ID: 958946109

View in Genome Browser
Species Human (GRCh38)
Location 3:100363857-100363879
Sequence TGAGGAGGTCACTAATTAGT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 138}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958946109_958946112 5 Left 958946109 3:100363857-100363879 CCAACTAATTAGTGACCTCCTCA 0: 1
1: 0
2: 0
3: 6
4: 138
Right 958946112 3:100363885-100363907 TTCCAAAGATTGACTTTGAAAGG 0: 1
1: 0
2: 3
3: 14
4: 262
958946109_958946113 6 Left 958946109 3:100363857-100363879 CCAACTAATTAGTGACCTCCTCA 0: 1
1: 0
2: 0
3: 6
4: 138
Right 958946113 3:100363886-100363908 TCCAAAGATTGACTTTGAAAGGG 0: 1
1: 0
2: 1
3: 26
4: 243

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958946109 Original CRISPR TGAGGAGGTCACTAATTAGT TGG (reversed) Exonic
903460526 1:23517488-23517510 GGAGGAGTTCACGACTTAGTGGG - Intronic
906289730 1:44611734-44611756 CGAGGAGAACACAAATTAGTAGG - Intronic
907652469 1:56308825-56308847 GGAAGAGGTCAATAATTAATGGG + Intergenic
908089244 1:60669144-60669166 TGAGAAAGTCACTGTTTAGTGGG + Intergenic
911143950 1:94534873-94534895 TGAGGATGCCATTAATTAGGGGG + Intronic
911972911 1:104460236-104460258 TGAGAATCTCACTTATTAGTGGG + Intergenic
1068480097 10:57579100-57579122 TGAGGAGGTCCCGAATAAGGGGG + Intergenic
1069522488 10:69135155-69135177 TAAGGAGCTTACAAATTAGTAGG - Intronic
1069939655 10:71946009-71946031 TGAGAACCTCACTTATTAGTGGG - Intergenic
1071259943 10:83910588-83910610 TGAGGAGATAATTAATGAGTTGG - Intergenic
1075278956 10:121122371-121122393 TGAGTAGGGCACTAATGGGTTGG - Intergenic
1078117569 11:8468461-8468483 GAAGGAGGTGAGTAATTAGTTGG - Intronic
1081756807 11:45550494-45550516 TTAGGAGGCCACTGAGTAGTAGG + Intergenic
1082649287 11:55768551-55768573 TTAAGAAGTCACTAATCAGTGGG + Intergenic
1083090314 11:60192703-60192725 TGAGAATCTCACTCATTAGTGGG - Intergenic
1085240170 11:75046655-75046677 TGAGAACTTCACTCATTAGTGGG - Intergenic
1085426830 11:76412194-76412216 TGAGAAGCTCACCATTTAGTAGG + Intronic
1088122199 11:106383371-106383393 TGAGAAGGGCAATAATTAATGGG - Intergenic
1090147934 11:124346786-124346808 TGAAGAGGTGACTAATTGCTAGG + Intergenic
1091814077 12:3422855-3422877 TGAGAACCTCACTTATTAGTGGG + Intronic
1097280842 12:57845021-57845043 TCAGCAGGTCACTAATTCCTGGG - Intronic
1098248812 12:68547479-68547501 TGAGAACTTCACTCATTAGTGGG - Intergenic
1101028091 12:100633515-100633537 TGAGAATCTCACTCATTAGTGGG + Intergenic
1102735018 12:115151540-115151562 TGAGGAGGCCACTGTTTAGGTGG + Intergenic
1105751743 13:23427277-23427299 AGAGGAGGTCATGAATCAGTGGG - Intronic
1107490257 13:40874586-40874608 TGAGAATCTCACTTATTAGTGGG + Intergenic
1109803419 13:67405415-67405437 TGAGAACTTCACTCATTAGTGGG - Intergenic
1110624848 13:77642269-77642291 TGAGGCTGTCACTGATTGGTTGG - Intronic
1111903443 13:94228284-94228306 TGAGGAGGTCCCTTATGATTTGG + Intronic
1114429643 14:22649694-22649716 TGAGGATGTCATTCATAAGTTGG + Intergenic
1114523136 14:23351494-23351516 ATAGGGGGCCACTAATTAGTGGG + Intronic
1115794323 14:36916292-36916314 TGAGGAGGTCACTTCTCATTTGG + Intronic
1117954867 14:61114852-61114874 TGAGAATCTCACTTATTAGTGGG + Intergenic
1121836783 14:97099459-97099481 TGTGGAGTTCACATATTAGTGGG - Intergenic
1126120930 15:45250921-45250943 TGAGGAGATCACTGTCTAGTAGG + Intergenic
1127686455 15:61350237-61350259 TTGGTAGGTCAATAATTAGTTGG + Intergenic
1130607366 15:85330138-85330160 TGGCGAGGTCACTAAATAATAGG - Intergenic
1137041281 16:35615105-35615127 TGAGAACTTCACTCATTAGTGGG + Intergenic
1137424144 16:48363367-48363389 TGAGGTGGGCACTGATCAGTAGG - Intronic
1139261456 16:65598650-65598672 TCAGAAGGACACTAATTAGGTGG + Intergenic
1141353610 16:83322481-83322503 TGAGGTGCTCATTAATTTGTTGG - Intronic
1144955490 17:19016965-19016987 TGAGGAGGCCAGGAAGTAGTGGG - Intronic
1146764587 17:35507874-35507896 TGAGAATCTCACTCATTAGTGGG - Intronic
1148082092 17:44972536-44972558 TGAGGAGTTCACTGTTTGGTGGG + Intergenic
1149429599 17:56587105-56587127 TGAGGAGGTCACAGATGATTGGG - Intergenic
1151033468 17:70770655-70770677 TGAGGATTTCAATAGTTAGTAGG + Intergenic
1158292525 18:55957485-55957507 TGAGAACCTCACTCATTAGTGGG - Intergenic
1159248587 18:65843116-65843138 TGAGTTGGTCACTAATTTTTGGG + Intronic
1159832682 18:73296788-73296810 TGATGAGGTCAAAGATTAGTTGG - Intergenic
1160449977 18:78956247-78956269 TGGAGAGCTCACTAATTACTGGG - Intergenic
1163208762 19:15824414-15824436 GGTGCATGTCACTAATTAGTGGG - Intergenic
1164130313 19:22355668-22355690 TGAGAACCTCACTCATTAGTGGG + Intergenic
1165158195 19:33800726-33800748 TGAGGAAGTCACTAATTTAGAGG + Intronic
925838361 2:7966969-7966991 CCAGGAGGTCACTATATAGTGGG - Intergenic
925967870 2:9083255-9083277 TAAGGAGATCACCAATTACTTGG + Intergenic
927832905 2:26369591-26369613 AGAGAGGGACACTAATTAGTAGG - Intronic
931053193 2:58437502-58437524 CTAGGAGGTCACTATCTAGTTGG + Intergenic
931304746 2:61017569-61017591 GGAGGATGCCACTAATTTGTAGG - Intronic
932170875 2:69554910-69554932 TGAGGAGCTCACAAATTAATGGG - Intronic
933279578 2:80318182-80318204 TGAAGAGTTCACTCACTAGTAGG + Intronic
933640232 2:84751078-84751100 TGATGAGGACTCTAATTGGTAGG - Intronic
937685709 2:124694134-124694156 TGAGTAGGTCACTAAAGAGGGGG - Intronic
937757509 2:125558021-125558043 TGAGGAGTTCACAGTTTAGTGGG + Intergenic
938342491 2:130544766-130544788 TGGGGAAGTCACCAGTTAGTTGG - Intronic
938347341 2:130575943-130575965 TGGGGAAGTCACCAGTTAGTTGG + Intronic
939255427 2:139738159-139738181 AGATGAGGTTAATAATTAGTTGG + Intergenic
944958249 2:204837692-204837714 TGAGGAGCTCACTATTCTGTAGG + Intronic
1171361545 20:24589916-24589938 GGAGGTGTTCACTAATCAGTGGG - Intronic
1175446822 20:59026933-59026955 TGAGTATCCCACTAATTAGTTGG - Exonic
1176415827 21:6474307-6474329 TGAGGAGGTGCCTGAATAGTTGG + Intergenic
1177928704 21:27251703-27251725 TGAGGAGGAAACTACTTAGGAGG - Intergenic
1179691327 21:43082641-43082663 TGAGGAGGTGCCTGAATAGTTGG + Intergenic
1183306144 22:37084216-37084238 TGAGGGGGTCACTATTGAGGAGG + Intronic
949518803 3:4830963-4830985 TGAGGAGGTGATTGATTACTCGG + Exonic
951165646 3:19482397-19482419 TGAGAACCTCACTCATTAGTGGG + Intronic
951314400 3:21170950-21170972 TAAGGAGGTCACTATGGAGTAGG + Intergenic
953575039 3:44106228-44106250 TGAGGACGTCACTCCTTAGGTGG + Intergenic
956016418 3:64888236-64888258 TGGGGAGGTCAAGAATTACTTGG + Intergenic
956086583 3:65617633-65617655 TAAGGACTTCACTAATTACTTGG - Intronic
958946109 3:100363857-100363879 TGAGGAGGTCACTAATTAGTTGG - Exonic
959022468 3:101203349-101203371 TGAGGAGCTCACCAACTAGGTGG - Intergenic
963959680 3:151295373-151295395 AGAGAAGGTCACTAATTCTTTGG - Intronic
974209849 4:58757572-58757594 TGAGGTCGTCAGTAATTTGTAGG - Intergenic
976971733 4:91111625-91111647 TTAGGAGGTCATAAATTTGTAGG + Intronic
977043133 4:92038908-92038930 TGAGAACTTCACTCATTAGTGGG + Intergenic
979421140 4:120506610-120506632 TAAGGGGGCTACTAATTAGTAGG + Intergenic
980073435 4:128267197-128267219 TGAGAACCTCACTCATTAGTGGG - Intergenic
983952371 4:173657390-173657412 TGAGTAGGCAACTTATTAGTAGG + Intergenic
987182410 5:15381495-15381517 TCAGGAGGTGACCAGTTAGTGGG + Intergenic
987779078 5:22409475-22409497 TTAGGATATCACTAATTATTTGG + Intronic
989176491 5:38532534-38532556 TGAGGAGGTCAGTAAGCAGGAGG + Intronic
991675741 5:69088279-69088301 TGAGAACCTCACTCATTAGTGGG + Intergenic
993119547 5:83757840-83757862 TGGGGAGTTCACTTATTATTTGG - Intergenic
993320681 5:86465219-86465241 TGAGAATCTCACTTATTAGTGGG - Intergenic
996390818 5:122959162-122959184 TGAACAGGTCTCTAACTAGTAGG - Intronic
1001133411 5:169082468-169082490 TGAGGAGTTTACAATTTAGTTGG - Intronic
1001890004 5:175330899-175330921 TTATTAGGTCACTAATTATTAGG + Intergenic
1002972218 6:2035377-2035399 TGAGGAGCTGACTCATGAGTTGG - Intronic
1003633891 6:7813810-7813832 TGAGGGGGTCACTCTTTAGGTGG - Intronic
1005462357 6:26081278-26081300 TGAGAATCTCACTCATTAGTGGG - Intergenic
1007118862 6:39363894-39363916 TGAGGAGCTCACTACTTTGCAGG + Intronic
1008123897 6:47647653-47647675 TGAGAACCTCACTCATTAGTGGG - Intergenic
1008583424 6:52927122-52927144 TGAGAATTTCACTAATTAGTGGG - Intergenic
1012383688 6:98652128-98652150 TGAGGAGGTCAAGTATTAGGTGG + Intergenic
1014392785 6:120884382-120884404 TGATTAGGTTACTAATGAGTTGG - Intergenic
1015745584 6:136506329-136506351 CGAAGAGGTCACTAAATAGCTGG + Intronic
1020517698 7:9144220-9144242 CTAGGAGGTCACTAGTTAATAGG + Intergenic
1021939879 7:25668915-25668937 CGAGGAGCTCACCAAATAGTTGG - Intergenic
1023280650 7:38565686-38565708 TGGGGAGGTCACAATTCAGTGGG + Intronic
1028018562 7:85743861-85743883 TGAGAAGTTCACTTAGTAGTCGG + Intergenic
1028485399 7:91352046-91352068 TGAGGAGGGCACATATTATTAGG + Intergenic
1031450946 7:121917279-121917301 TGATGACATCTCTAATTAGTAGG - Intronic
1032067231 7:128780720-128780742 TGAGAAGGTAACTGAGTAGTTGG - Intergenic
1033461868 7:141553680-141553702 AGAGGAGTTCAAGAATTAGTTGG + Intronic
1034452979 7:151147714-151147736 GGGGGAGGTCACTAATGACTGGG - Intergenic
1039876576 8:41591450-41591472 TGAGAACCTCACTCATTAGTGGG + Intronic
1040856111 8:51949747-51949769 TGTGGAGATCACTGATTGGTTGG - Intergenic
1041031167 8:53736741-53736763 TGAGAATCTCACTTATTAGTGGG - Intronic
1041395860 8:57390516-57390538 TAAGGAGATCACCAATTACTTGG - Intergenic
1041729561 8:61050990-61051012 AGAGGAGGTCACTCCTCAGTCGG - Intergenic
1047378480 8:124330048-124330070 TGAAGAAGCCACAAATTAGTAGG - Intronic
1047878750 8:129169837-129169859 TGAGGAGGTTACAAAATATTGGG - Intergenic
1052366636 9:27619346-27619368 TGAGTAGATCACTACTAAGTAGG - Intergenic
1052508503 9:29384185-29384207 TGAGAATCTCACTCATTAGTGGG - Intergenic
1058147830 9:101431173-101431195 TTAGTGGGTCACTAATTAGCTGG - Intronic
1058598738 9:106645784-106645806 TGAGGAGAACACAGATTAGTCGG - Intergenic
1062066849 9:134533070-134533092 TGGGGAGTTAACTACTTAGTGGG - Intergenic
1186472657 X:9833513-9833535 TTATGAGGTCCCTAATTAGGAGG - Intronic
1188561921 X:31478297-31478319 TGAGGAGGTCAATACTGAGTGGG - Exonic
1190425403 X:50330471-50330493 TGAGAACCTCACTCATTAGTGGG + Intronic
1190752805 X:53376821-53376843 TGAGGAGCTCACTGTTTAGTTGG - Exonic
1190771712 X:53520282-53520304 TGAGAACTTCACTCATTAGTGGG - Intergenic
1193624672 X:83803328-83803350 TGTGGAGGTCACAATTTAGAAGG - Intergenic
1196869710 X:120101201-120101223 TGAGAACCTCACTCATTAGTGGG - Intergenic
1197986314 X:132269680-132269702 TTAGGAGGTCATTGTTTAGTCGG - Intergenic
1198314997 X:135456247-135456269 TGATTAGGTCACTAATCAGTTGG - Intergenic
1199606285 X:149582312-149582334 TGAGAAGGTCATAAATTATTTGG - Exonic
1199632837 X:149787056-149787078 TGAGAAGGTCATAAATTATTTGG + Exonic
1199984232 X:152938854-152938876 TGAGGAGGGTACTACTTAGGTGG + Intronic
1200802559 Y:7399747-7399769 TCAAGAGCTCACTAATCAGTTGG + Intergenic
1200925680 Y:8652456-8652478 TGAGGATCTCACTTATTAGTGGG - Intergenic
1201259727 Y:12147168-12147190 TGAGAACCTCACTCATTAGTTGG + Intergenic
1201362490 Y:13168053-13168075 TGAGTATCTCACTTATTAGTGGG + Intergenic
1202127166 Y:21578829-21578851 TGAGAATCTCACTTATTAGTGGG - Intergenic
1202152093 Y:21852692-21852714 TGAGAATCTCACTTATTAGTTGG + Intergenic