ID: 958942653

View in Genome Browser
Species Human (GRCh38)
Location 3:100332736-100332758
Sequence GACACAGCTGTTCCTCCACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 273
Summary {0: 1, 1: 1, 2: 1, 3: 24, 4: 246}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958942645_958942653 29 Left 958942645 3:100332684-100332706 CCTCCACCTCCTGAAGTGCTGGG 0: 9
1: 119
2: 2640
3: 21536
4: 249291
Right 958942653 3:100332736-100332758 GACACAGCTGTTCCTCCACCAGG 0: 1
1: 1
2: 1
3: 24
4: 246
958942648_958942653 23 Left 958942648 3:100332690-100332712 CCTCCTGAAGTGCTGGGATTATG 0: 14
1: 362
2: 5321
3: 50417
4: 359651
Right 958942653 3:100332736-100332758 GACACAGCTGTTCCTCCACCAGG 0: 1
1: 1
2: 1
3: 24
4: 246
958942649_958942653 20 Left 958942649 3:100332693-100332715 CCTGAAGTGCTGGGATTATGTTA 0: 1
1: 7
2: 62
3: 620
4: 6494
Right 958942653 3:100332736-100332758 GACACAGCTGTTCCTCCACCAGG 0: 1
1: 1
2: 1
3: 24
4: 246
958942647_958942653 26 Left 958942647 3:100332687-100332709 CCACCTCCTGAAGTGCTGGGATT 0: 24
1: 195
2: 4178
3: 4456
4: 3986
Right 958942653 3:100332736-100332758 GACACAGCTGTTCCTCCACCAGG 0: 1
1: 1
2: 1
3: 24
4: 246

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958942653 Original CRISPR GACACAGCTGTTCCTCCACC AGG Intergenic
900974814 1:6010542-6010564 GACACAGCTGTGGCTCATCCAGG - Intronic
901197028 1:7445975-7445997 GACACAGCTGTGGCTGCTCCAGG + Intronic
901681531 1:10915720-10915742 GACCCACCTGTTCCTGTACCAGG - Intergenic
901724224 1:11228156-11228178 GACAATGCTTTTCCTCCCCCAGG + Intronic
901961275 1:12828433-12828455 GACCCAGCTGTTCCTTCAGTTGG + Intronic
901967868 1:12883038-12883060 GACCCAGCTGTTCCTTCAGTTGG + Intronic
901983266 1:13053303-13053325 GACCCAGCTGTTCCTTCAGTTGG + Intronic
901998823 1:13175615-13175637 GACCCAGCTGTTCCTTCAGTTGG - Intergenic
902017308 1:13318742-13318764 GACCCAGCTGTTCCTTCAGTTGG - Intronic
902369799 1:15998759-15998781 GAGACAGCTGTCCCTCTCCCAGG - Intergenic
902609431 1:17588451-17588473 GACCCAGCAGCTGCTCCACCCGG + Exonic
903063735 1:20686924-20686946 GATACTGCTCTTCCTCCATCTGG - Intronic
905340827 1:37276142-37276164 GACGCTGCTGCTGCTCCACCAGG + Intergenic
905396958 1:37672882-37672904 GACACACCTGTGCTCCCACCTGG + Intergenic
907851361 1:58258179-58258201 GACACAGCTGCTCCTTCGCGGGG - Intronic
907874345 1:58471392-58471414 TACACACCTGTTCCTAGACCTGG + Intronic
911046371 1:93632014-93632036 CACACACCTGTTCATCCATCTGG + Intronic
912501646 1:110126612-110126634 TCCACAGGGGTTCCTCCACCAGG - Intergenic
913494711 1:119417807-119417829 TAAACAGCTATTCCTGCACCTGG + Intronic
913500623 1:119469547-119469569 TAAACAGCTATTCCTGCACCTGG + Intergenic
914950281 1:152108020-152108042 GGCGCAGCTGTTCCTCCTCACGG + Exonic
914950344 1:152108524-152108546 GGCGCAGCTGTTCCTCCTCGCGG + Exonic
917083897 1:171286138-171286160 AACAAAGCTGTTACTCCAGCTGG + Intergenic
920733975 1:208514339-208514361 GGAACAACTGTTCCTCCTCCAGG + Intergenic
922194920 1:223351600-223351622 TCCACAGCTGTTCCTGCATCTGG - Intronic
1063587470 10:7365552-7365574 GAGGCAGCTGTTCTTCCACTTGG - Intronic
1064309646 10:14200968-14200990 GATTCAGCTGTTCCTGCAGCTGG - Intronic
1069574360 10:69516410-69516432 GCCCCAGCAGTGCCTCCACCTGG + Intergenic
1069829158 10:71272016-71272038 CACAAAGCTCTTCCTCCATCTGG - Intronic
1071872356 10:89809177-89809199 GCAACAGCTTCTCCTCCACCGGG - Intergenic
1072969799 10:100007418-100007440 CATACAGGTGTTCCTCCTCCCGG + Intronic
1073007290 10:100334304-100334326 GCCAAATCTGTTCCCCCACCAGG - Intergenic
1073227602 10:101936633-101936655 GACACAGCAATTCCTCCTCTGGG + Intronic
1077318828 11:1931606-1931628 AACACAGAGATTCCTCCACCAGG - Intronic
1080403542 11:31958379-31958401 GACACAGCTCTTCCCTCCCCAGG - Intronic
1083627665 11:64079785-64079807 GACCCAGCTGTACCTCCAGATGG - Intronic
1083655417 11:64226877-64226899 GCCACAGCTGCTCCTGCGCCTGG + Exonic
1085694091 11:78689389-78689411 GACACAGTTCTTCCTCTACATGG + Intronic
1086621669 11:88893629-88893651 GATACTGGTTTTCCTCCACCAGG - Intronic
1088368450 11:109063274-109063296 GACTCAGCTGTTCCTCATTCAGG + Intergenic
1091840481 12:3616914-3616936 GACACAGCAGTTACTGCACCTGG + Intronic
1092082928 12:5733048-5733070 GGCACATCTGTTTCTCCAGCTGG - Intronic
1093289353 12:17301934-17301956 GGCACAGCTATTCTTCCATCTGG - Intergenic
1097334780 12:58370069-58370091 CAAACAGCTGGGCCTCCACCAGG - Intergenic
1099199022 12:79653985-79654007 GACACAGTAGTACCTCCAACTGG - Intronic
1103614605 12:122144138-122144160 GCCTCAGATGTTCCTGCACCTGG - Exonic
1104614086 12:130254152-130254174 CACCCACCTGTTCATCCACCAGG + Intergenic
1105236265 13:18556109-18556131 GACAGTGCTGTTTCTCGACCTGG + Intergenic
1105505910 13:21009695-21009717 GTAGCAGCTGTTCCTCCATCTGG - Intronic
1105552501 13:21410856-21410878 GACAGAACTGTTCCTTCTCCTGG - Intronic
1106216737 13:27708479-27708501 GCCACAGCTGTGCCTCTACCTGG - Intergenic
1106671204 13:31907326-31907348 CACATACCTGTTCCTCCCCCAGG + Intergenic
1106773471 13:32985401-32985423 CACACAGCTGTCCCTCCACAGGG - Intergenic
1107959517 13:45545745-45545767 GACACAGGTGTCCCTACACAGGG - Intronic
1111377210 13:87396359-87396381 GACACAGCTTCTCATCCATCTGG - Intergenic
1112768373 13:102771180-102771202 GACACAGCGATTCCTTCCCCAGG - Intronic
1113949296 13:114062504-114062526 GACACAGTGGTTCCACCCCCAGG + Intronic
1114393936 14:22339512-22339534 CAGACAGCTGTTCCTACAGCTGG + Intergenic
1119063408 14:71500576-71500598 GACCCAGCAGTTCCACTACCAGG + Intronic
1119741482 14:77016509-77016531 GTCACAGGTGTGCATCCACCAGG - Intergenic
1121445449 14:93975738-93975760 GCCCAAGCTGCTCCTCCACCTGG + Intronic
1121468400 14:94130524-94130546 GACCCAGCAGTTCCACCTCCAGG - Intergenic
1122517446 14:102318902-102318924 GAAACAGCGGTTCACCCACCAGG + Intronic
1123999096 15:25739994-25740016 GACACAGCTGTTCTACCAGGAGG - Intronic
1124516772 15:30373204-30373226 TACACAGCAGTTCCTTCAGCCGG + Intronic
1124726144 15:32157527-32157549 TACACAGCAGTTCCTTCAGCCGG - Intronic
1125278952 15:38024489-38024511 GATTCACCTGATCCTCCACCAGG - Intergenic
1126273487 15:46848801-46848823 GAAGCAGCTGTACCTCCACTTGG + Intergenic
1127302432 15:57668299-57668321 GACCCAGCTATTCCACTACCAGG - Intronic
1127723037 15:61721465-61721487 GACGCAGCTGCTCCTCCAACAGG + Intergenic
1127811455 15:62568803-62568825 GACACAGCTGGGCATCCTCCAGG - Intronic
1127881288 15:63160509-63160531 GACTCAGCAATTCCTCCTCCAGG - Intergenic
1130667336 15:85880708-85880730 GGCACAGCTGCTCCTCCTTCTGG + Intergenic
1130968134 15:88712069-88712091 AACTCAGCTGTCCCTCCACTAGG - Intergenic
1131337451 15:91562836-91562858 GTCACAGCTTTTTCTGCACCAGG - Intergenic
1131511107 15:93050014-93050036 GACTCCTCTGTTCCTCCATCCGG + Intronic
1134213730 16:12299524-12299546 GAAACACCTGTTCCTCCAGGGGG + Intronic
1139619118 16:68122754-68122776 CACTCACCTGTTCCTTCACCTGG + Exonic
1140066819 16:71618489-71618511 GTCACAGCTGTTCCTTCTCTGGG + Intergenic
1141077140 16:81016957-81016979 GAGCCAGCTGTTCCTCTGCCTGG - Intronic
1141672325 16:85498813-85498835 CAGACAGCTGTTCCTTCAACTGG - Intergenic
1142072196 16:88097346-88097368 GACAAAGCATTTCCTCCACGGGG - Intronic
1142190050 16:88713312-88713334 GACCCACCTGATCCTCCACATGG + Exonic
1143148210 17:4789996-4790018 GTCCCAGCTCTGCCTCCACCGGG + Exonic
1143300145 17:5902808-5902830 GGCACACCTGTTCCTCCCCAGGG + Intronic
1144038083 17:11385264-11385286 AGCACAGTTGTTCCTTCACCTGG - Intronic
1145367625 17:22278196-22278218 GGCCCAGCTGTGCCTCCATCAGG - Intergenic
1145758100 17:27407656-27407678 GACACAGCTCTGCCCCCACAGGG + Intergenic
1145993094 17:29090908-29090930 GGCTCAGCTGCTCCTCCAGCTGG + Exonic
1146285280 17:31570413-31570435 CAAACAGCTGTACCGCCACCAGG + Intergenic
1147920197 17:43911620-43911642 GCAGCATCTGTTCCTCCACCTGG + Intergenic
1148114166 17:45165153-45165175 GACAGAGCTGTTGCCCCAGCTGG - Intronic
1149992868 17:61392493-61392515 GACAGAGTTGATCGTCCACCTGG + Exonic
1151217699 17:72589101-72589123 GACACACCTGCTACTCCAGCCGG + Intergenic
1152315459 17:79578008-79578030 AACCCTGCTGTCCCTCCACCTGG + Intergenic
1152724421 17:81938155-81938177 GCCACAGGTGTTCCTCTAACTGG + Intronic
1154513272 18:15133889-15133911 GACAGTGCTGTTTCTCGACCTGG - Intergenic
1160160521 18:76466829-76466851 GACACAGAAGTCCCTCCACCAGG + Intronic
1160683277 19:422316-422338 GACGCAGCTGTTCCTCCGTGGGG + Exonic
1160802616 19:977287-977309 CACACAGCTGTTCCACCGCCGGG + Intergenic
1161360929 19:3849295-3849317 CACACAGCTTTGTCTCCACCTGG + Intronic
1161616535 19:5274082-5274104 GCCACAGATGATGCTCCACCTGG + Intronic
1162828723 19:13270707-13270729 GGTACTGCTGTTCCTCCCCCAGG - Intronic
1164457474 19:28420741-28420763 GACTCAGCAGCTGCTCCACCTGG - Intergenic
1164678576 19:30119259-30119281 GAGGCAGCTTTTCCTCTACCTGG + Intergenic
1164803759 19:31099989-31100011 GAAACAGATGTTCCTGCTCCAGG + Intergenic
1165153582 19:33774529-33774551 GATCCAGCAGTTCCTCCACCTGG - Intergenic
1165153591 19:33774577-33774599 GATCCAGCAGTTCCTCTACCTGG - Intergenic
1165153609 19:33774648-33774670 GATCCAGCAGCTCCTCCACCTGG - Intergenic
1165161516 19:33819700-33819722 GACAATGCTGTTCCTGGACCCGG + Intergenic
1165309071 19:35019627-35019649 CACGCTTCTGTTCCTCCACCAGG - Intronic
1165310373 19:35026152-35026174 CACGCAGCTGTTCCCCCACATGG + Exonic
1167039281 19:47013103-47013125 AACACAGCTCATTCTCCACCAGG - Intergenic
1168348913 19:55664648-55664670 GACACAGATGTGCCTCCGTCTGG - Intronic
924985920 2:269797-269819 GCCACAGCATTTCCTCCCCCAGG - Intronic
925110332 2:1330087-1330109 TACACTGCTGTTCCGCCATCAGG + Intronic
926155034 2:10448728-10448750 TGCACAGCTGTGCTTCCACCTGG + Intergenic
927641648 2:24849298-24849320 GACACTGCTGAGCCTCCTCCCGG + Intronic
929047034 2:37800138-37800160 GAGACAGCTTTGCCCCCACCTGG + Intergenic
933558174 2:83857782-83857804 GACACAGCTTTTCTTCCCTCTGG + Intergenic
934781247 2:96971088-96971110 CACACAGCTTATCCTGCACCAGG + Intronic
935193109 2:100794056-100794078 GACACAGCTGTGACTCCTGCCGG - Intergenic
935333125 2:101991845-101991867 GACACACCTTTTCCTCCTCACGG - Exonic
935612223 2:105037691-105037713 GAGCCGGCTCTTCCTCCACCTGG - Intergenic
935626236 2:105174457-105174479 GAGAGAGCTGTTCCTCCTTCTGG - Intergenic
937084549 2:119162007-119162029 GACATACCTGTTTATCCACCTGG + Intergenic
937295153 2:120805682-120805704 GACACAGCTGTCCCTCAACCTGG + Intronic
937748570 2:125445965-125445987 GACACAGCTGAACATCCACTTGG + Intergenic
938513521 2:131978500-131978522 GACAGTGCTGTTTCTCGACCTGG - Intergenic
940205947 2:151201958-151201980 GACTCTGCTCTTCCTCCAACTGG - Intergenic
940215618 2:151300498-151300520 GCCATACCTGTTCCTCCACCAGG - Intergenic
943836873 2:192525019-192525041 GACACAGCTGCCCCTTCCCCCGG - Intergenic
944941705 2:204635239-204635261 GAAACAGCTGATCCTCGTCCGGG - Intronic
945542379 2:211105030-211105052 GAAACAGCTGTTCCTCATCATGG + Intergenic
946175211 2:217918399-217918421 GACACAGCCATTTCACCACCAGG + Intronic
946791428 2:223304297-223304319 GACACACCTGTTTCTCCAAGTGG - Intergenic
947920415 2:233866529-233866551 GCCCAAGCTGTTCCTGCACCTGG - Intergenic
948191291 2:236061327-236061349 GACCCAGCCATTCCTCCCCCAGG + Intronic
1169218748 20:3808341-3808363 GACACTACTGTTCCCCCAACTGG - Intergenic
1173169963 20:40715937-40715959 CAGACATCTGTTCCTACACCCGG - Intergenic
1176264191 20:64200158-64200180 GACACGGATGTGCCTACACCTGG + Intronic
1176780259 21:13184394-13184416 GACAGTGCTGTTTCTCGACCTGG + Intergenic
1177977927 21:27873416-27873438 GACAGTGCTGTTTCTCGACCTGG + Intergenic
1178703371 21:34852966-34852988 GACACATCTTTTCATCCCCCCGG + Intronic
1181747507 22:24966130-24966152 AATACAGCTGTTTCTCCAACAGG - Intronic
1183314334 22:37128731-37128753 GACGCAGCTGCTCCTGCAGCAGG - Exonic
1183721447 22:39565092-39565114 GCCTCAGGTCTTCCTCCACCAGG + Intergenic
949289527 3:2448185-2448207 CCCACAGCTTTTCCCCCACCAGG - Intronic
949892812 3:8745870-8745892 GCCACCGCTGTTGCCCCACCTGG - Exonic
950484811 3:13266869-13266891 GGCACATCTGCTCCCCCACCAGG + Intergenic
951186801 3:19722985-19723007 GACACAAGTGGTCCTGCACCCGG - Intergenic
954205791 3:49057866-49057888 GAGACTGCTGTACCTGCACCTGG + Exonic
954438315 3:50507820-50507842 TACCCAGCTCTGCCTCCACCTGG + Intergenic
956733878 3:72221398-72221420 CACACAGTTTTTCCTCCACTGGG + Intergenic
956746867 3:72317401-72317423 GGCCCAGCAGATCCTCCACCTGG + Intergenic
958942653 3:100332736-100332758 GACACAGCTGTTCCTCCACCAGG + Intergenic
960354017 3:116628924-116628946 GACACAGCTGGTGTTGCACCGGG + Intronic
961435085 3:126911406-126911428 CACAAAGCTGCTCATCCACCAGG - Intronic
961810476 3:129518970-129518992 GCCCCCTCTGTTCCTCCACCTGG + Intronic
962376488 3:134862803-134862825 GACCCTCCTGTTCCTCCTCCTGG + Intronic
962626058 3:137227157-137227179 GGAACAGCTGGTCCTCCACTGGG + Intergenic
965791089 3:172388607-172388629 CATACAGCTGTGCCTCCCCCAGG - Intronic
968231191 3:197005655-197005677 GCCACAGCTCTCCCTCCTCCTGG - Intronic
968597212 4:1491717-1491739 GACTCAGCTGTGCCACCATCAGG + Intergenic
969131618 4:4994769-4994791 GACTCAGCTTTTCCTCCAGGTGG + Intergenic
969175825 4:5398378-5398400 TACACAGATGTTGATCCACCAGG - Intronic
969371223 4:6732789-6732811 GACTCAGCTGTTCTTGCAGCTGG + Intergenic
974415260 4:61598896-61598918 GACAGAGCTGATGCTCCAACTGG + Intronic
976402742 4:84625551-84625573 TGCACAGCTGTTCCTCCGCCTGG - Intronic
976969981 4:91092676-91092698 GGCACAGCTATTCTTCCATCTGG + Intronic
979786963 4:124727672-124727694 CACAAATCTGTTCCTCCTCCTGG + Intergenic
981844700 4:149154310-149154332 GACACAGTTCTTCTTCCTCCTGG - Intergenic
984939779 4:184920912-184920934 GACACAGTTTTTCCTCCAACAGG - Intergenic
985151671 4:186953760-186953782 GTCACAGCTGTTCCGCATCCAGG - Intergenic
985529979 5:428445-428467 GGCACAGCTGCCCCTCCAGCTGG + Intronic
985673686 5:1219383-1219405 GACAGAGCTGTTCACACACCCGG - Intronic
986660722 5:10057572-10057594 GTGCCTGCTGTTCCTCCACCTGG + Intergenic
987400281 5:17468373-17468395 CACAGAGCTGTGCTTCCACCTGG + Intergenic
990483195 5:56231251-56231273 TTCACAGCAATTCCTCCACCTGG - Intronic
990684345 5:58284618-58284640 CATATAGCTGCTCCTCCACCTGG - Intergenic
992407571 5:76474607-76474629 TACACAGCTTTTCCTGCCCCTGG + Intronic
994184175 5:96800033-96800055 GACAAAGCTGTTCTTCCCTCAGG + Intronic
995933517 5:117481025-117481047 GACACAGCAATTCCACTACCAGG + Intergenic
997473800 5:134131230-134131252 CCCACAGCCCTTCCTCCACCAGG - Intronic
997764404 5:136485761-136485783 GCATCTGCTGTTCCTCCACCTGG + Intergenic
998525557 5:142840032-142840054 GACACAGGCACTCCTCCACCAGG - Intronic
998971304 5:147595418-147595440 GACACAGCTTTGCCCCCTCCAGG + Intronic
999126495 5:149250070-149250092 CACACACCTCTTCCACCACCTGG + Intronic
999250029 5:150177001-150177023 GCCAAAGCTGGTCATCCACCAGG + Intronic
1001692951 5:173646388-173646410 GACACAGCTGTTCCTCCACTGGG + Intergenic
1001936728 5:175710676-175710698 ACCACAGATGTTCCTCCTCCAGG - Intergenic
1002203533 5:177546710-177546732 GAAACAGCTGTTCTACCTCCTGG - Intronic
1002559059 5:180068819-180068841 GCCACAGCTGTTTTTCCACCAGG + Intronic
1002943304 6:1736592-1736614 GTCACAGATTTTACTCCACCTGG + Intronic
1003223137 6:4179464-4179486 GACACAGCTAATCCTCAACTTGG - Intergenic
1004239171 6:13903093-13903115 GACACTGCTGTTCATCCCACAGG - Intergenic
1004513633 6:16303286-16303308 GACACTGCGGTTCCTCCCCCGGG + Exonic
1005899912 6:30208351-30208373 GACACAGCTTTTTCTTCTCCTGG - Intronic
1005903718 6:30242146-30242168 GACACGGCTGTTCCTCCTTTTGG - Intergenic
1005980764 6:30834857-30834879 GAAACAGCTGTATCTGCACCTGG + Intergenic
1006719920 6:36143356-36143378 TACGGAGCTGTTCCTCCATCAGG - Intronic
1008568828 6:52795480-52795502 GACCCAGCAGTTCCTCTAACAGG - Intronic
1008684656 6:53911683-53911705 GACACCGAAGCTCCTCCACCTGG + Intronic
1009417681 6:63433897-63433919 TACACAGAGGTTCCTCCACAGGG - Intergenic
1010062277 6:71636531-71636553 CACACAGCTGCTCCTGCTCCAGG + Intergenic
1012364918 6:98427096-98427118 GACACAGAAGTTTCTCCACTTGG + Intergenic
1017082812 6:150685067-150685089 AACACAGCTGTGCATTCACCTGG - Intronic
1017500103 6:155016142-155016164 GACCCAGCAGTTCCTCCCCTGGG + Intronic
1017991104 6:159490505-159490527 GACAAACCTGTTGCTCCACTTGG - Intergenic
1018815509 6:167327570-167327592 CACACAGCTGTTGTTCCACACGG - Intronic
1019346276 7:532264-532286 GACACAGGAGTTCCCCCGCCTGG - Intergenic
1020720664 7:11740561-11740583 GACACAGGTGTTCCCCTTCCTGG + Intronic
1021843583 7:24743015-24743037 CACAAAGCTGTGACTCCACCAGG - Intronic
1024060829 7:45697319-45697341 GGCACAGCTGGTCCTGCCCCTGG - Intronic
1028058310 7:86276715-86276737 GACACAGTTTTTTCTCCACTAGG - Intergenic
1033180470 7:139172913-139172935 AACCAAGCTGTTCCTGCACCTGG - Intronic
1033428350 7:141265704-141265726 GAATCAGCTTTTCCACCACCAGG + Intronic
1038271649 8:26080643-26080665 GTCACAGCAGTTCCTCGACAAGG + Intergenic
1039576570 8:38628515-38628537 GCCACAGCTGGTCCTCCATTTGG - Intergenic
1041471995 8:58220876-58220898 GTCACAGCAGTTTCTCTACCCGG + Intergenic
1045381935 8:101635945-101635967 GACACAGCTGTTTCTCACCCAGG + Intronic
1048437788 8:134433827-134433849 GACCCAGCTGCTCACCCACCTGG + Intergenic
1048523040 8:135174594-135174616 TACAAAGCTGTTCCTCCCCAAGG - Intergenic
1049770800 8:144380180-144380202 CACACATCTGTTTCTACACCCGG - Intronic
1049770808 8:144380234-144380256 CACACATCTGTTTCTACACCCGG - Intronic
1049770817 8:144380288-144380310 CACACATCTGTTTCTACACCCGG - Intronic
1049770825 8:144380342-144380364 CACACATCTGTTTCTACACCTGG - Intronic
1049770834 8:144380396-144380418 CACACATCTGTTTCTACACCCGG - Intronic
1049770933 8:144381044-144381066 CACACATCTGTTTCTACACCCGG - Intronic
1049770941 8:144381098-144381120 CACACATCTGTTTCTACACCCGG - Intronic
1049770949 8:144381152-144381174 CACACATCTGTTTCTACACCCGG - Intronic
1049770957 8:144381206-144381228 CACACATCTGTTTCTACACCCGG - Intronic
1049770975 8:144381314-144381336 CACACATCTGTTTCTACACCCGG - Intronic
1049770984 8:144381368-144381390 CACACATCTGTTTCTACACCCGG - Intronic
1049770991 8:144381422-144381444 CACACATCTGTTTCTACACCTGG - Intronic
1049771008 8:144381530-144381552 CACACATCTGTTTCTACACCTGG - Intronic
1049771017 8:144381584-144381606 CACACATCTGTTTCTGCACCCGG - Intronic
1049771027 8:144381638-144381660 CACACATCTGTTTCTACACCCGG - Intronic
1049771036 8:144381692-144381714 CACACATCTGTTTCTACACCCGG - Intronic
1049771044 8:144381746-144381768 CACACATCTGTTTCTGCACCCGG - Intronic
1049771054 8:144381800-144381822 CACACATCTGTTTCTACACCCGG - Intronic
1049771064 8:144381854-144381876 CACACATCTGTTTCTACACCCGG - Intronic
1049771075 8:144381908-144381930 CACACATCTGTTTCTACACCCGG - Intronic
1049771094 8:144382016-144382038 CACACATCTGTTTCTACACCCGG - Intronic
1049771104 8:144382070-144382092 CACACATCTGTTTCTACACCCGG - Intronic
1049771112 8:144382124-144382146 CACACATCTGTTTCTACACCCGG - Intronic
1049771120 8:144382178-144382200 CACACATCTGTTTCTACACCCGG - Intronic
1049771128 8:144382232-144382254 CACACATCTGTTTCTACACCCGG - Intronic
1049771137 8:144382286-144382308 AACACATCTGTTTCTGCACCCGG - Intronic
1054775437 9:69120801-69120823 GAAATACCGGTTCCTCCACCCGG - Intergenic
1055352121 9:75400228-75400250 TACACAGCTGTCTCACCACCAGG + Intergenic
1056902530 9:90613197-90613219 CACACAGCTGCTCCTCCCGCAGG + Exonic
1057533977 9:95880171-95880193 GTCACAGCTTTTCCTCTTCCGGG - Intronic
1062165218 9:135104261-135104283 GCTCCAGCTGTCCCTCCACCTGG - Intronic
1062254596 9:135615014-135615036 AGCACAGCTTATCCTCCACCTGG + Intergenic
1185433227 X:21438-21460 GAAACAGCAGTCCCTCCACTTGG + Intergenic
1185442429 X:233506-233528 GAAACAGCAGTCCCTCCACTTGG + Intergenic
1186137335 X:6533780-6533802 GACTCAGTGGTTCCTCCACCTGG + Exonic
1186137346 X:6533840-6533862 GACTCAGTGGTTCCTCCACCTGG + Exonic
1186137356 X:6533900-6533922 GACTCAGTGGTTCCTCCACCTGG + Exonic
1186267078 X:7843779-7843801 GACTCAGTGGTTCCTCCACCTGG - Exonic
1186267088 X:7843839-7843861 GACTCAGTGGTTCCTCCACCTGG - Exonic
1186267099 X:7843899-7843921 GACTCAGTGGTTCCTCCACCTGG - Exonic
1186267108 X:7843959-7843981 GACTCGGTGGTTCCTCCACCTGG - Exonic
1186324767 X:8466026-8466048 GACTCAGTGGTTCCTCCACCTGG - Exonic
1186324777 X:8466086-8466108 GACTCAGTGGTTCCTCCACCTGG - Exonic
1186324792 X:8466176-8466198 GACTCAGTGGTTCCTCCACCTGG - Exonic
1186324802 X:8466236-8466258 GACTCAGTGGTTCCTCCACCTGG - Exonic
1186324811 X:8466296-8466318 GACTCAGTGGTTCCTCCACCTGG - Exonic
1195310955 X:103631291-103631313 GGCACAGCTGCTCCTTCTCCTGG + Intergenic
1195821593 X:108950988-108951010 AAAACAGCTGCTGCTCCACCTGG - Intergenic
1202175685 Y:22096937-22096959 GAAACACCTCTTCCTCCAGCGGG - Intergenic
1202215676 Y:22489446-22489468 GAAACACCTCTTCCTCCAGCGGG + Intergenic