ID: 958922058

View in Genome Browser
Species Human (GRCh38)
Location 3:100118563-100118585
Sequence GTGCTTGAACAGAGGCCGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 116}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958922058 Original CRISPR GTGCTTGAACAGAGGCCGCA TGG (reversed) Intronic
901448648 1:9323169-9323191 GTGCCGGGACAGAGGCCCCATGG - Intronic
902742153 1:18446092-18446114 GTGCTGGAACAGAAGGTGCAAGG - Intergenic
902830815 1:19011076-19011098 GTGGTTGAACACAGGCTGCAGGG - Intergenic
903656852 1:24954811-24954833 GTGTGTGAACAGAGACCACAGGG - Intronic
905234466 1:36536383-36536405 GTGCTGGAACAGAGGTCTAAGGG + Intergenic
907832523 1:58078548-58078570 TTGTTTGAGCAGAGGCTGCAGGG - Intronic
910876738 1:91885650-91885672 GTGCGTGGGCAGCGGCCGCACGG - Intronic
915141614 1:153771747-153771769 CTGCTTGCACAGTGGCCGCAGGG - Intronic
915626825 1:157118932-157118954 GTGATCGAACAGGGGCCTCAAGG + Intergenic
917471374 1:175328742-175328764 GAGCTGGAACAGAGGGAGCAAGG + Intronic
919465354 1:197918034-197918056 TTGGTTTAACAGAGGGCGCAGGG - Intronic
923592272 1:235329012-235329034 GTGCTAGCACAGAGTCCGGAGGG - Intronic
1063171542 10:3514219-3514241 GAGCTTAAACAGAGGCTTCATGG - Intergenic
1064185760 10:13160795-13160817 GTGCCTGAACAGTGTCTGCAAGG + Intergenic
1068398969 10:56503653-56503675 GTGCTAGAACTGAGGCTGCCAGG - Intergenic
1069771439 10:70903089-70903111 GTGCTCTAACAGAGGCCGTGAGG + Intergenic
1077849524 11:6062119-6062141 GAGGTTGAACAGAGGACTCAGGG - Intergenic
1084483800 11:69436679-69436701 GTTCAGGCACAGAGGCCGCATGG + Intergenic
1090987932 11:131788947-131788969 GAGCCAGAACAGAGACCGCAGGG - Intronic
1094874005 12:34620293-34620315 GTGCTTGAAGGCAGGCCACAGGG - Intergenic
1095683283 12:45003539-45003561 GTTCTTTAACAGAGGCTACACGG - Intergenic
1099131010 12:78831115-78831137 TTGCTTGAACCGAGGAGGCAGGG + Intergenic
1103799256 12:123526722-123526744 GTATTTGCACAGAGGGCGCAAGG + Intronic
1104415827 12:128596072-128596094 GTCCTGGTACAGAGGCAGCAGGG + Intronic
1104415856 12:128596218-128596240 GTCCTGGTACAGAGGCGGCAGGG + Intronic
1104415871 12:128596291-128596313 GTCCTGGTACAGAGGCGGCAGGG + Intronic
1104415914 12:128596510-128596532 GTCCTGGTACAGAGGCGGCAGGG + Intronic
1104415944 12:128596655-128596677 GTCCTGGTACAGAGGCAGCAGGG + Intronic
1104648511 12:130514167-130514189 GTGCTTTGAGAGAGGCAGCAGGG - Intronic
1104844124 12:131838387-131838409 GTGCCTGATCAGAGGGGGCATGG - Intronic
1113576627 13:111399659-111399681 GTGCCTGCACAGAGGAAGCAGGG - Intergenic
1117320331 14:54616175-54616197 GTGCATGAGCAGAGGGAGCAAGG - Intronic
1118161879 14:63298952-63298974 GTGCTTGAACCCAGGAGGCAAGG + Intergenic
1122029155 14:98899944-98899966 GTCCTTCAACAGGGGCCGGAAGG + Intergenic
1125025408 15:35024407-35024429 GTGCTTGAACCCAGGAGGCAGGG + Intergenic
1128618848 15:69131929-69131951 GTGCTTGAACAATGCCCTCAAGG + Intergenic
1132909323 16:2300232-2300254 GTCCTGGGACAGAGGCTGCATGG - Intronic
1133073406 16:3261905-3261927 GTGCTTGAACAGAGACCCAAAGG + Intergenic
1135882963 16:26277267-26277289 GCTCTTGGACAGAGGCAGCAGGG - Intergenic
1140257969 16:73352943-73352965 GTGCCTGACCAGAAGCCTCATGG + Intergenic
1142244466 16:88963179-88963201 GGGCTTGGACAGAGGCTGTAAGG + Intronic
1143616796 17:8056411-8056433 GTGCCTGAACAAAGGTCTCATGG + Intergenic
1144026706 17:11283440-11283462 GTGCTTTAATAGAGGCAGGATGG - Intronic
1144580996 17:16459496-16459518 GTGCTAGAGCAGAGCTCGCAGGG + Intronic
1146400122 17:32495172-32495194 GTGGTTGAACAGACGCCACCAGG + Intronic
1151917390 17:77128300-77128322 GCGCCTGACCAGAGGCCACAGGG + Intronic
1152003813 17:77664384-77664406 GTGCTTGAAAAGTGGCCCAAAGG - Intergenic
1152739424 17:82012522-82012544 CTGCCTGAACTGAGGCCGCTTGG + Intronic
1152937036 17:83145186-83145208 GTGCTGGAGCAGAGGCTGCAGGG - Intergenic
1159877970 18:73831959-73831981 GTGCTTGAGCAGTGGACCCATGG - Intergenic
1160236657 18:77090933-77090955 GTGCTGGCACAGAGGTGGCAGGG + Intronic
1160529440 18:79554993-79555015 GAGCTTAGACAGAGGCTGCAAGG + Intergenic
1162543001 19:11309410-11309432 GTGCTGGAACAGAGTGAGCAAGG - Intronic
1162947289 19:14051772-14051794 GGGCTTGAAGGGAGGCCTCAGGG + Intronic
1163329532 19:16627832-16627854 GAGCTGGGACGGAGGCCGCATGG - Intronic
1163528579 19:17836169-17836191 CTGTATGAACAGAGGCAGCAGGG - Intronic
1163750635 19:19075385-19075407 CTGCATGAACAGAAGCAGCATGG + Intronic
1165224159 19:34342347-34342369 GTTCTGGGACAGAAGCCGCAGGG + Exonic
1168338262 19:55608964-55608986 GTGGTTGAAGAAAGGCAGCAAGG - Intronic
926822525 2:16868285-16868307 GTGTTTGACCAGAGCCTGCAGGG + Intergenic
927375787 2:22412002-22412024 TTGCTTGAACAGGGGCAGCGTGG + Intergenic
928454897 2:31411195-31411217 TTGCTTGAACCCAGGCGGCAAGG + Intronic
934916530 2:98305004-98305026 CTGCTTCCACAGAGGCCACACGG + Intronic
935759180 2:106302896-106302918 GTGCATGAAGTGAGGCCACATGG + Intergenic
937933761 2:127226180-127226202 GTGCCTCAGCAAAGGCCGCAGGG + Intergenic
939618374 2:144386681-144386703 TTGCTTTAAAAGAGGCCACAGGG + Intergenic
941772201 2:169357414-169357436 CTGCTTGAACACAGGAGGCAGGG - Intronic
941779389 2:169427527-169427549 GTGCCTGAACAGAAGCATCAGGG + Intergenic
942055934 2:172182080-172182102 CTGCTTTAACAAAGGCCTCAAGG - Intergenic
944972524 2:205010322-205010344 GTTCATGCACAGAGGCTGCAAGG - Intronic
945985390 2:216349637-216349659 GTGATGGAAAAGAGGCCTCAGGG + Intronic
1169899067 20:10534689-10534711 GTGCATGAACAGAGGCCAGCAGG + Intronic
1169947234 20:11002305-11002327 GGGCATGAATAGAGGCCTCAGGG + Intergenic
1170342180 20:15341519-15341541 GTGCTTTAAAAGTGGCCTCAGGG - Intronic
1173090630 20:39967612-39967634 GTGCATGAACACAGGGGGCATGG - Intergenic
1174051155 20:47768534-47768556 CTGTGTGAACAGAGGCCTCAGGG + Intronic
1174400005 20:50270823-50270845 GTCCTTGAACGCAGGCCACAGGG - Intergenic
1175546081 20:59778588-59778610 GTGCTGGTAGAGAGGCTGCATGG - Intronic
1177108534 21:16993520-16993542 GTGCATGTCCAGAGGCCCCAAGG + Intergenic
1179820370 21:43933763-43933785 GTGCTTGGATGGAGGCCGCCGGG - Intronic
1179881849 21:44296313-44296335 GTGGGGGTACAGAGGCCGCAGGG - Intronic
1182700235 22:32230967-32230989 GTGCTGGAACTGATGCCCCAAGG - Exonic
949346032 3:3077681-3077703 TCGCTTGAACACAGGCAGCAGGG + Intronic
949918803 3:8985621-8985643 GTGCTGGACCACCGGCCGCACGG + Exonic
950482783 3:13254898-13254920 GTGGATGCACAGAGACCGCATGG - Intergenic
950665031 3:14490145-14490167 GGGCTTGAACACAAGCCACATGG - Exonic
952979631 3:38724157-38724179 GTGGGTGAACAGAAGCCGCTTGG - Intronic
953717519 3:45328734-45328756 GTGCTTGTACAGTGGCCTCCTGG + Intergenic
954671518 3:52293689-52293711 GTGCGTGAGCAGAGACCCCAGGG + Intergenic
955703581 3:61705802-61705824 ATGCTTGAGCAGAGGCCGTGAGG + Intronic
956533573 3:70249932-70249954 GTGCTATAACAGAGGCCACTTGG - Intergenic
958922058 3:100118563-100118585 GTGCTTGAACAGAGGCCGCATGG - Intronic
963748149 3:149146836-149146858 GTGCTTGAAAAGAGAGCTCAAGG + Intronic
970372786 4:15424701-15424723 GTGGTTGAAGAGAGGCATCAAGG - Intronic
976782280 4:88774153-88774175 ATGCTTGCACAGAGGCCTGAAGG - Intronic
981043942 4:140249104-140249126 GTTCCTGAACAAAGGCCTCAAGG - Intergenic
984698195 4:182799937-182799959 GCGGTTGACCAGCGGCCGCAAGG + Exonic
986771102 5:10974538-10974560 GTGCTTGAAAAGGGACCCCAGGG - Intronic
992105142 5:73444241-73444263 GTGCTGGAACAAAGGCTGCGGGG - Intergenic
1000529375 5:162400258-162400280 GTGCTTGAACCGGGGAGGCAGGG - Intergenic
1003002454 6:2348922-2348944 GAGGTTGAACAAAGGCAGCAGGG - Intergenic
1003573184 6:7269238-7269260 GTGGCTGGACAGAGGCAGCAGGG + Intronic
1006376739 6:33675795-33675817 GTGCTTGAAGAGCAGCTGCAGGG - Exonic
1007428143 6:41760318-41760340 GTGCTAGGACCGAGGCCCCAGGG + Intergenic
1019115542 6:169758500-169758522 GTGGTTAAACAGAGGCAGCAGGG - Intronic
1019570509 7:1709436-1709458 GGGAGTGGACAGAGGCCGCAGGG + Intronic
1020143086 7:5623007-5623029 GTTGTTGAACACAGGCCGCACGG + Exonic
1022552396 7:31253346-31253368 GTGATTGAGTAGAGGCTGCAGGG + Intergenic
1023175721 7:37433679-37433701 GTACTTGAACACGGGCCCCAGGG + Intronic
1023834266 7:44059214-44059236 GTGCAGGAACAGAGGCCCCAGGG - Intronic
1024987351 7:55206810-55206832 GTGCTTGAATAGATGACTCAAGG - Exonic
1035287904 7:157817723-157817745 GTGCATGCACACAGGCCACACGG - Intronic
1036566503 8:9942953-9942975 ATGCTGGAACAAAGGCTGCAGGG - Intergenic
1036700094 8:11007740-11007762 GTGGAGGAACAGAGGCAGCAGGG + Intronic
1038970705 8:32631294-32631316 GTGCTTCAACAGTGACCTCAAGG + Intronic
1049411924 8:142477411-142477433 GTGCTGGAGCAGAGGCTCCAGGG - Exonic
1053100691 9:35369900-35369922 GTGCTAGAACAGAACCCACAGGG - Intronic
1057882776 9:98806012-98806034 GTGTCTGAACAGAGGCCAAAGGG + Intergenic
1059283582 9:113154433-113154455 CAGTTTGAACAGAGGCAGCAAGG - Intronic
1061311974 9:129769495-129769517 GTGCTTGAAGAGAGAAGGCAGGG + Intergenic
1062049123 9:134438129-134438151 GTGCCTGAACAGAGGGTGGATGG + Intronic
1191939524 X:66463141-66463163 GTCCATGAACATAGGCCCCAGGG - Intergenic
1198772443 X:140145232-140145254 GTGCTTGTACAGTGTCAGCAGGG - Intergenic
1199708787 X:150453299-150453321 GAGCTTCAACAGAGACCACATGG + Intronic