ID: 958931871

View in Genome Browser
Species Human (GRCh38)
Location 3:100216043-100216065
Sequence ATTCCATACCCTCCTTAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958931870_958931871 -6 Left 958931870 3:100216026-100216048 CCACACAGTTGCGCATGATTCCA No data
Right 958931871 3:100216043-100216065 ATTCCATACCCTCCTTAAGCAGG No data
958931867_958931871 19 Left 958931867 3:100216001-100216023 CCTTTTTAATCCACTTGCACTCA No data
Right 958931871 3:100216043-100216065 ATTCCATACCCTCCTTAAGCAGG No data
958931866_958931871 28 Left 958931866 3:100215992-100216014 CCTTTGTGTCCTTTTTAATCCAC No data
Right 958931871 3:100216043-100216065 ATTCCATACCCTCCTTAAGCAGG No data
958931869_958931871 -5 Left 958931869 3:100216025-100216047 CCCACACAGTTGCGCATGATTCC No data
Right 958931871 3:100216043-100216065 ATTCCATACCCTCCTTAAGCAGG No data
958931868_958931871 9 Left 958931868 3:100216011-100216033 CCACTTGCACTCAGCCCACACAG No data
Right 958931871 3:100216043-100216065 ATTCCATACCCTCCTTAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958931871 Original CRISPR ATTCCATACCCTCCTTAAGC AGG Intergenic
No off target data available for this crispr