ID: 958951077

View in Genome Browser
Species Human (GRCh38)
Location 3:100416874-100416896
Sequence CTGGGTTAGGGGAAAGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2022
Summary {0: 1, 1: 0, 2: 15, 3: 203, 4: 1803}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958951077_958951086 -10 Left 958951077 3:100416874-100416896 CCCTCCCCTTTCCCCTAACCCAG 0: 1
1: 0
2: 15
3: 203
4: 1803
Right 958951086 3:100416887-100416909 CCTAACCCAGCAACAGGCCCAGG 0: 1
1: 3
2: 37
3: 642
4: 4235

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958951077 Original CRISPR CTGGGTTAGGGGAAAGGGGA GGG (reversed) Intronic
Too many off-targets to display for this crispr