ID: 958932370

View in Genome Browser
Species Human (GRCh38)
Location 3:100221351-100221373
Sequence CAGGCTAACCACAGGGAGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958932370_958932376 2 Left 958932370 3:100221351-100221373 CCTGACTCCCTGTGGTTAGCCTG No data
Right 958932376 3:100221376-100221398 AGATGGTGTCATTTTCTTGTGGG No data
958932370_958932375 1 Left 958932370 3:100221351-100221373 CCTGACTCCCTGTGGTTAGCCTG No data
Right 958932375 3:100221375-100221397 AAGATGGTGTCATTTTCTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958932370 Original CRISPR CAGGCTAACCACAGGGAGTC AGG (reversed) Intergenic
No off target data available for this crispr