ID: 958925272

View in Genome Browser
Species Human (GRCh38)
Location 3:100150224-100150246
Sequence CAAAAGAAACCCTGGCCCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 261
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 240}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958925272_958925279 19 Left 958925272 3:100150224-100150246 CCTTGGGGCCAGGGTTTCTTTTG 0: 1
1: 0
2: 1
3: 19
4: 240
Right 958925279 3:100150266-100150288 CACAGTTTGGGGCTCTTATTTGG 0: 1
1: 0
2: 1
3: 13
4: 121
958925272_958925275 6 Left 958925272 3:100150224-100150246 CCTTGGGGCCAGGGTTTCTTTTG 0: 1
1: 0
2: 1
3: 19
4: 240
Right 958925275 3:100150253-100150275 CTATAGTACCTAACACAGTTTGG 0: 1
1: 0
2: 2
3: 27
4: 415
958925272_958925276 7 Left 958925272 3:100150224-100150246 CCTTGGGGCCAGGGTTTCTTTTG 0: 1
1: 0
2: 1
3: 19
4: 240
Right 958925276 3:100150254-100150276 TATAGTACCTAACACAGTTTGGG 0: 1
1: 0
2: 3
3: 17
4: 221
958925272_958925277 8 Left 958925272 3:100150224-100150246 CCTTGGGGCCAGGGTTTCTTTTG 0: 1
1: 0
2: 1
3: 19
4: 240
Right 958925277 3:100150255-100150277 ATAGTACCTAACACAGTTTGGGG 0: 1
1: 0
2: 0
3: 21
4: 210

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958925272 Original CRISPR CAAAAGAAACCCTGGCCCCA AGG (reversed) Intronic
901797682 1:11690197-11690219 GACAAGAATCCCTGCCCCCATGG - Intronic
902351482 1:15858789-15858811 CAAAAAAAACCCGGGCACGATGG + Intronic
903369204 1:22824472-22824494 CCAGAGAGACCCTGGACCCATGG - Intronic
905223465 1:36464605-36464627 CCAAAATAACCCTGGCCCGAGGG - Intergenic
907325867 1:53638367-53638389 CAAAACAGACACTGGCCCCAAGG + Intronic
907621229 1:55982878-55982900 CAAAAGTAACCTTGGTACCAGGG + Intergenic
907748322 1:57237277-57237299 TAAAAGACAACCTGTCCCCATGG + Intronic
909985034 1:82151013-82151035 TAAAAGATACGGTGGCCCCAAGG - Intergenic
910023793 1:82624222-82624244 AAAAAGAAACCATGGCCACATGG - Intergenic
911856960 1:102890459-102890481 CAAAGGTGACCCTGGCTCCAAGG - Exonic
913099614 1:115551032-115551054 CTAATGAAAGCATGGCCCCAGGG - Intergenic
918260527 1:182791417-182791439 CAATAGAGACCCAGACCCCAGGG + Intronic
919347661 1:196406085-196406107 CAAAATAGACCCTGACCTCAAGG - Intronic
919813607 1:201424178-201424200 GAATAGGAAGCCTGGCCCCAGGG - Intronic
923595175 1:235355676-235355698 AAAAAGAAAACCTGGGCGCAGGG - Intergenic
923765778 1:236891192-236891214 CAAAAGAAACTCCGGGCCCGGGG + Exonic
924507508 1:244699748-244699770 AAAAACAAACCCTGGCACCTAGG + Intronic
1064325738 10:14349538-14349560 AGAAAGAAACACTGGCCCAAAGG + Intronic
1065214283 10:23435400-23435422 CAAAAGAAACCCACGCCCTTTGG + Intergenic
1066131100 10:32394951-32394973 CACAAGAATCCCTGGAACCAGGG - Intergenic
1067325473 10:45261898-45261920 CAAAACAAATCCTAGCTCCAGGG - Intergenic
1067340309 10:45395963-45395985 TAGAAGAAACCATGGCCCCGTGG - Intronic
1069008214 10:63341764-63341786 CTAAAGATACCCTGGTCGCATGG - Intronic
1069115305 10:64497542-64497564 TAAAAGAACCCCAGACCCCAGGG - Intergenic
1069408191 10:68124630-68124652 CAACAGAATCCCTGCCCTCAAGG - Intronic
1069818774 10:71214831-71214853 CAGAAGAAACCCCAGGCCCAGGG + Intronic
1069907074 10:71738321-71738343 CAAAGGAGGCCCTGGGCCCATGG - Intronic
1070913188 10:80135890-80135912 GAAAAGCAACCCTGGCCACTTGG - Intronic
1071366672 10:84907536-84907558 CCAGAGCAATCCTGGCCCCAGGG + Intergenic
1072748278 10:97957584-97957606 CAATTCAAACCCAGGCCCCATGG + Intronic
1073696957 10:105880262-105880284 AGAAATAAACCCTGGCCCCAGGG + Intergenic
1074729117 10:116349757-116349779 GAAAAAAATCCCTGCCCCCATGG + Intronic
1075586892 10:123665060-123665082 CAACAGAGACCCTGGACACAGGG - Intergenic
1076445282 10:130509971-130509993 CAGAGGAAACACTGGCCCCACGG - Intergenic
1076872242 10:133199805-133199827 CAGAAGAAACCCAGGTCCGATGG - Intronic
1077406594 11:2385136-2385158 CAGAAGAAACACTGGCCCCGGGG + Intronic
1078020081 11:7649759-7649781 CAAAAGAATCCCAGGCACCATGG - Intronic
1078773129 11:14369463-14369485 CAGAAGTATCCCTTGCCCCATGG - Intergenic
1079154779 11:17935779-17935801 CAATGAAAACCCTGCCCCCATGG + Intronic
1080307221 11:30849825-30849847 CAAGAGTAACTGTGGCCCCAGGG - Intronic
1081841242 11:46202905-46202927 CAAAAGAAAGCCCTGCCCCCAGG + Intergenic
1081994211 11:47353058-47353080 TCAGAGACACCCTGGCCCCAGGG - Intergenic
1082771827 11:57213659-57213681 CAAAAGACCCCCTGGCTCCTGGG - Intergenic
1082897533 11:58208194-58208216 CAAAAGAAAACATGGCCAAACGG + Intergenic
1083393211 11:62370814-62370836 TAAAGGAAAACCTTGCCCCACGG - Intronic
1085291537 11:75403736-75403758 CAAAAGAAACCCTGACATCTAGG - Intronic
1085667363 11:78426581-78426603 CAAAGGAAGCTCTGGCCCCCAGG + Intergenic
1087658175 11:100952626-100952648 TGAAAGAAACCCTGGCTCAAAGG + Intronic
1089471395 11:118723346-118723368 TAAAGGAAAACCTTGCCCCAAGG - Intergenic
1092482223 12:8870223-8870245 CATAAAAAACCCTGGCTCCCTGG - Intronic
1092860037 12:12712371-12712393 CAAAAGCAAGCCTGGGCCCTGGG - Intergenic
1092998807 12:13976779-13976801 AAAAAAAAATCCTGCCCCCAGGG + Intronic
1094100250 12:26753906-26753928 CAAGAGAAAGCATGGCCACACGG - Intronic
1096156501 12:49344328-49344350 CAGGAGATACCCTAGCCCCAAGG - Intergenic
1097482965 12:60154433-60154455 CAAAAAAAAAGCTGGCTCCAAGG - Intergenic
1098357735 12:69627235-69627257 CAAAAGGATCCCAAGCCCCATGG + Intergenic
1102434765 12:112912605-112912627 CAAAAGCAGCACTGCCCCCAGGG + Intronic
1104347264 12:128011862-128011884 GAAATCCAACCCTGGCCCCATGG + Intergenic
1105504486 13:20998513-20998535 CAAAAGAATCTCTGACCCAAAGG + Intronic
1105680133 13:22717635-22717657 GAAAAGAAACTGTGGCCACAGGG - Intergenic
1109586172 13:64407633-64407655 CAAGAGAAACCCTGGGCACTGGG - Intergenic
1110148359 13:72221378-72221400 CAACATCAACCCTGGCCCCAGGG + Intergenic
1114055674 14:18965386-18965408 CAAGAGAAAGCCTGGCCTCCTGG - Intergenic
1114106872 14:19436377-19436399 CAAGAGAAAGCCTGGCCTCCTGG + Intergenic
1114655481 14:24313010-24313032 CAAAAGAAACCCAGTCCCCAGGG + Intronic
1116080661 14:40166857-40166879 CAAAGGAAAAGCTGGCACCAAGG + Intergenic
1119339357 14:73863151-73863173 CAGAAGAAACCCTGAACCTATGG + Intronic
1119538055 14:75419203-75419225 CCAAAGAAGCCCTTGTCCCAAGG + Intergenic
1119923551 14:78470204-78470226 CTGAAGAAACCCTGAACCCAGGG - Intronic
1121336121 14:93078473-93078495 CAACAGAAACCTGGGCCCCGAGG + Intronic
1123997989 15:25732424-25732446 AAAAATAAACCCTAGACCCACGG + Intronic
1126253184 15:46592967-46592989 TAAAAGAAACCCTGCCCTCATGG + Intergenic
1126763885 15:51994290-51994312 CAAAAGGAACCAGGGCCCCTTGG + Intronic
1127226179 15:56931997-56932019 CAAGAGAGACCCTGGCACTATGG - Intronic
1128206697 15:65858970-65858992 AAAAAGAAATCCTTGCCTCATGG - Intronic
1129412119 15:75355881-75355903 CAAACAAAACCCCAGCCCCAGGG + Exonic
1129606001 15:77025331-77025353 CAAAAGATCCCATTGCCCCAGGG - Intronic
1132204924 15:99979941-99979963 CAAAAGAAACCCTGCTTCCTGGG + Intronic
1132358912 15:101195832-101195854 AAAAAAAAACCCTGTCTCCAGGG + Intronic
1132688305 16:1171364-1171386 CTAAGGAAAGCCTGTCCCCAGGG - Intronic
1133018844 16:2957124-2957146 CAAAAGAATCCCTTGACCCTGGG - Intergenic
1137397486 16:48126414-48126436 AACAAAAAACCCTGACCCCATGG + Intronic
1137871412 16:51953930-51953952 CATAAGACACCCTGTCACCATGG + Intergenic
1140127748 16:72132244-72132266 CCAGAGAAACCCTGTACCCAAGG + Intronic
1141851303 16:86647943-86647965 CAAGAGAAGCCTGGGCCCCAAGG - Intergenic
1142243505 16:88957865-88957887 CAAAAGAAACCCCATGCCCACGG - Intronic
1142508073 17:378312-378334 CCAATGAAACTCTTGCCCCATGG + Intronic
1142660998 17:1429272-1429294 AAAAAAAAACCCTGGACTCAAGG - Intronic
1143118547 17:4593777-4593799 AGTAACAAACCCTGGCCCCAGGG - Intronic
1143398859 17:6627419-6627441 CAAAAGAAACCGTTGCACTAGGG - Intronic
1143445599 17:7007166-7007188 CCAAAGAAACCTGAGCCCCAAGG - Intronic
1143700515 17:8656327-8656349 GATAAAAACCCCTGGCCCCATGG - Intergenic
1144050773 17:11495562-11495584 TGAAAGAAACCCTGGACACAGGG - Intronic
1145747714 17:27332514-27332536 CAAAACATCCCCTGGCCCCCTGG - Intergenic
1145886303 17:28384654-28384676 CAAAAGCGACCCTGGCGCCGCGG - Intronic
1147560710 17:41507261-41507283 CCACAGCAACCCTGGCCCCTTGG - Intergenic
1147760278 17:42793678-42793700 GAAGAGAGACACTGGCCCCATGG + Exonic
1149266273 17:54931076-54931098 CAACAGAAACACTGCCCCTAAGG - Intronic
1150204736 17:63394444-63394466 TAAAAGAAACCATGGCTCCTTGG - Intronic
1150476709 17:65481092-65481114 CAAAGGCAAGCCTAGCCCCAAGG + Intergenic
1150989983 17:70246116-70246138 CAAAAGAGACCTTAGACCCAAGG - Intergenic
1151598165 17:75090430-75090452 GAAAAGAAACTCTGCCACCAAGG - Intronic
1151714663 17:75825231-75825253 CAAGAGCCTCCCTGGCCCCAGGG + Exonic
1151940482 17:77288544-77288566 GAAAGGAAGCCCCGGCCCCAGGG - Intronic
1152609411 17:81308274-81308296 CAAATGAAACCTGGACCCCAGGG + Intergenic
1152622873 17:81373985-81374007 GCAAAGAGACCCTGGACCCAAGG + Intergenic
1152910409 17:83002217-83002239 CAGGAGAAAGCCTGCCCCCACGG + Intronic
1153127360 18:1810580-1810602 AAAAAGGAACCCTGGCTCCTGGG - Intergenic
1157607713 18:48936458-48936480 CAAAAGGAAACCCGGTCCCATGG + Intronic
1158643614 18:59223331-59223353 CAAAAGCAAAACTGGACCCAGGG + Intronic
1159871061 18:73760104-73760126 CAAATAAACTCCTGGCCCCAGGG + Intergenic
1160332493 18:78007244-78007266 AAAAAAAAACCCAGACCCCATGG - Intergenic
1160754979 19:752311-752333 CAAAAAAACCCCTGGATCCACGG - Intronic
1161926145 19:7301645-7301667 AAACAGAAACCCTGTCCCCATGG + Intergenic
1162999123 19:14355139-14355161 CAGAAAAACCCCTGCCCCCATGG + Intergenic
1163052683 19:14696309-14696331 AAGTAGAAACCCTGTCCCCATGG + Intronic
1163276581 19:16288290-16288312 AAAAAGAAACCCTGTCCCAGCGG + Intergenic
1163568917 19:18068733-18068755 AAAAAGAAGCCCTGGTTCCATGG - Intronic
1164586304 19:29478230-29478252 CAGAAGTAACCCTTGGCCCATGG + Intergenic
1165272946 19:34725983-34726005 AAAAAAAAATCCTGGTCCCATGG + Intergenic
1165454114 19:35900780-35900802 GAAAAGAAATCCAGGCCCCCCGG - Intronic
1166745248 19:45138830-45138852 CAAAAGAAACGCTGTTCCCTGGG + Intronic
925053286 2:834111-834133 CCAAAGAAAACATGGCCTCAGGG + Intergenic
926146535 2:10399928-10399950 CCAGAGTAAACCTGGCCCCAAGG + Intronic
926224058 2:10954964-10954986 CCACAGAAACCCTGGGCCAATGG + Intergenic
926598688 2:14818162-14818184 CTAAAGAAACCATGGTTCCATGG - Intergenic
927289335 2:21389487-21389509 CAAAAGGAACCATGGCTCCTTGG + Intergenic
928564249 2:32527400-32527422 CTAAAGATACCCTGGTCACATGG - Intronic
929315730 2:40476235-40476257 CTATAGAAACTCTGGACCCAAGG + Intronic
929510516 2:42562700-42562722 TAAGCCAAACCCTGGCCCCAGGG - Intronic
930255642 2:49087057-49087079 AAAAAAAAACCCTGCCCACAGGG - Intronic
933988786 2:87617611-87617633 CTAGTGAAACTCTGGCCCCAGGG + Intergenic
934529166 2:95074498-95074520 CACAAGAAGCCCTGGCCATATGG + Intergenic
935140186 2:100346101-100346123 CAAAAATAACCCTGGCTGCAGGG + Intergenic
935990712 2:108716640-108716662 CAAAAGACAGCCAGGCACCATGG - Intergenic
936283068 2:111159570-111159592 CAATAGAGGCCCTGGCCCCAGGG - Intronic
937951772 2:127393759-127393781 CAAAAGAAACCAGGGCCCTTTGG - Intergenic
938461398 2:131500045-131500067 CCAAAGGAACCCTGGTGCCATGG - Intergenic
940328748 2:152452724-152452746 CAAAGGAATCCCTTGGCCCATGG - Intronic
943175891 2:184473867-184473889 CAAAAAAAATCCTGGCCTCCTGG + Intergenic
943697771 2:190954792-190954814 CAAAGTAAACCCTTTCCCCAAGG + Exonic
945262306 2:207855100-207855122 CAAAAGAAACCAAGGCTCCCTGG + Intronic
946127491 2:217576553-217576575 CAAAAGAAACCAGGGCCCCTTGG + Intronic
946684074 2:222249684-222249706 CAGAAGAAGCCCTTGCCCCCGGG + Intronic
946840740 2:223817235-223817257 CAAAAGTCAACCTGGCTCCAGGG + Intronic
948539589 2:238679691-238679713 TAAAGGAAACCATGGCCCCTTGG - Intergenic
1168870518 20:1123681-1123703 CAGAAGAAACCCTGTGCACAGGG - Intronic
1171383526 20:24751726-24751748 CATCAGAAACCCTGGCTGCAGGG - Intergenic
1172091167 20:32433944-32433966 TCAAAGAAAACCTGGCTCCAGGG - Intronic
1173996120 20:47339861-47339883 CAAAAGGAAACCTAGCCACAAGG + Intronic
1174118816 20:48247155-48247177 CAACAGACAACCTGTCCCCAGGG + Intergenic
1175008339 20:55709754-55709776 CACAAGAAAGACTGGCCCCCAGG - Intergenic
1175166969 20:57050949-57050971 AAAAAGAAAACATGGCCCCAAGG + Intergenic
1175348498 20:58300902-58300924 CAATCAAAACCCTGGCTCCAAGG + Intergenic
1175857158 20:62127919-62127941 CAACAGAGAACCTGGACCCAGGG - Intronic
1177429980 21:20979667-20979689 CAAAGAAAACCCTGGCAGCATGG - Intergenic
1177646211 21:23902652-23902674 CAAATGATACCTAGGCCCCATGG - Intergenic
1178724032 21:35035465-35035487 CAAAAGCAGCCCAGGCCACACGG - Intronic
1179521569 21:41948954-41948976 CTAAAGAAACCCTGGGCTGAAGG + Intronic
1179963711 21:44787466-44787488 AAAAAGAAGTCCTGGCCCAAAGG + Intronic
1181431941 22:22887204-22887226 AAACAGAGACACTGGCCCCAAGG + Intronic
1181990508 22:26833381-26833403 CAGAGCAAACCCTGGCCCCATGG - Intergenic
1182294476 22:29305113-29305135 CAAAAGAGACACGGCCCCCAAGG + Intergenic
1184694464 22:46131800-46131822 CAAATGAGACCCTGGGCTCAGGG + Intergenic
1184838311 22:47037043-47037065 CAAAACAAACACAGGCCCCAAGG - Intronic
950430876 3:12950292-12950314 CAAGAGTTAGCCTGGCCCCAAGG + Intronic
954133757 3:48572685-48572707 TAAAGGAGAACCTGGCCCCACGG - Exonic
955417756 3:58708557-58708579 CAATATGAACCCTGGCCCCAAGG + Intergenic
955541475 3:59981088-59981110 CAAAAAAAACACTGGGTCCATGG + Intronic
956164628 3:66387087-66387109 CAGGAGAAGCCCTAGCCCCAGGG + Intronic
956387317 3:68733949-68733971 AAACAAAAACCCTGCCCCCATGG + Intronic
958829498 3:99070275-99070297 CTAAAGATACCCTGGTCACATGG + Intergenic
958925272 3:100150224-100150246 CAAAAGAAACCCTGGCCCCAAGG - Intronic
960033536 3:113079767-113079789 AAAATGAAACCCCAGCCCCAAGG + Intergenic
960985363 3:123276250-123276272 CAAAAGAAACCCAGCTCCAAGGG + Intergenic
961907839 3:130281180-130281202 AAAAACAAACCCTGCCCTCATGG + Intergenic
962014263 3:131424410-131424432 CAACAGGAACCCTGGGCCCTAGG + Intergenic
964708534 3:159646886-159646908 TAAAAGAGACCCAGGACCCAGGG + Intronic
966971397 3:185048696-185048718 GACAACAGACCCTGGCCCCAAGG + Intronic
968680489 4:1915595-1915617 CCAAGGAACCCCTGGACCCAGGG - Intronic
973994761 4:56446807-56446829 CAAAAGAAATCCTGGTGTCAAGG + Exonic
974300751 4:60064218-60064240 CAAAATATGCCCTGGCTCCAAGG + Intergenic
975082345 4:70296326-70296348 CTGTAGAAACCCTGGGCCCAGGG + Intergenic
976175609 4:82348748-82348770 AAAAGGAAACCCAGGACCCAAGG + Intergenic
977674967 4:99737204-99737226 AAAAAGAAACCCAGGCCCTTGGG + Intergenic
979904614 4:126271089-126271111 AAAAAGAAACCATCGCCCCTGGG + Intergenic
981201460 4:141984128-141984150 CTGTAGAAACCCTGGACCCAGGG + Intergenic
985183260 4:187288820-187288842 AAAAAGATACACTGGCCCCATGG + Intergenic
985749988 5:1668153-1668175 AAAAGGGAACCCAGGCCCCAAGG - Intergenic
985770262 5:1805478-1805500 CAAAGGAATCCATGGCCCCTGGG + Intronic
986130706 5:4927241-4927263 CAACAGCAACCCTGGTCCCTGGG - Intergenic
986442215 5:7792516-7792538 CAGAAGGTACCCTGGCCCCAGGG + Intronic
986505405 5:8444900-8444922 CAAAGGATACCCTGGTCACATGG - Intergenic
989450015 5:41575511-41575533 CAAATGCTACCCTGGCCCCCTGG + Intergenic
990906515 5:60809342-60809364 GAAATCAAACCCAGGCCCCAAGG + Intronic
991479776 5:67065161-67065183 CAAAAGCAACCCTAGACACAAGG - Intronic
993740339 5:91530863-91530885 CTAAAGTAACCATGGCTCCAGGG + Intergenic
994102072 5:95904204-95904226 CAATAGAAACCCTGCCCTCATGG - Intronic
994525758 5:100903199-100903221 GAAAAGAAACCTGAGCCCCAGGG - Exonic
994591813 5:101783472-101783494 AAAAAGAAACCTGAGCCCCAGGG - Intergenic
998488104 5:142521162-142521184 CAAAAGGCTGCCTGGCCCCATGG - Intergenic
998678284 5:144435052-144435074 CAATAAAAACCATGGACCCACGG - Intronic
1000793063 5:165630686-165630708 CAAAAGTCACCCTGCACCCAGGG + Intergenic
1000800447 5:165719890-165719912 CAGAAGATACCCTACCCCCAAGG - Intergenic
1000856290 5:166402719-166402741 AAAAAAAAACCATGGCCCTATGG - Intergenic
1001024899 5:168215791-168215813 CAGAGGAAATCCTGGCTCCATGG + Intronic
1001237758 5:170044487-170044509 GAAAAGAAACGCTCTCCCCATGG - Intronic
1001371816 5:171211615-171211637 AAAAAAAAACCCTGCCCTCATGG - Intronic
1004655678 6:17657570-17657592 CAAAACAAAACCTGGTGCCATGG + Intronic
1006267264 6:32935808-32935830 CAAATCAAACCCTCGTCCCATGG + Intronic
1006459477 6:34150068-34150090 CCAAAAAAGACCTGGCCCCAAGG + Intronic
1007757016 6:44106263-44106285 CAAAGAACTCCCTGGCCCCAAGG - Intergenic
1008559201 6:52706432-52706454 AAAGAGAAACCATGGCCACATGG - Intergenic
1011029001 6:82900721-82900743 CACAAGCAGCCCTGGCCTCAGGG - Intronic
1011482733 6:87811385-87811407 CATCAGAAACCCTGCCTCCAAGG - Intergenic
1012476369 6:99618770-99618792 CAATAGCAACCCTGGCTCCAAGG - Intergenic
1015177362 6:130324916-130324938 CACAAGAACCCCTGGCTCCTTGG - Intronic
1018489356 6:164275744-164275766 CACAAGAAAACCCGCCCCCATGG - Intergenic
1020372107 7:7443584-7443606 AAAAGGACAGCCTGGCCCCAAGG - Exonic
1020440449 7:8211488-8211510 CAAATGAAATCCAGGGCCCATGG - Intronic
1022862967 7:34387096-34387118 CCAAAGCAAGTCTGGCCCCAAGG - Intergenic
1023626315 7:42118551-42118573 GAAAAGAAACTATGGCCCCCTGG - Intronic
1023729600 7:43177990-43178012 CCAAAAAAACCCTGCCCACAGGG - Intronic
1026066236 7:67075748-67075770 AAAAAGAAACCCTATCCCCTTGG - Intronic
1026219199 7:68377729-68377751 CAAAAGTAACCCTGGACCGTAGG + Intergenic
1027369115 7:77489416-77489438 CTAAGGATACCCTGGCCACATGG - Intergenic
1028752341 7:94394836-94394858 CAAAAGTTTCCCTGGCCCTAGGG - Exonic
1031517002 7:122713007-122713029 AAAAATAAATCCTGTCCCCAAGG + Intronic
1031605787 7:123765842-123765864 TAAGAGAAACCATTGCCCCAAGG + Intergenic
1034927293 7:155132445-155132467 CTAGAGAAACCAAGGCCCCAGGG - Intergenic
1036016214 8:4787639-4787661 CAAAAGAAATCCTGGTGTCAAGG + Intronic
1036138089 8:6180750-6180772 CAAAAGAAGCCCTGGAGCCTCGG + Intergenic
1036949729 8:13129735-13129757 CATAGCAAAACCTGGCCCCATGG - Intronic
1037540070 8:19862439-19862461 CAGAGGAAACCATGCCCCCAAGG - Intergenic
1038582682 8:28763578-28763600 AAAAACAGACCCTGCCCCCAGGG + Intergenic
1039195117 8:35022404-35022426 CAGAAAAAATCATGGCCCCAAGG - Intergenic
1039437243 8:37568136-37568158 AAAAAGAATCCCCGACCCCATGG + Intergenic
1040986700 8:53302637-53302659 TAAAAGAAGCACTGACCCCAGGG + Intergenic
1042491507 8:69404123-69404145 TAAAAGAAACCAGGGCTCCAAGG - Intergenic
1043401055 8:79884849-79884871 AAAAAAAAACCCTGCCCTCATGG + Intergenic
1043944188 8:86231352-86231374 AGAAAGAAGACCTGGCCCCAGGG + Intronic
1045057642 8:98382950-98382972 GGAAAGAAATCCAGGCCCCAAGG + Intergenic
1045059595 8:98400319-98400341 CAACAGATTCCCAGGCCCCAAGG + Intergenic
1047477973 8:125253364-125253386 GAAAAGAAAGCCTGCCCCTAGGG - Intronic
1049707715 8:144050607-144050629 CAAAAGCAGCCCTGGGCCCTGGG + Intergenic
1049950500 9:639407-639429 CAAAAGAATCCCTTGAGCCAGGG - Intronic
1051196217 9:14565190-14565212 GGAAGGAAACCCTGGCACCATGG + Intergenic
1053122156 9:35555474-35555496 CCACAGAAAGCCTGCCCCCATGG + Exonic
1053130739 9:35613850-35613872 CAAAAAATACCCAGGCACCATGG + Intronic
1057062839 9:92020724-92020746 CAAAAAGAACACTGGCACCATGG + Intergenic
1059072173 9:111149410-111149432 CAGGAGAAAGCCTGGCTCCAAGG + Intergenic
1059138532 9:111830505-111830527 CCAGAAAAATCCTGGCCCCAGGG - Intergenic
1060309606 9:122447495-122447517 AAAATGAAATCCTGGCCCTATGG + Intergenic
1203785739 EBV:126402-126424 CAGGCGAAACCCAGGCCCCACGG - Intergenic
1186786122 X:12957120-12957142 CTAAAGAAACCCTAAGCCCAGGG + Intergenic
1191756685 X:64600528-64600550 GAAAAGACACCCTGCCCTCATGG - Intergenic
1192805628 X:74506142-74506164 GAAAAGGAACCCTGAGCCCATGG - Intronic
1195990180 X:110674592-110674614 CCCAAGAAACCCTGGCCATAAGG + Intronic
1197761587 X:130031866-130031888 CAATATGAACCCTGTCCCCAAGG + Intronic
1197895192 X:131305417-131305439 AGACAGAAACCCTGTCCCCAAGG - Intronic
1199771742 X:150979571-150979593 AAAATGAAACCCTGGTCCCCTGG - Intergenic