ID: 958921907

View in Genome Browser
Species Human (GRCh38)
Location 3:100116519-100116541
Sequence CCTCCATCCATTATGGAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 240
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 228}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958921904_958921907 -6 Left 958921904 3:100116502-100116524 CCATATCTTCAAGAAGACCTCCA 0: 1
1: 0
2: 1
3: 12
4: 196
Right 958921907 3:100116519-100116541 CCTCCATCCATTATGGAAAATGG 0: 1
1: 0
2: 0
3: 11
4: 228
958921903_958921907 10 Left 958921903 3:100116486-100116508 CCAACTCTGGAATTAGCCATATC 0: 1
1: 0
2: 7
3: 45
4: 221
Right 958921907 3:100116519-100116541 CCTCCATCCATTATGGAAAATGG 0: 1
1: 0
2: 0
3: 11
4: 228
958921902_958921907 11 Left 958921902 3:100116485-100116507 CCCAACTCTGGAATTAGCCATAT 0: 1
1: 1
2: 4
3: 42
4: 288
Right 958921907 3:100116519-100116541 CCTCCATCCATTATGGAAAATGG 0: 1
1: 0
2: 0
3: 11
4: 228

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958921907 Original CRISPR CCTCCATCCATTATGGAAAA TGG Intronic
901275182 1:7985846-7985868 ACTCTTTCCATAATGGAAAAAGG - Intergenic
902404058 1:16173555-16173577 CCTCCCTCCTTCATGGGAAATGG + Intergenic
904789432 1:33007557-33007579 CCTCCAGCCTTTCTGGAATACGG + Intergenic
908141699 1:61191718-61191740 CCTACATCCATCATACAAAATGG + Intronic
909660592 1:78077438-78077460 ACTCCATCAGTTATGGAAATAGG + Intronic
910142433 1:84040501-84040523 CCTACTTTCATTATGGAAGATGG + Intergenic
910927764 1:92413724-92413746 CCTCCATCCTTCTTGGAACATGG + Intergenic
913543143 1:119841165-119841187 CCTCCTTCCTTAATGGAAATTGG - Intergenic
916006778 1:160669092-160669114 GTTCAATCCATTATTGAAAATGG + Intergenic
917062331 1:171054917-171054939 AGTACAGCCATTATGGAAAATGG + Intronic
918386072 1:184009350-184009372 CTTCAATCCTTTTTGGAAAAGGG + Intronic
918452623 1:184674266-184674288 AATACAGCCATTATGGAAAACGG - Intergenic
919559945 1:199104920-199104942 TGTCAATCCATTATAGAAAATGG + Intergenic
924404069 1:243723592-243723614 CCACCAACCCCTATGGAAAATGG + Intronic
924564860 1:245188810-245188832 CATCCATCCATGATGGACACTGG - Intronic
1063403400 10:5769794-5769816 GGTCCAGCCACTATGGAAAATGG + Intronic
1064127745 10:12678558-12678580 GTTCCATCCATTATTGAAAGTGG + Intronic
1068155761 10:53196050-53196072 ATTACAGCCATTATGGAAAAGGG - Intergenic
1069202329 10:65635743-65635765 CATCCATCCATTGCTGAAAAGGG - Intergenic
1070099805 10:73374202-73374224 CTTCTATCCATTATTGAGAATGG - Intergenic
1070936499 10:80301908-80301930 GTTCTATCCATTATTGAAAATGG - Intergenic
1071727908 10:88218373-88218395 CCGCCCACCATTGTGGAAAAGGG - Intergenic
1071971356 10:90911067-90911089 AGTTCATCCATTGTGGAAAATGG + Intergenic
1073685427 10:105747319-105747341 TGTGCAGCCATTATGGAAAACGG + Intergenic
1074152339 10:110768408-110768430 CTTCCACCCATTTTGGGAAAGGG + Intronic
1074418930 10:113292316-113292338 CAACCATCCATTATGTAATAGGG + Intergenic
1076436500 10:130448630-130448652 CGTACAGCCTTTATGGAAAATGG - Intergenic
1078306357 11:10191503-10191525 TTGCGATCCATTATGGAAAAAGG + Intronic
1079025884 11:16947255-16947277 CGTACAGCCATTATTGAAAATGG + Intronic
1079974763 11:27077226-27077248 CCTCCATCCATGCTGGAGACTGG + Intronic
1081272743 11:41106733-41106755 CCGCCAACCATTTTGGATAAGGG - Intronic
1084452923 11:69250752-69250774 CCTCCATCCTGAATGAAAAAGGG - Intergenic
1087688251 11:101289663-101289685 GTTCCATCCATTATCGAAAGTGG + Intergenic
1087905452 11:103691297-103691319 ATTCTATCCATTATTGAAAATGG + Intergenic
1088185412 11:107162053-107162075 AGTACATCCATTATGGAAAATGG + Intergenic
1089978171 11:122750671-122750693 CTTCAATGCATTATGAAAAATGG - Intronic
1089993311 11:122882302-122882324 CAACCAACCATTTTGGAAAATGG - Intergenic
1091363210 11:134994622-134994644 CCTCCCTCCTTTGTGAAAAAGGG - Intergenic
1092305654 12:7298092-7298114 CCTCAATTCATTATGCCAAAAGG - Intergenic
1093681114 12:22004572-22004594 ACTACAACCAGTATGGAAAACGG - Intergenic
1093761072 12:22911618-22911640 AGTACAGCCATTATGGAAAATGG + Intergenic
1094038602 12:26098468-26098490 AGTACAGCCATTATGGAAAATGG + Intergenic
1095459534 12:42428173-42428195 AGTACAGCCATTATGGAAAACGG + Intronic
1096921241 12:55087998-55088020 CCCCCATCTATTCTGGAAATGGG + Intergenic
1097570795 12:61328615-61328637 CCTCCATCTATGTTTGAAAATGG + Intergenic
1097698589 12:62798453-62798475 CCCCAATCCACTATGGAAATTGG - Intronic
1097889835 12:64766613-64766635 ACTCTATCCATTATTGAAAGTGG - Intergenic
1097953756 12:65462231-65462253 GCCCCATCCCTGATGGAAAAGGG + Intronic
1098107579 12:67085824-67085846 CCAGCATTCATTTTGGAAAAAGG - Intergenic
1100190028 12:92180405-92180427 CCTCCTTCCCCTATGAAAAAGGG + Intergenic
1100304380 12:93337219-93337241 CCTCCAGCCATGATGGAAGTGGG - Intergenic
1103235850 12:119371842-119371864 CCTACATCCATTATTAAAAGGGG + Intronic
1103271699 12:119678931-119678953 AGTACAACCATTATGGAAAATGG - Intronic
1106385045 13:29276493-29276515 CCTTCATCCTTTGGGGAAAATGG + Intronic
1106987875 13:35376947-35376969 CCTCCTTCCATACTGGTAAAAGG + Intronic
1108136228 13:47365393-47365415 GTTCTATCCATTATTGAAAATGG + Intergenic
1111407774 13:87832283-87832305 GCTGCATCCATAATGGAAGAGGG + Intergenic
1111972910 13:94935642-94935664 AGTACAGCCATTATGGAAAATGG - Intergenic
1115587287 14:34827342-34827364 GTTCCATCCATTATGGAAGATGG + Intronic
1115826170 14:37280396-37280418 ACTACAGCCATTTTGGAAAACGG - Intronic
1116500084 14:45610328-45610350 TCTCCATCCACCAAGGAAAATGG + Intergenic
1117219822 14:53591932-53591954 CTTCCTGCCACTATGGAAAAAGG + Intergenic
1118149243 14:63171699-63171721 AATACAACCATTATGGAAAATGG + Intergenic
1118425460 14:65655706-65655728 CTTCCATCAATTATTGAAAGAGG - Intronic
1119056389 14:71425769-71425791 GTTCCATCCATTATTGAGAATGG + Intronic
1119622206 14:76139445-76139467 CCTCCAACCCATCTGGAAAATGG - Intergenic
1120369762 14:83617931-83617953 ACTCAATACATGATGGAAAATGG - Intergenic
1122522177 14:102352549-102352571 CCTCTATCCGTTATAGAGAATGG - Intronic
1123214400 14:106792914-106792936 GCCCCATCCATCATGGATAACGG + Intergenic
1124213036 15:27779333-27779355 GTTCCATCTATTATTGAAAATGG + Intronic
1124782914 15:32652583-32652605 CCTTCCTCCATTGGGGAAAAAGG + Intronic
1125136179 15:36345883-36345905 CATCCTTACATTATGGAACATGG - Intergenic
1126217072 15:46168102-46168124 GGTGCAGCCATTATGGAAAATGG - Intergenic
1127366005 15:58291145-58291167 AGTCTATCCATTCTGGAAAAGGG + Intronic
1128346503 15:66856176-66856198 CCTCCTTTCACTTTGGAAAATGG - Intergenic
1129157446 15:73727688-73727710 GCTCCCTTCATTATAGAAAAGGG - Intergenic
1130442956 15:83973789-83973811 ACTCCATCCATTATGGAAGGGGG + Intronic
1131444334 15:92484180-92484202 AGTACATCCATTATGGAAAACGG + Intronic
1131911102 15:97202973-97202995 GATCCATCCATTATTAAAAATGG - Intergenic
1137353981 16:47740349-47740371 GTTCTATCCATTATTGAAAATGG - Intergenic
1138216429 16:55208756-55208778 CCTCCTTCCTTGATGGAACAAGG - Intergenic
1138364850 16:56466666-56466688 CATCCATCTATTATTGAGAAGGG - Intronic
1139178942 16:64723090-64723112 CCTTCAACCATTAGGGATAATGG - Intergenic
1139406018 16:66718251-66718273 CTTCCATCCATCATGGCAAGGGG + Intergenic
1144694157 17:17290198-17290220 CCTCCAGACAATAGGGAAAAGGG - Intergenic
1144992068 17:19239902-19239924 CCTCCGCTCATTATGGAAGAGGG - Intronic
1146741986 17:35294348-35294370 CCACCATCATTTATTGAAAAGGG - Intergenic
1148859780 17:50598530-50598552 AATACAGCCATTATGGAAAACGG - Intronic
1150486577 17:65548148-65548170 CTTTCATCCAATATGGAAACAGG - Intronic
1151400554 17:73853150-73853172 CCTCCATCCTTGAGGGGAAATGG - Intergenic
1155808190 18:30198778-30198800 CATTCAGCCATTGTGGAAAATGG - Intergenic
1157226587 18:45871343-45871365 AGTACAACCATTATGGAAAAAGG + Intronic
1159512570 18:69415274-69415296 CTTCCTTCCTGTATGGAAAATGG + Intronic
927371769 2:22363828-22363850 CCACCACCGTTTATGGAAAATGG + Intergenic
928116880 2:28551448-28551470 CCTCCCTATTTTATGGAAAAGGG + Intronic
929689434 2:44062168-44062190 CCCCCCTCCCTTATGAAAAAAGG + Intergenic
931589607 2:63868176-63868198 CCTCCATACAATATGAAAACGGG - Intronic
931678756 2:64725105-64725127 ACTCCATTTATCATGGAAAAGGG + Intronic
932417591 2:71583266-71583288 CCCCCATCTCTTATGTAAAAGGG - Intronic
933418393 2:82017164-82017186 TTTCCATACATTATTGAAAATGG + Intergenic
934656968 2:96121452-96121474 CCTCGATGCATTCTGGAGAATGG - Intergenic
935887619 2:107640003-107640025 GGTGCAGCCATTATGGAAAATGG - Intergenic
937568402 2:123326087-123326109 GCTCTATCCATTATTGAACATGG + Intergenic
937796098 2:126022210-126022232 CCTACATCCCTTATATAAAATGG - Intergenic
938038416 2:128055546-128055568 CCTCCCTCCCCTATGAAAAAGGG + Intergenic
938963967 2:136370360-136370382 GATTCAGCCATTATGGAAAATGG + Intergenic
938979478 2:136512539-136512561 AATACAGCCATTATGGAAAATGG - Intergenic
940186557 2:150991563-150991585 AGTACAGCCATTATGGAAAACGG + Intergenic
941189500 2:162361507-162361529 CCTCCATCCATTAAGAAACATGG - Intronic
941546720 2:166859903-166859925 AATACAGCCATTATGGAAAATGG + Intergenic
942340647 2:174942071-174942093 AATACAGCCATTATGGAAAATGG + Intronic
943293655 2:186109156-186109178 TATACAGCCATTATGGAAAATGG - Intergenic
943518912 2:188923098-188923120 TGTACAGCCATTATGGAAAATGG - Intergenic
943827921 2:192419429-192419451 TCTTCATACATTATTGAAAAAGG + Intergenic
944056747 2:195530019-195530041 CCTCTCTCCATTTTGAAAAATGG - Intergenic
944998894 2:205326778-205326800 CATCCACCCAGTTTGGAAAAGGG + Intronic
948903964 2:240969078-240969100 CCTCAACCCATTCTGGAAAGAGG + Intronic
1170263429 20:14438489-14438511 GCTACAGCCATTATGGAAAATGG - Intronic
1170350404 20:15434583-15434605 AGTACAACCATTATGGAAAATGG + Intronic
1171510503 20:25679717-25679739 AGTACAGCCATTATGGAAAATGG + Intronic
1175020164 20:55837918-55837940 AATCTATCCATTATGGAAAGTGG + Intergenic
1177204062 21:17991382-17991404 AATACATCCATTATAGAAAACGG - Intronic
1179396882 21:41048447-41048469 CCTCCTTTCATTATGTACAAGGG - Intergenic
949689377 3:6617924-6617946 GCTCCAATCATTTTGGAAAAGGG - Intergenic
951583592 3:24192246-24192268 CCTCAAGCCCTTATGGATAAAGG - Intronic
952585652 3:34888972-34888994 CATCCACACATGATGGAAAAGGG + Intergenic
953175636 3:40549299-40549321 CCTCTATCAATTATTGAGAATGG + Intronic
954438392 3:50508205-50508227 CCTCCATATATTATGGTAAATGG - Intergenic
955622849 3:60884277-60884299 AGTACAGCCATTATGGAAAACGG + Intronic
955797376 3:62651847-62651869 ACTCCATCAGTTATGGAATAGGG - Intronic
955994243 3:64662471-64662493 GCTCTATCCATTATTGAAAGCGG + Intronic
958477198 3:94599923-94599945 CCAACATCAATTATTGAAAAGGG - Intergenic
958921907 3:100116519-100116541 CCTCCATCCATTATGGAAAATGG + Intronic
960930950 3:122849404-122849426 AGTACAGCCATTATGGAAAACGG - Intronic
961493838 3:127276209-127276231 CCTCCATCCATGAAGCAGAAGGG - Intergenic
962576182 3:136757036-136757058 CCCCCTTCCCTTATGAAAAAGGG + Intergenic
965952090 3:174321960-174321982 GCTACAGCCATTGTGGAAAATGG + Intergenic
967297554 3:187979942-187979964 CCTCCATCCATAATAACAAAAGG + Intergenic
971706696 4:30053172-30053194 AATCTAGCCATTATGGAAAATGG + Intergenic
971801346 4:31296219-31296241 TCTCCATCCATTATGCACATTGG + Intergenic
973787493 4:54347025-54347047 ACTACAACCACTATGGAAAATGG + Intergenic
974218011 4:58926131-58926153 ATTCTATCCATTATTGAAAATGG - Intergenic
974541424 4:63242906-63242928 GTTCCATCTATTATTGAAAATGG - Intergenic
974889067 4:67857047-67857069 AGTGCAGCCATTATGGAAAACGG + Intronic
978080586 4:104585728-104585750 CATCCATCCATTTTTCAAAATGG - Intergenic
979117570 4:116846770-116846792 AATACAGCCATTATGGAAAATGG - Intergenic
979433815 4:120664926-120664948 CCTAAATCCTTTTTGGAAAATGG + Intergenic
980864355 4:138536918-138536940 ACTACAGCCATTATGGACAATGG + Intergenic
981232383 4:142371843-142371865 AGTACAGCCATTATGGAAAACGG + Intronic
982613368 4:157606879-157606901 AGTACAGCCATTATGGAAAACGG + Intergenic
982916504 4:161216760-161216782 AGTACAACCATTATGGAAAACGG + Intergenic
987982317 5:25101917-25101939 CATTCATCATTTATGGAAAAAGG - Intergenic
988881334 5:35506869-35506891 GCTCTATCCATTATTGAAAGTGG - Intergenic
989403019 5:41029051-41029073 GGTGCATCCATTATGGAAAACGG - Intronic
990088960 5:52016677-52016699 CTTCTATCCATTATTCAAAAAGG + Intronic
990501601 5:56401938-56401960 CATCCAGCTATTTTGGAAAATGG + Intergenic
990554870 5:56922687-56922709 ACTGCATCCATTACGGCAAAAGG + Exonic
991239352 5:64439790-64439812 AGTACAGCCATTATGGAAAATGG + Intergenic
992192651 5:74309121-74309143 CCTTCCTCCCCTATGGAAAAGGG - Intergenic
993144950 5:84082047-84082069 TCTCCATCCAGCATGGCAAAAGG + Intronic
994313584 5:98305908-98305930 ACTACAGCCATTATGGAAAATGG + Intergenic
994494359 5:100490891-100490913 GGTACAACCATTATGGAAAATGG + Intergenic
994888261 5:105594924-105594946 GGTGCAACCATTATGGAAAAGGG - Intergenic
995408695 5:111830960-111830982 CTTCCATCACTTATGGAACAGGG - Intronic
1000521262 5:162297460-162297482 TGTTCATCCATTGTGGAAAACGG - Intergenic
1000710793 5:164574676-164574698 GCTCCATCCATTGAGGAAACTGG + Intergenic
1001758481 5:174188596-174188618 CCTCACTCCACTATGGAATAGGG + Intronic
1002412386 5:179092361-179092383 AGTACAGCCATTATGGAAAACGG - Intergenic
1003263197 6:4542732-4542754 ACTACAGTCATTATGGAAAACGG + Intergenic
1004897085 6:20158982-20159004 AGTACAGCCATTATGGAAAACGG + Intronic
1005589246 6:27308053-27308075 AGTACACCCATTATGGAAAATGG - Intronic
1007030895 6:38624983-38625005 CCTAAGTCCATTTTGGAAAAAGG - Intronic
1011120753 6:83949617-83949639 ACTCCATCCTTTGTGGAACAAGG + Intronic
1011123287 6:83978455-83978477 CCTCAATTCATTATGCCAAAAGG - Intergenic
1011160438 6:84383275-84383297 CCATTTTCCATTATGGAAAACGG - Intergenic
1011368503 6:86606669-86606691 AGTACAGCCATTATGGAAAATGG + Intergenic
1012160356 6:95877373-95877395 CATTCTTCCTTTATGGAAAAAGG + Intergenic
1015110074 6:129582710-129582732 CCTCCAGCCAGTGTGGAGAATGG + Intronic
1016650787 6:146457108-146457130 AGTACAGCCATTATGGAAAACGG - Intergenic
1017287429 6:152692094-152692116 GGTACAGCCATTATGGAAAATGG - Intergenic
1019865843 7:3709333-3709355 CCTCCATCCATGCTGGAGACTGG + Intronic
1021435505 7:20609866-20609888 AGTACAACCATTATGGAAAATGG + Intergenic
1022335603 7:29418737-29418759 CCTCCCTCGATTTTGGAACATGG + Intronic
1023456186 7:40341214-40341236 TCTCCATTCATTATACAAAATGG - Intronic
1023910365 7:44551111-44551133 GTTCCATCAATTATTGAAAATGG - Intergenic
1026514276 7:71054267-71054289 ATTACAGCCATTATGGAAAACGG + Intergenic
1026540389 7:71275108-71275130 CCTACAGCCATCTTGGAAAATGG + Intronic
1026927232 7:74202929-74202951 ACTACACCCACTATGGAAAATGG - Intronic
1027827774 7:83137943-83137965 TTTCCTTCCATTAAGGAAAATGG - Intronic
1030604650 7:111626792-111626814 AGTACAGCCATTATGGAAAATGG - Intergenic
1032259005 7:130319614-130319636 CCTCCCTCCTGTATGAAAAAGGG - Intronic
1032421589 7:131784243-131784265 GTTACAGCCATTATGGAAAATGG - Intergenic
1032423928 7:131805188-131805210 GATACAGCCATTATGGAAAACGG - Intergenic
1035549696 8:511535-511557 CTTCTATCCATTATTGAAAGTGG - Intronic
1035778823 8:2211115-2211137 CCTCCCTCTATTCTGGGAAATGG - Intergenic
1037573754 8:20181035-20181057 CCTGCAGCCTTTATGGAAGAGGG + Exonic
1039973039 8:42336403-42336425 TCTCCAGCCTTTATGGGAAATGG - Intergenic
1042981202 8:74530964-74530986 AGTACAGCCATTATGGAAAAAGG + Intergenic
1043307361 8:78812472-78812494 AATACAGCCATTATGGAAAATGG - Intergenic
1043551326 8:81376206-81376228 CATCCATCCCTTCTGGAATAGGG - Intergenic
1044326713 8:90867257-90867279 CCCTAATCCATTATTGAAAATGG - Intronic
1045134124 8:99194818-99194840 AATACAACCATTATGGAAAACGG - Intronic
1045145800 8:99342822-99342844 AATACAGCCATTATGGAAAACGG - Intronic
1047000650 8:120569332-120569354 CCTGCATCCAATATGCAAACAGG - Intronic
1047242212 8:123100936-123100958 ATTGCATCTATTATGGAAAATGG + Exonic
1047639886 8:126807202-126807224 GTTCTATCCATTATTGAAAATGG + Intergenic
1049269785 8:141688606-141688628 CCTCCAGGCTCTATGGAAAAGGG - Intergenic
1049293032 8:141813920-141813942 CCTCCAGCAGTTCTGGAAAAGGG + Intergenic
1050470319 9:5981743-5981765 CGTCCATCTCTTCTGGAAAATGG + Intronic
1050647117 9:7732078-7732100 CCTCCAAGCATTCTGGAGAAGGG - Intergenic
1050960774 9:11727506-11727528 AGTACAGCCATTATGGAAAATGG + Intergenic
1052588360 9:30458222-30458244 AGTACAGCCATTATGGAAAACGG + Intergenic
1053264521 9:36700978-36701000 ACTCCATCCATTTTGGACAATGG + Intergenic
1054720794 9:68601853-68601875 CTTCCATCCATTTTGGAAGTTGG - Intergenic
1054768264 9:69060825-69060847 CCTCCATCCCTCCTGCAAAAAGG - Intronic
1055289581 9:74768952-74768974 CCTCCAACCCTTAAGGAAAGGGG - Intronic
1055713354 9:79089154-79089176 CCTCCATCCATTGCTAAAAAAGG - Intergenic
1055798949 9:80010458-80010480 GTTCTATCCATTATTGAAAATGG + Intergenic
1056634323 9:88319254-88319276 CCTCCATCCATTAGGTGAGAAGG - Intergenic
1057773642 9:97987130-97987152 CCCCCATCCCTTAGGGAAATGGG - Intronic
1061694310 9:132360282-132360304 GTTACATCCATTATTGAAAATGG + Intergenic
1185749151 X:2596771-2596793 CATCCATAAATTATGGAAGAGGG - Intergenic
1187183119 X:16962048-16962070 GGTACAGCCATTATGGAAAATGG + Intronic
1187951846 X:24478660-24478682 CTGCCATTCATTATGGCAAAAGG - Intronic
1190517666 X:51241844-51241866 AGTACAACCATTATGGAAAACGG + Intergenic
1191177385 X:57518893-57518915 CCTCCATACTTTAAGGAAACTGG + Intergenic
1191664973 X:63692623-63692645 AGTACAGCCATTATGGAAAATGG + Intronic
1192015893 X:67330526-67330548 AGTACAACCATTATGGAAAATGG + Intergenic
1194006090 X:88494507-88494529 GTTCCATCCATTATTGAAAATGG + Intergenic
1194691503 X:96991753-96991775 CAGTCATCCATTATGGAAATGGG - Intronic
1194891815 X:99388310-99388332 GTTCTATCCATTATTGAAAATGG + Intergenic
1195362611 X:104098661-104098683 GGTACAGCCATTATGGAAAACGG + Intergenic
1196077916 X:111597567-111597589 CCTCCATATTTTATGGCAAATGG - Intergenic
1196793531 X:119484863-119484885 AGTACAGCCATTATGGAAAATGG - Intergenic
1196857172 X:119995197-119995219 ACTCCATCACTTATGGGAAATGG + Intergenic
1197677909 X:129350236-129350258 CCTCCAGCCATTATGGTATTGGG - Intergenic
1197698287 X:129574476-129574498 CCTACAGCCATTTTAGAAAATGG - Intronic
1197861447 X:130975194-130975216 TTTCCATTCATTATGGAAAGGGG + Intergenic
1198313405 X:135442538-135442560 CCTTCATCCATTTTGGAATCAGG - Intergenic
1199476476 X:148251926-148251948 AGTCGAGCCATTATGGAAAATGG - Intergenic