ID: 958931866

View in Genome Browser
Species Human (GRCh38)
Location 3:100215992-100216014
Sequence GTGGATTAAAAAGGACACAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958931866_958931871 28 Left 958931866 3:100215992-100216014 CCTTTGTGTCCTTTTTAATCCAC No data
Right 958931871 3:100216043-100216065 ATTCCATACCCTCCTTAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958931866 Original CRISPR GTGGATTAAAAAGGACACAA AGG (reversed) Intergenic
No off target data available for this crispr