ID: 958942653

View in Genome Browser
Species Human (GRCh38)
Location 3:100332736-100332758
Sequence GACACAGCTGTTCCTCCACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958942648_958942653 23 Left 958942648 3:100332690-100332712 CCTCCTGAAGTGCTGGGATTATG No data
Right 958942653 3:100332736-100332758 GACACAGCTGTTCCTCCACCAGG No data
958942645_958942653 29 Left 958942645 3:100332684-100332706 CCTCCACCTCCTGAAGTGCTGGG No data
Right 958942653 3:100332736-100332758 GACACAGCTGTTCCTCCACCAGG No data
958942649_958942653 20 Left 958942649 3:100332693-100332715 CCTGAAGTGCTGGGATTATGTTA No data
Right 958942653 3:100332736-100332758 GACACAGCTGTTCCTCCACCAGG No data
958942647_958942653 26 Left 958942647 3:100332687-100332709 CCACCTCCTGAAGTGCTGGGATT No data
Right 958942653 3:100332736-100332758 GACACAGCTGTTCCTCCACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958942653 Original CRISPR GACACAGCTGTTCCTCCACC AGG Intergenic