ID: 958932782

View in Genome Browser
Species Human (GRCh38)
Location 3:100225431-100225453
Sequence GGCCTCCATGAAGACCTACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958932778_958932782 18 Left 958932778 3:100225390-100225412 CCTCCTCAGAGCATTTCGAGAAG 0: 1
1: 1
2: 0
3: 10
4: 94
Right 958932782 3:100225431-100225453 GGCCTCCATGAAGACCTACAAGG No data
958932779_958932782 15 Left 958932779 3:100225393-100225415 CCTCAGAGCATTTCGAGAAGCTG 0: 1
1: 1
2: 1
3: 17
4: 135
Right 958932782 3:100225431-100225453 GGCCTCCATGAAGACCTACAAGG No data
958932777_958932782 21 Left 958932777 3:100225387-100225409 CCGCCTCCTCAGAGCATTTCGAG 0: 1
1: 1
2: 0
3: 9
4: 127
Right 958932782 3:100225431-100225453 GGCCTCCATGAAGACCTACAAGG No data
958932775_958932782 30 Left 958932775 3:100225378-100225400 CCACCTTCACCGCCTCCTCAGAG 0: 1
1: 0
2: 4
3: 38
4: 404
Right 958932782 3:100225431-100225453 GGCCTCCATGAAGACCTACAAGG No data
958932776_958932782 27 Left 958932776 3:100225381-100225403 CCTTCACCGCCTCCTCAGAGCAT 0: 1
1: 0
2: 0
3: 25
4: 205
Right 958932782 3:100225431-100225453 GGCCTCCATGAAGACCTACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958932782 Original CRISPR GGCCTCCATGAAGACCTACA AGG Intergenic
No off target data available for this crispr