ID: 958918947

View in Genome Browser
Species Human (GRCh38)
Location 3:100081206-100081228
Sequence GTGAAGATTAGAAGGACTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 186}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958918947 Original CRISPR GTGAAGATTAGAAGGACTCT TGG (reversed) Intronic
902438335 1:16412398-16412420 GAAAAGAATAAAAGGACTCTAGG - Intronic
903323311 1:22555370-22555392 GTGAAGATTAAAAGGATGCCTGG - Intergenic
905401096 1:37703879-37703901 GTGATGACTAGGAGGCCTCTAGG + Intronic
906444326 1:45881745-45881767 GTGTAGATTACAGGCACTCTAGG - Intronic
907598890 1:55746795-55746817 GTGAATATTAGAAGGACCCTAGG - Intergenic
907706158 1:56834542-56834564 CTGAAGATTACCAGGACTCTGGG + Intergenic
909489351 1:76208961-76208983 ATGAAGATTAGAAGGTTTCTGGG - Intronic
909722659 1:78794659-78794681 GGGCAGATTTGAAGGACTCAGGG + Intergenic
911791156 1:102016512-102016534 GAGAAAATTAGGAGTACTCTTGG + Intergenic
915766237 1:158365462-158365484 GTGGAGATTTGAAGGGCTATTGG - Intergenic
916163823 1:161946320-161946342 GTGAATATTAGGAGGAGCCTGGG + Intronic
916504627 1:165416926-165416948 GTGGAGATTAGGATGACTTTGGG + Intronic
916749481 1:167711642-167711664 GAGATGATTAGAATAACTCTGGG - Intergenic
919371832 1:196738322-196738344 GTTAAGATTTGGAGGACTGTTGG - Intronic
920238580 1:204526992-204527014 GTAAAGATTAAAAAGACACTGGG + Intronic
920521729 1:206632584-206632606 ATGATGATTAGAAAGACTCCTGG + Intergenic
922244440 1:223781471-223781493 GTGAAGGTTGCAAGGCCTCTAGG + Intronic
924593002 1:245421296-245421318 TTGGAGAAGAGAAGGACTCTGGG + Intronic
1063436666 10:6037504-6037526 GTGAAGATTAGAATAACGCACGG + Intronic
1065192060 10:23221545-23221567 GTGAAGATTAGCAATAATCTTGG + Intronic
1067900352 10:50234170-50234192 GTGGATGTTTGAAGGACTCTGGG - Intronic
1068352293 10:55862904-55862926 GTGGAGATTATAAGGATTATGGG - Intergenic
1073135145 10:101216141-101216163 GTGGAGCTTGAAAGGACTCTGGG + Intergenic
1080930306 11:36803160-36803182 GTGATCATTAGAAGGACTGTTGG + Intergenic
1082286523 11:50323567-50323589 GTTAAGATTGGAAGGGATCTGGG + Intergenic
1090536002 11:127642439-127642461 GTGAAGAGTAGAAGGAATGAGGG - Intergenic
1096426677 12:51509886-51509908 GTGAAGATGGGAAGGAATTTGGG + Exonic
1099846961 12:88039374-88039396 CTGAAGAGTAGATTGACTCTTGG + Intronic
1100106000 12:91173174-91173196 GTTAAGATTAGAGGGTCTCATGG + Intronic
1100331449 12:93586175-93586197 GTGAAGATCAGAAGAACTTCCGG - Intergenic
1101529378 12:105560162-105560184 CTGAAAAATAGAAGGACTCTAGG + Intergenic
1101698086 12:107145560-107145582 GAGAAGATTAGAGGGATTCATGG - Intergenic
1105258451 13:18760759-18760781 GTTAAGATTTGGGGGACTCTAGG - Intergenic
1105259330 13:18767157-18767179 GTTAAGATTTGAGAGACTCTAGG - Intergenic
1105261120 13:18780060-18780082 GTTAAGATTTGGGGGACTCTAGG - Intergenic
1105264370 13:18803063-18803085 GTTAAGATTTGAGAGACTCTAGG - Intergenic
1105638459 13:22239083-22239105 CAGAACATTAGAAGGACTCTAGG - Intergenic
1109637344 13:65139599-65139621 TTGAAGATTATATTGACTCTTGG + Intergenic
1110973495 13:81798655-81798677 GAGAGGATTAGAAAGAGTCTGGG - Intergenic
1110978383 13:81867755-81867777 AGGAAGATTAGAAAGACTCAAGG - Intergenic
1111417943 13:87974408-87974430 GTAAAGATTTGAAAGAATCTAGG - Intergenic
1111487168 13:88919101-88919123 GTGGGGATTAGAAGGATTATGGG - Intergenic
1111788050 13:92816238-92816260 GTGACAATTAGAAGGGCTATTGG + Intronic
1111933963 13:94540391-94540413 GTAAAGATGAGAAAGACTGTGGG + Intergenic
1112682599 13:101784255-101784277 GTTAAGATCAGAAGGTCTATTGG - Intronic
1113094283 13:106647247-106647269 GTGAAGATCTGAAAGAATCTTGG + Intergenic
1113826682 13:113260685-113260707 ATGAAGATGAGAAAGACTCTTGG + Exonic
1115720511 14:36156107-36156129 GTGAAGATTATATGGTCTGTGGG + Intergenic
1116573364 14:46545558-46545580 AGGAAGATTAGAAAGACTCAGGG - Intergenic
1117470535 14:56039921-56039943 TTGGAGATTCTAAGGACTCTAGG + Intergenic
1117722736 14:58643328-58643350 ATGAAGATTAGAATTGCTCTGGG + Intronic
1118331448 14:64818760-64818782 GTGACAATTAGGGGGACTCTAGG + Intronic
1202834070 14_GL000009v2_random:64950-64972 GTTAAGATTTGAGAGACTCTAGG + Intergenic
1124349682 15:28945899-28945921 GTGATGAGGAGGAGGACTCTGGG + Intronic
1127711239 15:61600317-61600339 GTGAAACTTACAGGGACTCTTGG + Intergenic
1128432139 15:67606751-67606773 ATGAAAATTAGAAGGACTGATGG + Intronic
1128761794 15:70221398-70221420 GTGAAGGCTAGAAGGCCACTTGG - Intergenic
1128885441 15:71282710-71282732 CTGAAGATTAGATAGAATCTGGG - Intronic
1131094407 15:89646650-89646672 GCCAAGATTTGAATGACTCTGGG - Intronic
1131357177 15:91755982-91756004 GTGATGAGTAGCAGGAGTCTGGG - Intergenic
1134059292 16:11189236-11189258 GTGTAGCTTTGAAGGCCTCTGGG - Intergenic
1138119662 16:54389464-54389486 GTGATGATTGTAAGCACTCTAGG - Intergenic
1138804848 16:60080450-60080472 AGGAAGATTAGAAAGACTCAGGG - Intergenic
1139702303 16:68715531-68715553 GAGAAGATGAGCAGGACTCCAGG - Intronic
1141303145 16:82836798-82836820 ATGCAGATTAGAATGACTATGGG - Intronic
1142491034 17:279788-279810 CTGAAGATTAGAAGGACCTCAGG + Intronic
1143347447 17:6260375-6260397 GTGAAGATTAGATGGGGTCATGG + Intergenic
1144842623 17:18197504-18197526 GGGAAGATGAGAGGAACTCTTGG - Intronic
1146801564 17:35827868-35827890 GTGAAGATTATAGGGACTACAGG + Intronic
1146935731 17:36811580-36811602 GTGAGGAATGGAAGGACACTGGG - Intergenic
1147266961 17:39240210-39240232 GGGAAAATAAGAATGACTCTCGG + Intergenic
1150225858 17:63524058-63524080 GGAAAGATCATAAGGACTCTTGG - Intronic
1151273000 17:73011348-73011370 GGCCAGATCAGAAGGACTCTGGG + Intronic
1151768038 17:76142082-76142104 ATTAAGAGTAGAGGGACTCTGGG + Intergenic
1154424025 18:14258499-14258521 GTTAAGATTTGAGAGACTCTAGG + Intergenic
1154429425 18:14297231-14297253 GTTAAGATTTGAGAGACTCTAGG + Intergenic
1154431698 18:14313579-14313601 GTTAAGATTTGAGAGACTCTAGG + Intergenic
1155164857 18:23223902-23223924 GTAATGATTAGTGGGACTCTGGG - Intronic
1158008952 18:52706548-52706570 GTGAAGATTAGAATGGAACTTGG - Intronic
1158883763 18:61806031-61806053 GTGAACATTTCATGGACTCTTGG - Intergenic
1163487183 19:17595012-17595034 AGGAAGATTAGAAAGACTCAGGG - Intergenic
1166274510 19:41743148-41743170 GTGAGGTCTAGAAGGTCTCTTGG + Intronic
1166774065 19:45301999-45302021 GTGAAGATGACAAGGGCTCCAGG - Intronic
1167982091 19:53283877-53283899 GTGAAGATGAGAAGCAAGCTAGG - Intergenic
1167984055 19:53300096-53300118 GTGAAGATGAGAAGCAAGCTAGG + Intergenic
1167987479 19:53331067-53331089 GAGAAGATTACCAGGAGTCTCGG - Intergenic
1202637706 1_KI270706v1_random:56305-56327 GTTAAGATTTGGGGGACTCTAGG - Intergenic
1202638610 1_KI270706v1_random:62742-62764 GTTAAGATTTGAGAGACTCTAGG - Intergenic
928877543 2:36057681-36057703 GTAAAGCTTAGAAGGAATGTGGG + Intergenic
930744833 2:54871376-54871398 TTGGAGAATAGAAGGACCCTAGG - Intronic
931711599 2:64992630-64992652 GAAGAGATTAGAAGGACTGTGGG + Intronic
932872721 2:75419539-75419561 GTGAAGATTAGTAGGAGCTTAGG + Intergenic
932994233 2:76829476-76829498 GTGCAGATTATAAGAGCTCTGGG - Intronic
935868265 2:107416063-107416085 GTGAAGGTTAGGTGGACTTTTGG - Intergenic
941803131 2:169683556-169683578 ATTAAGTTTAGAATGACTCTTGG - Intronic
944297261 2:198080464-198080486 GTGAAGCTTAGAAGGAGATTTGG + Intronic
944989266 2:205216902-205216924 GTGAAGAGGAGAAGGAGCCTAGG - Intronic
946957914 2:224952297-224952319 GTGTAGATGAGAAAGACACTTGG + Intronic
1169336351 20:4760311-4760333 GTGCAGATTAGAAGGGATCATGG - Intergenic
1171342720 20:24443317-24443339 GGGAAGATGAGCAGGACTCTTGG + Intergenic
1171884282 20:30640397-30640419 GTTAAGATTTGGGGGACTCTAGG - Intergenic
1171885190 20:30646804-30646826 GTTAAGATTTGAGAGACTCTAGG - Intergenic
1173365630 20:42382253-42382275 TTGAAGTTTTGATGGACTCTGGG + Intronic
1173401535 20:42730465-42730487 GTGAAAATGAGAAAGTCTCTTGG - Intronic
1174187826 20:48719627-48719649 CAGAATAATAGAAGGACTCTGGG + Intronic
1176848067 21:13891740-13891762 GTTAAGATTTGAGAGACTCTAGG - Intergenic
1176849445 21:13901501-13901523 GTTAAGATTTGAGAGACTCTAGG - Intergenic
1180363356 22:11919146-11919168 GTTAAGATTTGAGAGACTCTAGG + Intergenic
1182916174 22:34034257-34034279 GTGAAGATTATAAAAACTCTGGG - Intergenic
949690398 3:6630353-6630375 GTGAAGATTAAAATTACTTTTGG - Intergenic
952787523 3:37170571-37170593 GTTAAGATCAAAAGGACTCTTGG - Intronic
955995709 3:64678549-64678571 GTGACCTTTAGAAGTACTCTGGG - Intronic
956709121 3:72024594-72024616 AGGAAGATTAGAAAGACTCAGGG - Intergenic
957024437 3:75165547-75165569 GAGATGCTTAGTAGGACTCTAGG + Intergenic
958918947 3:100081206-100081228 GTGAAGATTAGAAGGACTCTTGG - Intronic
959485864 3:106926807-106926829 AGGAAGATTAGAAAGACTCAGGG + Intergenic
959512002 3:107224377-107224399 GTACAGATTATAAGTACTCTAGG + Intergenic
960010660 3:112831421-112831443 GTGAAGAATACAATGACTATTGG + Intronic
960071579 3:113437110-113437132 CTGGAACTTAGAAGGACTCTTGG - Intronic
962381946 3:134905192-134905214 GAGAAGATTGGATGGACACTGGG + Intronic
962723753 3:138201409-138201431 GGGAAGAAGACAAGGACTCTAGG - Intronic
963456761 3:145555267-145555289 AGGAAGATTAGAAAGACTCAGGG + Intergenic
963641778 3:147869202-147869224 TTGAAGATGAGAATGACTTTTGG + Intergenic
964436781 3:156661434-156661456 GTGATCATTAGAAAGACTCTAGG + Intergenic
964920123 3:161885849-161885871 GTTAAGATTTGGAGGACTATTGG + Intergenic
967584967 3:191201918-191201940 ATGAAGATCAGAAGTAATCTGGG - Intronic
971317042 4:25576268-25576290 GAGAAGAGTTCAAGGACTCTGGG - Intergenic
971403293 4:26296101-26296123 GTGGAGTTTAGAGGGACTATTGG + Intronic
973330185 4:48905056-48905078 GTGGAGGGTAGATGGACTCTGGG + Intronic
973367948 4:49222670-49222692 GTTAAGATTTGGGGGACTCTAGG - Intergenic
973368846 4:49229071-49229093 GTTAAGATTTGAGAGACTCTAGG - Intergenic
973392199 4:49566344-49566366 GTTAAGATTTGAGAGACTCTAGG + Intergenic
973393106 4:49572756-49572778 GTTAAGATTTGGGGGACTCTAGG + Intergenic
976499422 4:85770389-85770411 GTGAACAATAGGAGGACTATTGG - Intronic
978402434 4:108344857-108344879 ATGCAGATCAGAAGGACTCCTGG + Intergenic
980968586 4:139547693-139547715 TTTAAGGTGAGAAGGACTCTGGG - Intronic
982094325 4:151907473-151907495 GTGTAGATTAGAAAGACTGCTGG + Intergenic
982181852 4:152755090-152755112 GTGAAGATTACATGCACACTTGG + Intronic
983466513 4:168099667-168099689 GTGAATACTAGAATGACTGTGGG + Intronic
984322090 4:178208750-178208772 AGGAAGATTAGAAAGACTCAGGG - Intergenic
985389972 4:189483559-189483581 AGGAAGATTAGAAAGACTCAGGG + Intergenic
1202765026 4_GL000008v2_random:142162-142184 GTTAAGATTTGGGGGACTCTAGG - Intergenic
1202765949 4_GL000008v2_random:148601-148623 GTTAAGATTTGAGAGACTCTAGG - Intergenic
986919683 5:12666635-12666657 AGGAAGATTAGAAAGACTCAGGG + Intergenic
988538368 5:32088280-32088302 GGGAAGATGAGCAGGACTCGAGG - Exonic
989555549 5:42790662-42790684 GAGAAGAAAAGAAGGAATCTTGG + Intronic
989761819 5:45024434-45024456 GTGGAGATTACAAGGATTTTAGG + Intergenic
991959038 5:72023172-72023194 GAGATGATTTCAAGGACTCTGGG - Intergenic
992658409 5:78933418-78933440 GTGAAGATAAGAACAACTTTGGG - Intronic
994272589 5:97798588-97798610 GGGAAGATTAAAAGGAGTGTGGG - Intergenic
994926185 5:106120193-106120215 GTGAAGATGAGAGGGACTGAGGG + Intergenic
995804714 5:116038637-116038659 GTGGAGATTAAAAAGACTCAAGG + Intronic
996726491 5:126677284-126677306 GTGAACATAAGAAGTACCCTGGG + Intergenic
997788283 5:136733718-136733740 GTGAGGGTTACATGGACTCTGGG + Intergenic
998553113 5:143096717-143096739 GTGAAGAATACAATGACTATTGG + Intronic
1000094105 5:157955857-157955879 GAGAAGAGTAAAAGGACTCTAGG + Intergenic
1000984043 5:167847589-167847611 GTGAAGGTATGAAGGAATCTAGG - Intronic
1002047111 5:176548382-176548404 GTGAGGATAAGAAGGACTTGTGG + Intronic
1003572959 6:7268059-7268081 GTGAAGGTAAGAAGGACACAGGG - Intergenic
1004767122 6:18741942-18741964 GAGAAGATGAGAATGAGTCTTGG - Intergenic
1004832238 6:19489760-19489782 TTGAAGATTACAAGGATTTTAGG - Intergenic
1005014752 6:21365588-21365610 AGGAAGATTAGAAAGACTCAGGG + Intergenic
1006077680 6:31544741-31544763 TTGGAGATCAGAAGGTCTCTGGG + Exonic
1008534262 6:52495100-52495122 GGGAAGATCAGAAGGAGCCTTGG - Exonic
1012842992 6:104353860-104353882 GTGAAGATTATATGGTCTATGGG - Intergenic
1014053821 6:116989575-116989597 GTGAAAAATAGAAAGACCCTAGG + Intergenic
1014548993 6:122766697-122766719 GTGAACATTAGAAGCATTCCTGG + Intergenic
1015344140 6:132135747-132135769 GTGAATATTAGAAAGAGTCATGG + Intergenic
1016650387 6:146454497-146454519 AGGAAGATTAGAAAGACTCAGGG + Intergenic
1018576264 6:165263184-165263206 GTAAAGATGGGAGGGACTCTGGG + Intergenic
1023989141 7:45117762-45117784 GTGCAGGTGAGAAGGCCTCTGGG + Intergenic
1025120482 7:56297496-56297518 GGGTGGAGTAGAAGGACTCTTGG - Intergenic
1028387568 7:90274862-90274884 GAGAAGATTTGGAGAACTCTTGG + Intronic
1031467838 7:122135365-122135387 GTGAAGGTGAGCTGGACTCTAGG - Intronic
1031842440 7:126760265-126760287 ATGAAGTTGAGTAGGACTCTAGG + Intronic
1032617594 7:133491722-133491744 GTGAATATTAGAAGTACTTTGGG + Intronic
1032949764 7:136894023-136894045 GTGAATAATACTAGGACTCTAGG - Intronic
1033777873 7:144633085-144633107 GTGCAGATTATAAGGATTATGGG + Intronic
1033826339 7:145194758-145194780 AGGAAGATTTGAAGGACTCTAGG + Intergenic
1038426286 8:27466037-27466059 GTGGAAACTAGAAGGACCCTGGG + Intronic
1040102568 8:43518653-43518675 GTTAAGATTTGGAGGACTGTAGG + Intergenic
1040596070 8:48839029-48839051 ATGAAGATTTGGAGGGCTCTGGG + Intergenic
1042789686 8:72590136-72590158 TTGAAGAGTAAAATGACTCTGGG - Intronic
1043199204 8:77341689-77341711 GTGAAGATTATATGGCCTTTTGG + Intergenic
1048570548 8:135651355-135651377 GTGAAGATTAGAAGCATGCCTGG + Intronic
1052454120 9:28672191-28672213 GTGCAGAATAGTAGGACACTAGG + Intergenic
1056766972 9:89450406-89450428 GTGAAGATGAGAAGAAGGCTTGG + Intronic
1058612306 9:106789799-106789821 AGGAAGATTAGAAAGACTCAGGG - Intergenic
1059117449 9:111612424-111612446 CAGAAGGTTAGAAGGACTCTGGG + Intergenic
1059849177 9:118318063-118318085 GTGATGATCAGAGGGACTATGGG - Intergenic
1060865478 9:126991895-126991917 GTCAAGCTGAGAAGGGCTCTGGG + Intronic
1062072727 9:134566538-134566560 GTGAAGGTCAGGAGGACCCTAGG - Intergenic
1203546700 Un_KI270743v1:133490-133512 GTTAAGATTTGAGAGACTCTAGG - Intergenic
1185535193 X:855479-855501 GTGAAGATTTGCACCACTCTAGG - Intergenic
1186652847 X:11579569-11579591 CTGAAGGTAAGAAGGACTATGGG - Intronic
1186936249 X:14452823-14452845 GTGCAGATTAGAAAGAATCCAGG - Intergenic
1188607217 X:32046059-32046081 GTGGACATTAGAAAGTCTCTTGG + Intronic
1192952544 X:76032590-76032612 GTGAAAATAAGAAGGAACCTAGG + Intergenic
1195393306 X:104385524-104385546 GGAAAGATTAGGATGACTCTTGG + Intergenic
1195752317 X:108171316-108171338 CTGAGGATTAGAAGGAATTTTGG - Intronic
1198160630 X:134004455-134004477 GTGCAGACTAGAAGGATTATCGG + Intergenic
1202029953 Y:20561069-20561091 GTTAACACTAGAAAGACTCTTGG - Intergenic