ID: 958914454

View in Genome Browser
Species Human (GRCh38)
Location 3:100033257-100033279
Sequence GTTCAAGGATGCAGCCTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 238
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 223}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958914454 Original CRISPR GTTCAAGGATGCAGCCTGCC TGG (reversed) Intronic
900303162 1:1988010-1988032 GGTCAAGGCTGCAGCAAGCCTGG - Intronic
901037339 1:6344181-6344203 GTCCAAAGAGGCAGGCTGCCAGG + Intronic
903636340 1:24820144-24820166 GTTCAAGGTTGCAGTGAGCCAGG - Intronic
905454378 1:38077724-38077746 CTTTAATGATGCAGCCTGACTGG + Intergenic
905912864 1:41665503-41665525 GTTCATGGATGGAGACTGACAGG + Intronic
908192954 1:61722037-61722059 GTTCAAGCAATCTGCCTGCCTGG - Intronic
908265361 1:62373491-62373513 GTTAAAAGATGCAGCCTGTTGGG - Intergenic
909809987 1:79921504-79921526 GTTCCTGGATGCAGCCAGCTTGG + Intergenic
912271808 1:108218391-108218413 GTTCATTGATGCATCCTGTCGGG - Intergenic
915490578 1:156248018-156248040 GTCCAAGGCTGCTGCCAGCCAGG + Exonic
916433702 1:164757208-164757230 GTTCAAGGATGTAACCTGATGGG + Intronic
916983724 1:170167580-170167602 GATCAAGGATACAGCCCTCCCGG - Exonic
917041597 1:170811144-170811166 CTGCAAGGCTGCAGCCTGGCAGG + Intergenic
921203518 1:212828596-212828618 GTTCAAGGCTGTAGTGTGCCAGG - Intergenic
923021516 1:230167739-230167761 GTGCAGGGCTGCAGCCTGGCCGG + Intronic
1063410798 10:5835057-5835079 GGTCGAGGCTGCAGCCAGCCAGG + Intronic
1065542177 10:26781306-26781328 ATTCAAGAATGCAGCCAGTCTGG + Intronic
1068385409 10:56319637-56319659 ATTCAATCATGAAGCCTGCCTGG - Intergenic
1068807046 10:61208485-61208507 GTAAATGAATGCAGCCTGCCTGG + Intergenic
1068838111 10:61578540-61578562 GCTCAAGCAATCAGCCTGCCTGG - Intergenic
1069210065 10:65745554-65745576 GTTCAAGGATGCAGTGAGCTGGG + Intergenic
1069598731 10:69689458-69689480 GTTCAGGCAGACAGCCTGCCTGG + Intronic
1070269085 10:74934482-74934504 TTTAAAGGATGCAGCCGGCATGG - Intronic
1070826329 10:79392332-79392354 GAGCAAGGAAGCAGCCTGCTAGG - Intronic
1071066720 10:81644689-81644711 CTGCAAGGCTGCAGCCTGGCGGG - Intergenic
1071698486 10:87903568-87903590 CTTCAAGGCAGCAGCCTGGCTGG - Intronic
1072196566 10:93121389-93121411 ATTCAAGGAAGCAGAATGCCAGG + Intergenic
1073659087 10:105452813-105452835 TTTAAAGGATGCAGCATGCAAGG - Intergenic
1076202497 10:128569612-128569634 GTGGAAGAATGCAGCCTGCACGG - Intergenic
1076647948 10:131966617-131966639 GTTCAAGGCTGCAGTGAGCCAGG - Exonic
1077537310 11:3130554-3130576 CTCCAAGGATGCAGCCAGGCTGG + Intronic
1080595136 11:33766357-33766379 ATTCAAGGAGGCAGCAGGCCAGG - Intronic
1083148137 11:60773659-60773681 GAGCAAGGAGGCAGCCTGCAGGG + Intronic
1083316174 11:61816190-61816212 GAGCAAGGATGCAGGCCGCCTGG - Intronic
1083615604 11:64024647-64024669 TTGCAAGGATGGAGACTGCCCGG - Intronic
1083889476 11:65588787-65588809 ATTCAAAGATCCAGCCAGCCTGG + Intronic
1084323054 11:68384277-68384299 TTTGAAGGCTGCAGCCTGGCAGG + Intronic
1084444762 11:69197089-69197111 GTTCATGGATCCAGCAGGCCGGG + Intergenic
1084605315 11:70168727-70168749 TTTTAAAAATGCAGCCTGCCAGG - Intronic
1085329376 11:75635165-75635187 CTTCTTGGAGGCAGCCTGCCTGG + Intronic
1085478639 11:76804318-76804340 GTTGAAGGAAGCACGCTGCCTGG + Intergenic
1085516361 11:77114180-77114202 GGTAAAGGATGCAGCCTGGCTGG + Intronic
1087224624 11:95584056-95584078 GTTCAAGGATGCAGTAAGCTAGG + Intergenic
1089405700 11:118195652-118195674 GATCCAGCATGCAGCCTGCCTGG + Intronic
1089432495 11:118436069-118436091 GCTCAAGGCTGCAGGCGGCCCGG + Intergenic
1089767099 11:120775955-120775977 ACTGCAGGATGCAGCCTGCCAGG - Intronic
1091151747 11:133335449-133335471 CTTCATGGATGCAGCCTCCAGGG - Intronic
1091573005 12:1706919-1706941 GTTCAAGGCTGCAGTGGGCCAGG + Intronic
1092705732 12:11282422-11282444 GTTCAAGGATGCTGTAAGCCAGG - Intergenic
1092713782 12:11366715-11366737 GTTCAAGGATGCTGTAAGCCAGG - Intronic
1094482323 12:30894770-30894792 CTGCAAGGCTGCAGCCTGGCGGG - Intergenic
1094713324 12:32986683-32986705 GGTAAAGGATGGTGCCTGCCGGG - Intergenic
1099410091 12:82314584-82314606 CTGCAAGGCTGCAGCCTGGCGGG - Intronic
1101795491 12:107969270-107969292 GATCATGGATGAAGCCAGCCTGG - Intergenic
1104366712 12:128184633-128184655 GTTCAAGTCTGAACCCTGCCTGG + Intergenic
1104371612 12:128228582-128228604 GCCCAAGGATGCAGCTTCCCTGG + Intergenic
1106625706 13:31419064-31419086 ATTCAAGGATGCAATCTGCCTGG + Intergenic
1107942434 13:45386709-45386731 CTTCAAGAATGAAGCCAGCCGGG + Intergenic
1108489904 13:50971126-50971148 GGTCAAGGATGCAGTCACCCAGG - Intronic
1110539316 13:76689972-76689994 GTTGAAGGAGGCAGCCTGCCTGG - Intergenic
1110861452 13:80348866-80348888 GTTCAAGGCTGCAGTGAGCCAGG - Intergenic
1113179168 13:107605923-107605945 TTTCAATGATACAGCCTGGCTGG - Intronic
1113501435 13:110778496-110778518 GTTCAAGGCTGCAGTGAGCCAGG - Intergenic
1114355663 14:21905041-21905063 GCTCAAGGATGCAACTTGCAAGG - Intergenic
1114964372 14:27939355-27939377 CTGCAAGGCTGCAGCCTGGCAGG + Intergenic
1116792737 14:49356988-49357010 CTGCAAGGCTGCAGCCTGGCAGG + Intergenic
1118761703 14:68884237-68884259 GTTGAAGGGTGCAGCCCGCTTGG + Exonic
1118829957 14:69421725-69421747 CTTCAAGGAGGCAGCCTGACTGG - Intronic
1120480256 14:85040519-85040541 GCACAAGGAACCAGCCTGCCTGG - Intergenic
1122384824 14:101337195-101337217 GTTCATGGAGCCAGCCTGCAGGG - Intergenic
1122410753 14:101525085-101525107 GGTCAAGGATGGTGCCTGCGTGG - Intergenic
1122883350 14:104699881-104699903 CTTCCAGGAGGCAGCCTGACAGG - Intronic
1124343163 15:28902964-28902986 TTTCTCAGATGCAGCCTGCCTGG + Intronic
1127243982 15:57151115-57151137 CTGCAAGGATGCACCATGCCTGG + Intronic
1127784220 15:62342043-62342065 GGCCTAGGATGCAGCCTGCCTGG - Intergenic
1130913022 15:88283950-88283972 CTTCCAGGGTGCAGCCTGTCAGG + Intergenic
1131143175 15:89994199-89994221 GTTCAAGGCTGCAGTGAGCCAGG + Intergenic
1131212211 15:90507602-90507624 TTTCAAGGATGCAGTCTGGGTGG + Intergenic
1131330573 15:91495564-91495586 ATTCAAGGGAGCAGCCTTCCCGG - Intergenic
1132945327 16:2529012-2529034 GTGCAGGGATGCAGCCTCCAGGG - Exonic
1133115336 16:3575319-3575341 GTGGAAGGCTCCAGCCTGCCAGG - Intronic
1134186138 16:12086477-12086499 GTTCAAGGCTGCAGTAAGCCAGG - Intronic
1134533959 16:15009674-15009696 GTTCCAGGATGTTGCCTTCCTGG + Exonic
1134776539 16:16858484-16858506 GACCAAGAATGCAGCCTGTCAGG - Intergenic
1135269990 16:21060904-21060926 GTTCAAGGCTGCAGTGAGCCAGG - Intronic
1136011920 16:27369052-27369074 GTTCAAGGCTGCAGTGAGCCGGG - Intergenic
1137231319 16:46570008-46570030 CTTCCAGGATGCCGACTGCCAGG - Intergenic
1138621920 16:58218339-58218361 CTTTAAGGATGCTGCCAGCCAGG + Intergenic
1138851995 16:60640873-60640895 GTTGAGTGATGCAGCCTGTCAGG + Intergenic
1139139490 16:64243976-64243998 TTTGAAGGATGGAGCCTGTCTGG + Intergenic
1139177487 16:64707056-64707078 GTTAAATAATGCAGCATGCCTGG - Intergenic
1139862079 16:70031051-70031073 GTTCCAGGATGTTGCCTTCCTGG - Intergenic
1140825948 16:78706864-78706886 GGTCAAGGCTGCAGCCAGCCAGG - Intronic
1143585299 17:7847743-7847765 GTTGAAGGGTCCGGCCTGCCGGG + Exonic
1143870107 17:9951993-9952015 CTTCAATGATGCATCCTGGCTGG + Intronic
1144490586 17:15704895-15704917 GTTCATGGCTGCGGCCGGCCGGG + Intronic
1146132111 17:30287112-30287134 GTTCAAGGCTGCAGTGGGCCAGG - Intronic
1148429199 17:47628240-47628262 GTTCAAGGCTGCAGTGAGCCAGG - Intergenic
1148910967 17:50942570-50942592 GTTCCCGTGTGCAGCCTGCCTGG + Intergenic
1149520125 17:57312421-57312443 CTTCAAGGCTGCAGGCTCCCTGG + Intronic
1151254129 17:72862424-72862446 GTTCAAGAATGGACCCTGCTTGG + Intronic
1151322712 17:73361328-73361350 CTGGAAGGATGCAGCCTGGCAGG - Intronic
1151430560 17:74059734-74059756 GTTGAAAGAGGCAGCCTTCCTGG + Intergenic
1151732763 17:75920994-75921016 GTTTAAGGAGGCAGCCAGGCCGG - Intronic
1153038305 18:785867-785889 GTTCAAGGCTGCAGTGAGCCAGG + Intronic
1157551391 18:48584089-48584111 GTACAAGGCTGCAGCCAGCTGGG - Intronic
1157856389 18:51109258-51109280 CTTAAAGAAAGCAGCCTGCCAGG - Intergenic
1158354865 18:56607056-56607078 GTTCAAGGCTGCAGCGAGCTAGG - Intronic
1160324397 18:77930055-77930077 GTTCAAGCAATCTGCCTGCCTGG - Intergenic
1164482315 19:28621676-28621698 CTTCCAGGATGCTGACTGCCAGG - Intergenic
1165044540 19:33094377-33094399 GGTCAAGGCTGCAGTATGCCGGG - Intronic
1165104284 19:33459877-33459899 GTGCAAGGCTGAAGCCAGCCAGG + Intronic
1165577306 19:36831511-36831533 GTTCAAGGTTGAGGCCAGCCTGG + Intronic
1165956336 19:39504078-39504100 GCTCAGGGCTGCAGCCTGCTCGG - Exonic
1167510071 19:49891139-49891161 TCTCAGGGGTGCAGCCTGCCTGG - Intronic
1202704921 1_KI270713v1_random:15332-15354 GGTGAAGGAGGCCGCCTGCCTGG - Intergenic
925262473 2:2540555-2540577 GTTCAGGGCTGAAGCCAGCCTGG + Intergenic
930143158 2:47973917-47973939 CTGCAAGGCTGCAGCCTGCTCGG + Intergenic
931583314 2:63800983-63801005 GGTCAAGGATGCAGAGAGCCGGG + Intronic
932038645 2:68274923-68274945 GTTCAAGGTTGCAGTGAGCCAGG - Intergenic
932377556 2:71251145-71251167 CTGCAAGGCTGCAGCCTGGCGGG - Intergenic
932996330 2:76858384-76858406 CTTCTTGGCTGCAGCCTGCCAGG + Intronic
933332417 2:80910660-80910682 GTTAAAGGCTGCAGCATGCAGGG - Intergenic
934730785 2:96655776-96655798 GTTCAAGGCTGCAGTGAGCCGGG - Intergenic
934761037 2:96857438-96857460 TTTAAAGCATGCAGGCTGCCTGG + Intronic
934970918 2:98763338-98763360 GTTCAAGGCTGCAGTGAGCCCGG + Intergenic
935437138 2:103046903-103046925 CTTCAAGGATGCAGCATTCTGGG + Intergenic
935649282 2:105368398-105368420 GTTCAAGGCTGCAGTGAGCCAGG - Intronic
935868013 2:107412674-107412696 GTTCTCGGCTGCAGCTTGCCAGG - Intergenic
937495886 2:122418714-122418736 GTTGAAGAAGGCAGCGTGCCAGG - Intergenic
941589465 2:167401527-167401549 GTTAAAGAAGGCAGCCTGCTAGG - Intergenic
941884587 2:170514989-170515011 GTTCAAGACTGCAGCGAGCCTGG + Exonic
942070315 2:172310185-172310207 GTTCAAGGCTGCAGTGAGCCAGG - Intergenic
944020926 2:195103155-195103177 GTTCAAGGAAGCTGGCTGCATGG + Intergenic
945177089 2:207053648-207053670 TTGCAAGCATGCAGCCTGCAGGG - Intergenic
1169267476 20:4175367-4175389 GTTCCATCATGCATCCTGCCTGG + Intronic
1170987876 20:21274806-21274828 GTCCCAGCATGCAGCCAGCCAGG - Intergenic
1172311649 20:33922902-33922924 GTTCAAGGCTGCAGTGAGCCAGG - Intergenic
1174455229 20:50644049-50644071 GTTCAAGGCTGCAGTGAGCCAGG + Intronic
1174587186 20:51618411-51618433 GCTCAAGAGTGCAGCCTTCCAGG - Intronic
1179251188 21:39673217-39673239 GGTCCTGGATGCAGCCTGCCAGG - Intergenic
1179989789 21:44941694-44941716 GTTCAAGGACGCACCCTACCAGG - Intronic
1181844300 22:25694293-25694315 TTTCCAAGATGCAGCCTGACAGG - Intronic
1182437983 22:30342926-30342948 GTACAAAGAGGCAGCCTTCCTGG + Intronic
1183067790 22:35375482-35375504 TTTGAAGGATGCAGACTACCAGG - Intergenic
1183371308 22:37434007-37434029 GTTTAATAATGCAGGCTGCCGGG - Intergenic
1183802755 22:40181705-40181727 GCTCAAGCAATCAGCCTGCCTGG - Intronic
1184296589 22:43529022-43529044 GGTTAAGGAGGCAGGCTGCCAGG + Intronic
1184523640 22:45009374-45009396 CTTCCAGGCTGGAGCCTGCCCGG - Intronic
949944588 3:9179981-9180003 CTTCCAGGCTGCAGCCTGCGAGG + Intronic
953945683 3:47145461-47145483 GTTCAAGGCTGCAGCAAGCTGGG - Intronic
954503815 3:51049091-51049113 GGTCAAGGAATCTGCCTGCCTGG - Intronic
956093766 3:65694846-65694868 GTTCAAAGAGACAGCCAGCCAGG - Intronic
956373245 3:68586865-68586887 CTGCAAGGCTGCAGCCTGGCAGG - Intergenic
958914454 3:100033257-100033279 GTTCAAGGATGCAGCCTGCCTGG - Intronic
960138990 3:114134159-114134181 GTTCAAGGAAGCAGTCTTCTAGG + Intronic
960565813 3:119130479-119130501 TTGCAAGGCTGCAGCCTGGCGGG + Intronic
960890527 3:122443225-122443247 CTGCAAGGCTGCAGCCTGGCGGG + Intronic
960990045 3:123304330-123304352 GTTCAAGGCTGGAGCCTTGCAGG - Intronic
961744656 3:129056745-129056767 CTTAAAGGATGCAGCATGCCAGG + Intergenic
964716995 3:159732898-159732920 GGTTAAGGCTGCAGCCTTCCAGG - Intronic
966918131 3:184595970-184595992 GAGGAAGGATGCAGCCAGCCGGG + Intronic
967937790 3:194742885-194742907 GTTCAAGGCTGCAGCAAGCTAGG - Intergenic
968608960 4:1548401-1548423 GTCCAGGGAAGCAGCTTGCCGGG + Intergenic
969671783 4:8593669-8593691 GTTCAAGGGTGCAGGGTGTCAGG + Intronic
970387356 4:15568998-15569020 TTTCAAGGAGGCAGCTTGCCAGG - Intronic
970917475 4:21352548-21352570 TTGCAAGGCTGCAGCCTGGCAGG + Intronic
972249285 4:37282532-37282554 GTGCAAGGATTCAGACTGACTGG - Intronic
973013858 4:45110848-45110870 CTTCAAGGCAGCAGCCTGGCAGG - Intergenic
973959036 4:56091119-56091141 GTTCAAGGCTGCAGTGAGCCCGG - Intergenic
974044298 4:56884689-56884711 CTTCAAGGTGGCAGCCTGGCTGG + Intergenic
976477940 4:85506466-85506488 CTGCAAGGCTGCAGCCTGGCTGG - Intronic
977134720 4:93289458-93289480 CTTAAAGGATGCTGGCTGCCTGG + Intronic
978350234 4:107813597-107813619 GTTCAAGGCTGCAGTGAGCCTGG - Intergenic
978394256 4:108261605-108261627 GTGGCAGGATGCATCCTGCCAGG + Intergenic
980908545 4:138973132-138973154 GCTCAAGGATGCAAGCTGACGGG - Intergenic
981702313 4:147620036-147620058 TTTCAAGGAGGGAGCATGCCTGG - Intronic
985768891 5:1796668-1796690 GGTCAAGGATGCTCCCTGCAGGG - Intergenic
987030746 5:13974635-13974657 GTTCAATGTTTCAGCCTCCCTGG - Intergenic
989087277 5:37689107-37689129 CTTCAAGGCGGCAGCCTGGCTGG + Intronic
989119671 5:37991710-37991732 TCTGAAGTATGCAGCCTGCCTGG + Intergenic
990003923 5:50923438-50923460 GTCCAGGGAAGCAGCTTGCCGGG - Intergenic
990050176 5:51488977-51488999 GTTCAAGGATTCAGCCATCTGGG + Intergenic
993308732 5:86301609-86301631 GTTCATTGATGCATCCTGTCGGG + Intergenic
996829458 5:127723733-127723755 GCACAAGGATGCAGCCTCTCAGG + Intergenic
999954575 5:156686544-156686566 GTTCAAGGATGAAGACAGCTGGG - Intronic
1000362661 5:160462296-160462318 GTTGGAGGATGCAGACTGCTTGG - Intergenic
1002291952 5:178205983-178206005 GTTCAAAGATGCAGCCAGTGTGG + Exonic
1003057012 6:2830780-2830802 GTTCAAGGTTGCAGTGAGCCAGG + Intergenic
1003496568 6:6668549-6668571 CTGCAAGGCTGCAGCCTGGCAGG + Intergenic
1006358394 6:33573893-33573915 GTTCAGGGCTGCCACCTGCCGGG + Exonic
1007431278 6:41778962-41778984 GTCCAAGGATGCAGGGTGCAAGG - Intronic
1008198244 6:48553050-48553072 GCTCAAGAAGGCAGCCTGCCTGG + Intergenic
1010194831 6:73228780-73228802 CTTCAAGTATTCTGCCTGCCTGG + Intronic
1010664125 6:78607062-78607084 TCTCAAGCTTGCAGCCTGCCTGG - Intergenic
1011847996 6:91590356-91590378 CTGCAAGGCAGCAGCCTGCCTGG + Intergenic
1012606683 6:101166949-101166971 GTTCAAGGCTGCAGTGAGCCAGG - Intergenic
1013043797 6:106463083-106463105 GTTCAAGGTTGCAGTCAGCTAGG + Intergenic
1015502657 6:133950483-133950505 GTTCAAGGAAGCATCCAGCATGG - Intergenic
1018911949 6:168106365-168106387 GAGCAAGGGTGCCGCCTGCCTGG - Intergenic
1019301313 7:305437-305459 GTTCAAGGAGGCACTCGGCCTGG + Intergenic
1019324900 7:433256-433278 CTGCTAGGATGCAGCCCGCCCGG + Intergenic
1020344166 7:7145340-7145362 CTGCAAGGAGGCAGCCTGGCTGG - Intergenic
1020774141 7:12432072-12432094 CTGCAAGGCTGCAGCCTGGCTGG - Intergenic
1021077189 7:16319458-16319480 GATCAAGGAAGCAGACTGCACGG - Intronic
1021829166 7:24586120-24586142 GTTCATGGATGATGCCTGACTGG - Intronic
1023274540 7:38503527-38503549 GTTCAAGCATCCATCTTGCCAGG + Intronic
1023529330 7:41136674-41136696 GTTCAGGAAGGCAGGCTGCCGGG - Intergenic
1023966458 7:44965404-44965426 GTCCAGGGCTGCAGCCTGCAGGG - Intronic
1025033314 7:55574369-55574391 GCTCAAGGAAACAGCCTGGCTGG - Intergenic
1025873744 7:65460654-65460676 GGTCAAGGCTGCAGCAAGCCAGG + Intergenic
1025943782 7:66091489-66091511 GCTCAAGGATGCAGAGAGCCAGG + Intronic
1030241389 7:107329824-107329846 GTTCAAGGCTGCAGTGAGCCAGG + Intronic
1030585308 7:111411550-111411572 GTTGAAGGATGGTGCCTGCTGGG - Intronic
1032121712 7:129161830-129161852 GCTAAAGGAGGCAGCCTCCCTGG + Intronic
1037801213 8:22036952-22036974 GTTCAAGGCTGCCCTCTGCCGGG - Intergenic
1037843788 8:22264487-22264509 GTTCCAGGCTGCAGTCAGCCAGG + Intergenic
1040918432 8:52587831-52587853 GTTCAAGGCTGCAGTGAGCCAGG - Intergenic
1041224364 8:55684014-55684036 GTTCAAGGCTGCAGTGAGCCAGG + Intergenic
1041909863 8:63077581-63077603 CTTCAAGGCGGCAGCCTGGCTGG + Intronic
1042610048 8:70588519-70588541 GTTCAAGGATGCAGTGAGCTAGG + Intronic
1052934693 9:34083221-34083243 GTTTAAGGCTGCAGCGCGCCAGG - Intergenic
1053285469 9:36847299-36847321 GTTCAAGGCTGCAGACTGCTTGG + Intronic
1057497256 9:95571109-95571131 GTGAAAGAACGCAGCCTGCCGGG + Intergenic
1057739113 9:97696818-97696840 GTTTAGGGATGCAGCCGCCCCGG - Intronic
1059400753 9:114069624-114069646 GATCAAGTGTGCAGCGTGCCTGG + Intronic
1060465047 9:123896241-123896263 GTTCAAGGCTGCAGTCAGCCAGG + Intronic
1060668352 9:125447097-125447119 GTTCAAATATGCAGCCTTTCAGG - Intronic
1060828642 9:126700470-126700492 GCTCAAGGATGGAGCCAGGCAGG - Exonic
1061924284 9:133798348-133798370 CTTCAGGGATGCAGGCAGCCAGG + Intronic
1203778323 EBV:86412-86434 TATCAGGGATGCTGCCTGCCGGG + Intergenic
1188428044 X:30072387-30072409 GTTCAAGGCTGCAATGTGCCAGG + Intergenic
1189332640 X:40153022-40153044 GTTCCAGCGAGCAGCCTGCCCGG + Intronic
1189463140 X:41258635-41258657 GGTCAAGGTTCCAGCCTTCCTGG - Intergenic
1189729494 X:44004214-44004236 GTTCCAGGAAGCAGCATCCCAGG + Intergenic
1189929083 X:45988859-45988881 ACTGAAGGATGCAGCCTGCAAGG - Intergenic
1191645668 X:63478414-63478436 CTTCAAGGCGGCAGCCTGGCTGG + Intergenic
1192395897 X:70780728-70780750 CTGCAAGGCTGCAGCCTGGCTGG + Intronic