ID: 958949529

View in Genome Browser
Species Human (GRCh38)
Location 3:100401309-100401331
Sequence CCTTCTTTCCTGAAGGTAGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 273
Summary {0: 1, 1: 0, 2: 3, 3: 15, 4: 254}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958949529_958949537 9 Left 958949529 3:100401309-100401331 CCCTCTACCTTCAGGAAAGAAGG 0: 1
1: 0
2: 3
3: 15
4: 254
Right 958949537 3:100401341-100401363 CCTCTTGCCTACTGAAGCCGAGG 0: 1
1: 0
2: 0
3: 5
4: 81
958949529_958949538 12 Left 958949529 3:100401309-100401331 CCCTCTACCTTCAGGAAAGAAGG 0: 1
1: 0
2: 3
3: 15
4: 254
Right 958949538 3:100401344-100401366 CTTGCCTACTGAAGCCGAGGAGG 0: 1
1: 0
2: 1
3: 5
4: 86
958949529_958949544 29 Left 958949529 3:100401309-100401331 CCCTCTACCTTCAGGAAAGAAGG 0: 1
1: 0
2: 3
3: 15
4: 254
Right 958949544 3:100401361-100401383 AGGAGGGGCGCGTATACAGCGGG 0: 1
1: 0
2: 0
3: 5
4: 48
958949529_958949539 13 Left 958949529 3:100401309-100401331 CCCTCTACCTTCAGGAAAGAAGG 0: 1
1: 0
2: 3
3: 15
4: 254
Right 958949539 3:100401345-100401367 TTGCCTACTGAAGCCGAGGAGGG 0: 1
1: 0
2: 0
3: 7
4: 93
958949529_958949543 28 Left 958949529 3:100401309-100401331 CCCTCTACCTTCAGGAAAGAAGG 0: 1
1: 0
2: 3
3: 15
4: 254
Right 958949543 3:100401360-100401382 GAGGAGGGGCGCGTATACAGCGG 0: 1
1: 0
2: 1
3: 4
4: 81
958949529_958949540 14 Left 958949529 3:100401309-100401331 CCCTCTACCTTCAGGAAAGAAGG 0: 1
1: 0
2: 3
3: 15
4: 254
Right 958949540 3:100401346-100401368 TGCCTACTGAAGCCGAGGAGGGG 0: 1
1: 0
2: 1
3: 7
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958949529 Original CRISPR CCTTCTTTCCTGAAGGTAGA GGG (reversed) Exonic
901149867 1:7094095-7094117 ATTTCTTTCCTAAAGGCAGAGGG + Intronic
902354036 1:15882983-15883005 CCTTCTTCCCAGAAGAGAGAGGG + Intronic
902538769 1:17137587-17137609 GCTTCTTTCCTCCAGGTACAGGG - Intergenic
905356176 1:37386445-37386467 CTGACTTTCCTGAAGGGAGAAGG - Intergenic
906188197 1:43877810-43877832 GCCCCTTCCCTGAAGGTAGAGGG + Intronic
906456424 1:46001146-46001168 CCTTGGTTCCAGCAGGTAGAGGG - Intronic
907682394 1:56577284-56577306 CCTACCTTCCTGAAGGCAGCTGG - Intronic
911116665 1:94252745-94252767 CCTTCCTTCTTTAAAGTAGAGGG + Intronic
911965095 1:104358460-104358482 ACTTCTTTCCCTAAGGTTGATGG - Intergenic
912258319 1:108083743-108083765 TCTTCTTTCCTAAAGGCACAGGG - Intergenic
912376317 1:109212751-109212773 CCCCCTTTCCTGGAGGTTGAAGG + Intergenic
913323675 1:117607585-117607607 CCCTCTTTCCTGCACGCAGAGGG - Intronic
913441983 1:118907854-118907876 ACTTCTTTCCTGAAGCTCGCAGG + Intronic
913531708 1:119738343-119738365 CCTTCTTTCCTCAGGATGGAGGG - Intronic
917067234 1:171110215-171110237 CCTTCTTTCCAGATAGTAGCAGG + Intronic
917079777 1:171245690-171245712 TCATCTTCCCTGAAGGTAGGAGG + Intergenic
917719286 1:177770815-177770837 CCTTCTTTTTGGAGGGTAGAGGG + Intergenic
919000479 1:191825966-191825988 CCTTCATTCCTGAAGGGTGTGGG + Intergenic
919224113 1:194671801-194671823 TCATCTTTCATGGAGGTAGAAGG + Intergenic
919888975 1:201956111-201956133 AATTCTTTCTTGAGGGTAGAGGG + Intronic
920375939 1:205508032-205508054 CCTTCTTTCCCTGAGGTAGGAGG + Intronic
920683212 1:208089130-208089152 ACATCTTTCCAGAAGGCAGATGG - Intronic
920901180 1:210111942-210111964 TTATCTTTCCTGAAGGTTGAGGG + Intronic
920978501 1:210808972-210808994 CCTTCCTTTCTGAAAATAGAAGG - Intronic
922161931 1:223084496-223084518 CCTTCTTTCCTGAGGGCCTAAGG - Intergenic
923140271 1:231155962-231155984 ACATTTTTCCTGAGGGTAGAAGG + Intergenic
923548133 1:234939772-234939794 CCTGCTTTCCGGCAGCTAGAAGG - Intergenic
923794761 1:237142995-237143017 CCTTCTTTTTTCAAGGAAGAAGG - Intronic
1063288326 10:4713776-4713798 TCTTCTTTCCTGAAGGTGGAAGG + Intergenic
1063355814 10:5397411-5397433 CCTTCTTATCTGAAGCTATAAGG + Intronic
1063710624 10:8474251-8474273 TGTTCTTTCCTGGAGGTAAAAGG + Intergenic
1065788684 10:29240115-29240137 CCTTCTTTCCTGCGGGTCCAGGG - Intergenic
1066217011 10:33297775-33297797 CCCTCTGTCCTGACGGCAGAGGG + Intronic
1066438500 10:35415463-35415485 AACTCTTTCCTGAAGGCAGAAGG + Intronic
1070340177 10:75491040-75491062 CCTTCCTTCCTGATGGTATGGGG - Intronic
1074387761 10:113030576-113030598 CTTTTCTGCCTGAAGGTAGATGG + Intronic
1075398664 10:122145808-122145830 CTTTCTTTCCTGAGGTCAGATGG + Intronic
1076119641 10:127925336-127925358 CATTCTTTCCTGAAGGAATAAGG - Intronic
1076797002 10:132803244-132803266 CCTTCTGTCCTGAGGGTTGTGGG + Intergenic
1077846806 11:6034079-6034101 CCCTCTTATCTGAAGGCAGAAGG + Intergenic
1077942304 11:6856085-6856107 CCTGCTGGCCTGCAGGTAGACGG - Intergenic
1078469984 11:11578973-11578995 CCTTCCTTCCTGAAGCCAGGGGG - Intronic
1080348974 11:31359608-31359630 CCATGTTTCCTGAAGCTACAGGG - Intronic
1081179214 11:39966532-39966554 CTTTCTTTCCTTCAGGTAAATGG + Intergenic
1081237645 11:40664693-40664715 CCTTGTTTCTTGAAGGTCTAGGG - Intronic
1082810832 11:57477870-57477892 TCTTGTTTCCTGAAGGAACAGGG - Intergenic
1082863164 11:57874275-57874297 CCTTCTTTGCTGAACATTGAGGG + Intergenic
1083634107 11:64110911-64110933 CCTACTTTCCTGGAGCCAGAGGG + Intronic
1084161022 11:67350298-67350320 CCCTCTATCCTGGGGGTAGATGG - Intronic
1086472666 11:87132035-87132057 CCTTTTTTCCTGTAACTAGATGG - Intronic
1087698003 11:101402970-101402992 CCTTCATTCAACAAGGTAGATGG - Intergenic
1087984266 11:104658068-104658090 CATTGTCTCCTGCAGGTAGATGG + Intergenic
1088674193 11:112175756-112175778 GCCTCTTTCCTGAAGGTTGCTGG + Intronic
1092009824 12:5100086-5100108 CCATCCTCCCTGAAGGCAGAGGG - Intergenic
1092283248 12:7113484-7113506 CCTTCTGTCCTGAAAGGGGAAGG + Intergenic
1092863352 12:12738821-12738843 CCTTTGTTCCTGAGGATAGAAGG + Intronic
1094330373 12:29285516-29285538 CCTTCCTTCCTTAAAGTAAATGG - Intronic
1095294609 12:40513917-40513939 CCTTATTTCCTGAGCTTAGAAGG + Intronic
1097988023 12:65804762-65804784 CCTCCCTTCCTGAAAGCAGAGGG - Intergenic
1098000103 12:65932118-65932140 TCTTCTTCCCAGAAGGAAGAGGG + Intronic
1099977634 12:89562781-89562803 CTTTTATTCCTGAAAGTAGAGGG - Intergenic
1099990019 12:89710374-89710396 CCATCTTTCCTGAGGGGAAAAGG + Intergenic
1100182247 12:92098315-92098337 TGTTCCTTCCTGAAGGTAGGAGG - Intronic
1100667642 12:96771828-96771850 CCTTCTGTCCTGCATGGAGAAGG - Intronic
1102589453 12:113946432-113946454 GCTTCCTTCTTGATGGTAGATGG + Exonic
1104003711 12:124877475-124877497 CCTTCTTTCTTGAAGGCAGAGGG + Intronic
1104450255 12:128863290-128863312 CCTTCTTTCCTTCTGGTACAAGG + Intronic
1104689914 12:130818073-130818095 GCTTCGTTTCTGAAGGGAGAAGG + Intronic
1107036130 13:35904633-35904655 CCTTCTTTCCTAAAGGCAAAAGG - Intronic
1107384031 13:39888976-39888998 CTTTCATCTCTGAAGGTAGAGGG + Intergenic
1108250495 13:48562716-48562738 ATTTCTTACCTGAAGGGAGAAGG + Intergenic
1109402119 13:61846465-61846487 CCATATTTCCTGATTGTAGATGG - Intergenic
1114628906 14:24147093-24147115 CGGTCTGTCCTGAAGGCAGAGGG - Exonic
1116334183 14:43636147-43636169 TCTTCTTTCCTGCAACTAGAAGG - Intergenic
1117424737 14:55581323-55581345 CCTTCTTTCCTGTGGGAGGAAGG + Intronic
1117573022 14:57068098-57068120 GCATTTTTCCTGAAGGTAAAAGG + Intergenic
1117620450 14:57580896-57580918 CCTTCGTTCCTGAGGACAGAAGG + Intronic
1117642309 14:57812897-57812919 CCTTCCTCCCTGAGGGTTGAAGG + Intronic
1119119495 14:72061058-72061080 CCTCCTCCTCTGAAGGTAGATGG + Intronic
1119198147 14:72732620-72732642 CCTTTTTTTCTGAAGGTATCAGG + Intronic
1119280499 14:73403158-73403180 CCTTCTTCCTTGAATGTAGGTGG + Intronic
1120381715 14:83789202-83789224 GCTTCTTTTCTGGAGGGAGAAGG + Intergenic
1122244414 14:100391870-100391892 CCTTCTCTCCTGAGTGTACATGG + Intronic
1124558654 15:30750387-30750409 TCTTCTTTCCTGCAGATGGATGG + Intronic
1124672597 15:31655243-31655265 TCTTCTTTCCTGCAGATGGATGG - Exonic
1125039378 15:35166189-35166211 GCTCCTTTCCTCAGGGTAGAAGG - Intergenic
1125898557 15:43324252-43324274 CCTTCATTACTGAAGTTAAAAGG + Exonic
1128448756 15:67788434-67788456 GCTTCATTATTGAAGGTAGATGG + Intronic
1128464895 15:67902161-67902183 CCCTCATTCCTGGAGGTTGATGG - Intergenic
1130690176 15:86075534-86075556 ATTTCTTTCCTGAGAGTAGAAGG - Intergenic
1132783158 16:1639738-1639760 CCTTCTTTCTTCATGGCAGATGG - Intronic
1133699239 16:8293798-8293820 CCTTCTGTCATGGAGATAGAGGG + Intergenic
1134369895 16:13613490-13613512 CCTTATTTCCCAAAGGAAGATGG + Intergenic
1136228840 16:28875561-28875583 CCTTGTGTCCTGTAGGGAGATGG + Intergenic
1140809035 16:78559270-78559292 CGTTCTTCCCTGAAGCCAGAGGG - Intronic
1141784026 16:86186536-86186558 TTATCTTTCTTGAAGGTAGAAGG + Intergenic
1142850913 17:2704353-2704375 CCATCTTACCTGCAGGGAGAAGG + Exonic
1143304646 17:5936726-5936748 CCCTCTTCCCTGGAGGGAGATGG + Intronic
1147671715 17:42180461-42180483 CCTTTTTTTCTGGAGGTAGTGGG + Intronic
1147772835 17:42879517-42879539 GCTTCTTTCTTGAAGGTGGAAGG - Intergenic
1148743358 17:49905462-49905484 GCTTCTTTCCTGCTGGGAGATGG + Intergenic
1151744024 17:76001859-76001881 CCTTGTTTCTTGCAGGGAGATGG + Exonic
1151813509 17:76459232-76459254 CCCTCCTTCCTGAAGATACAGGG + Exonic
1152003649 17:77663238-77663260 CCTGTTTTCCTGCAAGTAGACGG - Intergenic
1153053015 18:918065-918087 TCTTCCTTCTTTAAGGTAGATGG + Intergenic
1154228278 18:12528510-12528532 CCTTCATTCCTGAATGTCCAGGG - Intronic
1155149063 18:23108084-23108106 CGTTCTCTCCTGAGAGTAGAGGG - Intergenic
1155628456 18:27863318-27863340 CTTACTTTCTGGAAGGTAGAAGG + Intergenic
1156455858 18:37293638-37293660 CCTTCCTTCCTGCAGGAATAAGG - Intronic
1157685959 18:49642739-49642761 CCTTCTTTCTTAAAGCTGGATGG + Intergenic
1158378381 18:56900361-56900383 CATTCATTCTTGAAGGGAGATGG + Intronic
1158513295 18:58110224-58110246 CCTTCTTCCCCAAAGGTAGCTGG + Intronic
1159804799 18:72943218-72943240 GTTTCCTTCCTGTAGGTAGAGGG - Intergenic
1161966449 19:7551507-7551529 CCTTCTTTCCTGAGGGATGCTGG + Intronic
1164510448 19:28892434-28892456 TCTGCTTTCCTGAAGGCAGAGGG + Intergenic
1165473797 19:36017983-36018005 TCTTCTTGCCTAAGGGTAGAAGG + Exonic
1166538581 19:43591498-43591520 CCTTCTGTCCTGAAGGGAGTTGG - Exonic
925266733 2:2571264-2571286 CCTTCCTTCCTGAGGGTACCTGG - Intergenic
925536871 2:4927287-4927309 ATTTCTTTCCTGAAGCTAGGTGG - Intergenic
926774092 2:16405049-16405071 ACTCCTCTCCTGGAGGTAGAAGG + Intergenic
928395984 2:30943712-30943734 CCTTCATTTCTAAAGGGAGAGGG - Intronic
928419885 2:31130273-31130295 AGTTCTTTCCTGAAGGAAGGAGG - Intronic
928438510 2:31272083-31272105 CCTACATTCCTGAAGAGAGAAGG - Intergenic
929183214 2:39066083-39066105 CCTTCTACCCTGAAGGCTGAGGG - Intronic
930416574 2:51097093-51097115 CCTTCTTTCCCTAAGGCAGGAGG + Intergenic
931572982 2:63689334-63689356 GTTTCTTTTCTGAAGTTAGAGGG - Intronic
933101282 2:78261476-78261498 CCTTCTTCCCTGCAGGAGGAGGG - Intergenic
933141366 2:78795243-78795265 CTCTCTTTCCTGAAGGTAAAAGG - Intergenic
935446638 2:103164266-103164288 CTTTCTTTGCTCAAGGGAGACGG + Intergenic
936084716 2:109459429-109459451 CCTTCATTCCTGAAGGGACTGGG + Intronic
936605178 2:113944863-113944885 CATTCTTTACTCAAGGTAGCAGG + Intronic
941303819 2:163835706-163835728 CCTTCTTCCCTGAAGGTGGTCGG - Intergenic
941857796 2:170248209-170248231 CCTTCCTTCCGGAAGGGTGAAGG + Intronic
942508498 2:176669999-176670021 CCTGCTCTCCTGAAAGTAAATGG - Intergenic
943262151 2:185679760-185679782 CCTGCTTTCCTGATGATGGAAGG - Intergenic
943976534 2:194485559-194485581 CATTCTTTCCTGAAGGTTCTAGG - Intergenic
944211201 2:197208341-197208363 CATTCTTCCCTTAAGGTGGAAGG - Intronic
944297910 2:198088499-198088521 GCTTTTTTCCTCAAGGTAGCAGG - Intronic
944452950 2:199861643-199861665 CCTTCTTTGCTGATTGTACATGG - Intergenic
944779411 2:203002753-203002775 CCTTGTTTTCAGCAGGTAGAAGG + Intronic
945753649 2:213819427-213819449 CTTCCTTTTCAGAAGGTAGATGG + Intronic
945863349 2:215148923-215148945 CCTTAGTTCCTGATGGTAAATGG - Intergenic
1168831708 20:848617-848639 ACTTCTATCATGAAGGTGGATGG + Intronic
1168961116 20:1870649-1870671 CCTTCTTTCCTGAGGAGAGCTGG + Intergenic
1170099443 20:12682604-12682626 TGTACTTTCATGAAGGTAGATGG + Intergenic
1170247203 20:14234459-14234481 ACATATTTCCTGAAGGTATATGG + Intronic
1170548763 20:17457439-17457461 CCTTTTCTTGTGAAGGTAGAGGG - Intronic
1173639654 20:44591952-44591974 CCTTCTTGGCTGCAGGGAGAGGG - Intronic
1174553275 20:51376476-51376498 CCATCTTTACAGAGGGTAGAGGG + Intergenic
1174910214 20:54600103-54600125 CATTCCTTCCAGAAGGAAGATGG + Intronic
1175475086 20:59266820-59266842 CCCTCCTTCCTGAAAGGAGAGGG - Intergenic
1176424879 21:6542230-6542252 CCTCCTTTACTCAAGGTGGACGG - Intergenic
1179448749 21:41453104-41453126 CCTTCTGCCGTGATGGTAGAAGG - Intronic
1179700368 21:43150539-43150561 CCTCCTTTACTCAAGGTGGACGG - Intergenic
1184608918 22:45590278-45590300 CCTTCACTCCGGAAGGCAGAGGG + Intronic
949312103 3:2711502-2711524 CCTACTTTTCTGAAGGAAGAAGG + Intronic
949445873 3:4132944-4132966 CCTTCATTCCTGAAGGGTGTGGG - Intronic
953291958 3:41674551-41674573 CCTCCTTTCTTCAAGGTAGTTGG - Intronic
953864538 3:46572878-46572900 CCTTCTTTGCTGGGGGAAGAGGG + Intronic
956397504 3:68841428-68841450 CCTTCTTTCCTGACAGGACAAGG + Intronic
956730613 3:72193530-72193552 CCATATTTCCTGCAGTTAGATGG + Intergenic
958170154 3:89929082-89929104 AGTTCTCTCCTGAAGGGAGATGG + Intergenic
958949529 3:100401309-100401331 CCTTCTTTCCTGAAGGTAGAGGG - Exonic
959831771 3:110871495-110871517 CTTTTTTTCTGGAAGGTAGAGGG + Intergenic
963730963 3:148971698-148971720 ATTTGTTTCCTGGAGGTAGAGGG - Intergenic
964741878 3:159975039-159975061 CCTTCTTTCCTAGAGGTTGTTGG - Intergenic
967726442 3:192866940-192866962 CCTTCCTCCCAGAAGGGAGAAGG + Intronic
970202789 4:13626978-13627000 CCTTCTTTCTTGAAGGTTTCTGG - Intronic
970279628 4:14440184-14440206 TTTTATTTCCTGAAGGTAAATGG + Intergenic
970526535 4:16938195-16938217 CCTTCTAGCCTGCAGGTAGTAGG - Intergenic
973304534 4:48630563-48630585 CCTTTTTTCCTAAAAGGAGATGG - Intronic
975845377 4:78519650-78519672 CCTTCTGTCCTGATGCTGGAAGG + Intronic
976278662 4:83304713-83304735 CTTTCCTTCTTGAAAGTAGAGGG + Intronic
978173762 4:105705339-105705361 CTTGCTTTCCTGCAGCTAGACGG - Intronic
978870714 4:113573735-113573757 CCTTCTTTCTTTTAGGTAGGAGG - Intronic
979484623 4:121256424-121256446 CTTTCTTTTCTGAAATTAGATGG + Intergenic
981291523 4:143082170-143082192 CTTTCCCTCCTGAATGTAGATGG - Intergenic
981312549 4:143311347-143311369 CCTTTCTTCCTGAAGGGAGGAGG + Intergenic
981436391 4:144727858-144727880 CCTTTTTTCCTAAAGTAAGAGGG + Intronic
982666270 4:158268450-158268472 CATTCTATTCTTAAGGTAGAGGG + Intergenic
984541095 4:181037896-181037918 TCTTGTTTCCTGAAGGAAAAAGG + Intergenic
985292804 4:188404097-188404119 GTCTCTTTCCTGTAGGTAGAGGG + Intergenic
985588482 5:752887-752909 CCTTCTTTCCTGGATGAAGAGGG - Intronic
985603153 5:845342-845364 CCTTCTTTCCTGGATGAAGAGGG - Intronic
985774931 5:1836537-1836559 CATTCTTTCCTGGAGGCAGCAGG + Intergenic
986358295 5:6950240-6950262 CCTTCTTTCCTCAAGATGTACGG - Intergenic
986716039 5:10524344-10524366 CCGTCTTTAATGAAGGCAGATGG - Intergenic
987290684 5:16505628-16505650 CCAGCTGTCCTGAAGGGAGAGGG - Intronic
988671174 5:33383644-33383666 ATTTCTTTCCTCAAGGTACAGGG - Intergenic
990262763 5:54042850-54042872 CCTTCTTTCCTGCTTGGAGAAGG + Intronic
990499957 5:56386195-56386217 CCTTGATTCCTGAAGGTTGCAGG - Intergenic
992262794 5:74987573-74987595 CCTTCTTTTCTGATGGCACAGGG + Intergenic
994301827 5:98156986-98157008 CTTTCTTTCCTGCAGGTAAGAGG - Intergenic
994527875 5:100929129-100929151 TCTTATTTCCTAAAGATAGAGGG - Intergenic
996164669 5:120210351-120210373 CCTTCATTCCTGAAGGGTCAGGG + Intergenic
997651719 5:135526768-135526790 CCATTTTCCCTGAAGGGAGAAGG - Intergenic
998253608 5:140568612-140568634 CCTTCTTGCATGAAAGTGGAAGG - Exonic
998885592 5:146690804-146690826 CCTTCTGTACTGAAGGTACAGGG - Intronic
999261358 5:150240873-150240895 CCTTCTTTCCAGCAGGGAGAGGG - Intronic
999629117 5:153551920-153551942 CCTTCTTTCTTGAAGGAATTAGG - Intronic
999921680 5:156328598-156328620 CATTCTGTCCTGTTGGTAGAAGG + Intronic
999954455 5:156685404-156685426 GCTTCTTTCCTGCAGGGAAATGG + Intronic
1001217474 5:169869214-169869236 TGTTCTTCCCTGAATGTAGATGG - Intronic
1002215079 5:177625606-177625628 TCTTCTTTGCTGAGGGCAGAAGG - Intergenic
1002703475 5:181143731-181143753 CCTGCTTCCCTGAAGATGGAAGG + Intergenic
1003460814 6:6326034-6326056 TCATCTTTCCTGAAAGAAGAAGG - Intergenic
1004770777 6:18778662-18778684 CATTCTTTCCAAAAGGAAGATGG - Intergenic
1006436688 6:34029398-34029420 ACTTGTTTCCTGAAGGCACAGGG + Intronic
1007296365 6:40824645-40824667 CCTTCCTCCCTGCATGTAGACGG - Intergenic
1008114768 6:47535657-47535679 CATTATTGCCTGAAGGTGGATGG + Intronic
1008468824 6:51860248-51860270 CCATCTTGCCTGATGGGAGATGG - Intronic
1012165884 6:95951255-95951277 CCTTCTTTCCTTAGCTTAGAAGG - Intergenic
1013387112 6:109642589-109642611 CACACTTTCCTCAAGGTAGAGGG - Intronic
1013695827 6:112701481-112701503 CCTTCATTCCTGAAGGGAGATGG + Intergenic
1014052256 6:116968529-116968551 CCTTGTGTCCTGCAGGAAGAAGG + Intergenic
1014538615 6:122647896-122647918 CCTTCATTCCTGAAGGGACTGGG + Intronic
1014824126 6:126028766-126028788 CCTGCTTTCCTGGAGCTAGTGGG - Intronic
1015104156 6:129516910-129516932 CTTTTTATGCTGAAGGTAGAGGG + Intergenic
1015244036 6:131057735-131057757 AATTCTTTCATGAAGGTTGATGG + Intronic
1015560003 6:134503829-134503851 TTTTCTTCCCTGAAGGCAGATGG - Intergenic
1017001160 6:149998877-149998899 TCATCTTTCCTCAAGGTGGAAGG - Intergenic
1017010869 6:150063344-150063366 TCATCTTTCCTCAAGGTGGAAGG - Exonic
1018614861 6:165677149-165677171 TCTGCTTTCCTGAAAGTTGACGG - Intronic
1018904000 6:168064702-168064724 CCTTCTGTCCTGAAGGCCCAAGG - Intronic
1019577235 7:1743437-1743459 CCTTCCTTCCAGAAGGGAGGTGG + Intronic
1021036299 7:15803481-15803503 CCTTCTTTTGTGAAAATAGAAGG + Intergenic
1021162472 7:17292971-17292993 CCTTCCTGCCTGAATGTAGATGG - Intergenic
1021401132 7:20210554-20210576 CATTATTTCCTGAAGGCAGTGGG - Intronic
1022258925 7:28685474-28685496 CCTTTTTTCCTGGAGCTGGATGG - Intronic
1023207484 7:37766438-37766460 CCTGCTTTGCTGAAGACAGAGGG + Intronic
1024866356 7:53908228-53908250 CCTTCATTCCTGAAGGGTGTGGG - Intergenic
1026181498 7:68045083-68045105 CTTGTTTTCCTGCAGGTAGACGG + Intergenic
1027752335 7:82165214-82165236 CCTCCTTTCCTGAGAGGAGAGGG + Intronic
1027888208 7:83936669-83936691 CTTTCTTTCCTGAAGTAAGGTGG + Intergenic
1028093627 7:86733434-86733456 TCTTCCTTCCTGAAGGTACCAGG + Intronic
1030079757 7:105767254-105767276 CCAGCTTTCCTGGGGGTAGAAGG + Intronic
1033530489 7:142257965-142257987 CTTTCTTCCCTGAAGACAGAGGG - Exonic
1033724443 7:144098838-144098860 CTTTCCTTCCTGGTGGTAGAAGG - Intergenic
1035917867 8:3644631-3644653 CCCTCTTTACTGAAGGTAATAGG - Intronic
1037675467 8:21047320-21047342 TCTTCATTCCTGAAGGTTGTGGG + Intergenic
1037885779 8:22595487-22595509 CATGCCTTCCTGGAGGTAGAAGG + Intronic
1038083434 8:24166041-24166063 CAGTTTTTCCTGAAGGTGGAGGG + Intergenic
1038285271 8:26200758-26200780 CTTTCTTTCCTGCAACTAGATGG - Intergenic
1039819312 8:41122219-41122241 CCTGCTTTCCTGCAGGCAGTTGG + Intergenic
1041869841 8:62620242-62620264 GCTTCTTTCCTCCAGGTATAGGG + Intronic
1043117624 8:76278918-76278940 CCTACTTTCCTGGAGGTTGTTGG + Intergenic
1043525169 8:81088715-81088737 GCTTCTTTTCTGAAGGTGGGTGG - Intronic
1044528867 8:93285040-93285062 ACTTCTTTGCTGAAGGAAGCTGG - Intergenic
1044829527 8:96233566-96233588 CCTTCATTTCTGAAGGTAACAGG - Intronic
1045877306 8:106996971-106996993 GCTTCTTTCCTATGGGTAGAGGG - Intergenic
1046707811 8:117475825-117475847 GCTTCTTTCTTTATGGTAGAAGG + Intergenic
1052690332 9:31808805-31808827 CTTTCTTTCCTGAGGGTAAGAGG - Intergenic
1053826274 9:42028021-42028043 CCTTCTGTACTAAAGGAAGATGG + Intronic
1054604286 9:67159376-67159398 CCTTCTGTACTAAAGGAAGATGG - Intergenic
1055495989 9:76856423-76856445 TCTTCTTTCCTGTAAGTTGAGGG - Intronic
1057014274 9:91637129-91637151 CCTCATATACTGAAGGTAGAAGG - Intronic
1057534801 9:95890632-95890654 GCATCATTCCTTAAGGTAGAAGG - Intronic
1059008606 9:110431971-110431993 GCTTCTTGCCTGAACGTAGATGG - Exonic
1059155914 9:111988171-111988193 CCTTCTCTTCAGAAGCTAGAAGG - Intergenic
1062333765 9:136056063-136056085 GCCTCTTTTCTGAAGGTATAGGG - Intronic
1186135670 X:6517967-6517989 TTTTCTTTCCTGAGGGTAAAAGG - Intergenic
1187981181 X:24759164-24759186 GCTTCTTTCATCAAGGAAGATGG + Intronic
1188368264 X:29336797-29336819 CATTCTTTCCTCCAGGTACAGGG + Intronic
1188621842 X:32235176-32235198 CTTCCTTTCCTGCAGCTAGATGG + Intronic
1188692613 X:33149191-33149213 CTTTCTTTCCTGCAACTAGACGG + Intronic
1188844259 X:35053915-35053937 CCTTTGTTCCTGATGGAAGAGGG + Intergenic
1191669427 X:63735340-63735362 CTTTGTTTCCAGAAGGTAGGAGG + Intronic
1192248588 X:69392597-69392619 CCTTCTTTCCTGTGGGCAAATGG - Intergenic
1196053063 X:111325984-111326006 CCTTCTTTTCTGAAACTAGTAGG - Intronic
1198782798 X:140255928-140255950 CCTTCATTCCTGAAGGTTGTGGG + Intergenic
1198790240 X:140337366-140337388 CCTTATTTGCTGAAGGTGAAGGG + Intergenic
1198934294 X:141889731-141889753 CCTTCATTCCTGAAGGTTCTGGG - Intronic
1201334033 Y:12859885-12859907 CCTTCTTTCCTGGATATATAAGG + Exonic