ID: 958942433

View in Genome Browser
Species Human (GRCh38)
Location 3:100331176-100331198
Sequence CTGACCAACCACTTTCAAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958942433_958942435 6 Left 958942433 3:100331176-100331198 CCAACTTGAAAGTGGTTGGTCAG No data
Right 958942435 3:100331205-100331227 TGGAGTCCAAGACATATGACTGG No data
958942433_958942437 12 Left 958942433 3:100331176-100331198 CCAACTTGAAAGTGGTTGGTCAG No data
Right 958942437 3:100331211-100331233 CCAAGACATATGACTGGTGCCGG No data
958942433_958942438 27 Left 958942433 3:100331176-100331198 CCAACTTGAAAGTGGTTGGTCAG No data
Right 958942438 3:100331226-100331248 GGTGCCGGTGTGTCTTCCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958942433 Original CRISPR CTGACCAACCACTTTCAAGT TGG (reversed) Intergenic
No off target data available for this crispr