATCCCTACTAGAATTCTCATGG + Intergenic
1052838903 9:33274392-33274414 CATTGCTTTAGAAATTCTGAAGG + Intronic
1053585070 9:39448809-39448831 TATTTCTTCTATATTTCTGAAGG - Intergenic
1054581245 9:66916426-66916448 TATTTCTTCTATATTTCTGAAGG + Intronic
1055442169 9:76347349-76347371 CATTGCTTCTAAGGTTCTGCAGG - Intronic
1056623466 9:88234755-88234777 AATTGTATCTACAATTCTGAGGG + Intergenic
1057523425 9:95778728-95778750 CATAGCTTATAGAATGATGAAGG + Intergenic
1057749030 9:97775675-97775697 CATTGCCTCCAAAATTCTGAAGG + Intergenic
1057757646 9:97850670-97850692 TCATTCTTCTAGAATTCTGATGG - Intergenic
1058763482 9:108159600-108159622 CATTCATTCTTGCATTCTGAGGG - Intergenic
1059215617 9:112559027-112559049 CATTGCTGCTACACTTCTGAAGG - Intronic
1059587838 9:115625390-115625412 CATAGCTTCTAAAATTCTTGTGG - Intergenic
1203786374 EBV:130210-130232 CATGACTTCTAAATTTCTGATGG - Intergenic
1186545058 X:10440611-10440633 TTTTGCTTCATGAATTCTGAAGG + Intergenic
1187017077 X:15340304-15340326 CAATGCTGCTAAACTTCTGAAGG - Intergenic
1187371554 X:18712157-18712179 CATTGATTCTAAAATTCATATGG - Intronic
1187701571 X:21968488-21968510 TATTGCTTCAAGAACTCTTACGG - Intronic
1191274121 X:58517229-58517251 AATTGCTTCTAAAATGCTGTAGG + Intergenic
1192197624 X:69039583-69039605 AATTGGTTCTAAAATTCAGATGG - Intergenic
1192668527 X:73114097-73114119 CAATGCACCTAGAACTCTGATGG - Intergenic
1192726290 X:73756550-73756572 CATTTCTTCTAGAATTTTTATGG + Intergenic
1192985043 X:76389325-76389347 CTTATCTTCTAGAATTCTTATGG + Intergenic
1193082054 X:77415775-77415797 CAATGTTTCTAGAACTATGATGG - Intergenic
1193934402 X:87598833-87598855 CATTTTTTCTAGTCTTCTGATGG - Intronic
1195097521 X:101518103-101518125 CAATGTCTCTAAAATTCTGAAGG + Intronic
1195642990 X:107197845-107197867 CCTCACTTCTAAAATTCTGACGG + Intronic
1196905827 X:120433208-120433230 CATTGCCTCTAGCAATATGAAGG + Intronic
1197159558 X:123308225-123308247 CAGTGCTTCTCAAATTTTGATGG + Intronic
1197511762 X:127378247-127378269 ATTTACTTCTAGAATTCTTATGG - Intergenic
1197869139 X:131049466-131049488 CATTGCATCTAGAATTAGGAAGG + Intergenic
1198268051 X:135029121-135029143 AATTGCTTCTAAAATTCGTAGGG - Intergenic
1198936277 X:141904603-141904625 CAATGCTAATTGAATTCTGAGGG + Intronic
1200743411 Y:6879633-6879655 CTTTTCTTCTAGAATTTTCATGG + Intergenic