ID: 958954364

View in Genome Browser
Species Human (GRCh38)
Location 3:100451343-100451365
Sequence GGGAAAACCCAAAGTGGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 407
Summary {0: 1, 1: 0, 2: 2, 3: 60, 4: 344}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958954364 Original CRISPR GGGAAAACCCAAAGTGGGCA GGG Intronic
900854092 1:5166840-5166862 AGGACAACTCAAAGTGGGGAGGG + Intergenic
901262848 1:7886152-7886174 GGGGAGACTCAGAGTGGGCAGGG - Intergenic
904581721 1:31548661-31548683 GGGAAGAGCCAACGTGGGCGGGG + Intergenic
906377305 1:45305414-45305436 GGGACAACTCGAAGTGGGGAGGG - Intronic
906609745 1:47192986-47193008 CAGAAAAGCCAAAGTGGGCCTGG + Intergenic
907524669 1:55047124-55047146 GGGAAGACACAAAGTGGCCCAGG - Intronic
908050443 1:60224081-60224103 GGGAAAAGCCAAGGTAAGCATGG + Intergenic
909050030 1:70755242-70755264 GGGACAACTCCAAGTGGGGAGGG - Intergenic
909721500 1:78776125-78776147 GGGAGGACCCAGAGTGTGCAAGG + Intergenic
910150574 1:84138150-84138172 GGAAATACACAAAGTGAGCATGG + Intronic
910524771 1:88165136-88165158 GGGAATACACAGAGTGGGTAAGG + Intergenic
911104646 1:94120233-94120255 GGGAAAACCCAAAGTACGTTTGG - Intronic
912074528 1:105855862-105855884 GGGAAGACTCAAAGTGGGGCGGG - Intergenic
912867191 1:113268230-113268252 GGGAAAAGCAAAACTGAGCAAGG - Intergenic
913465084 1:119132332-119132354 GGGAAAAGCCAAAGTTTGCCAGG + Intronic
914381663 1:147121786-147121808 AGGAAAACTCAAAGTGGAGAGGG - Intergenic
916284807 1:163094414-163094436 TGGAAAACCCAAAGGGGGATAGG + Intergenic
916605507 1:166338589-166338611 GGGAAAAGCCAGTGTGGGCTGGG - Intergenic
917312591 1:173692344-173692366 GGGACAACTCAAAGTGGGGAGGG + Intergenic
917577797 1:176342329-176342351 GGGAAATCCAGAAGTGGTCATGG - Intergenic
918398205 1:184137426-184137448 GGGAAAAAGTAAAGTAGGCATGG - Intergenic
919417796 1:197332919-197332941 GGGAAAAGCCAAAGTTGAGAAGG + Intronic
919469234 1:197958190-197958212 GGGAAAACTGATAGTGGGGAAGG + Intergenic
920596086 1:207271629-207271651 GAAAAAACCCAAAGTGGTCCTGG - Intergenic
920774625 1:208924087-208924109 GGGAAAAGCCATAGTGAGCGAGG - Intergenic
921090500 1:211837528-211837550 GAGAAATCCCAAAGTGGGGCGGG + Intergenic
922024581 1:221738871-221738893 GAGAAAACCCAAAGTGAACCCGG + Intronic
922337408 1:224628951-224628973 GGGACAACTCAAAGTGGGGGTGG - Intronic
922601279 1:226856504-226856526 AGGAAGACTCAAAGTGGGGAAGG - Intergenic
923449438 1:234102908-234102930 GGGAGAAGTAAAAGTGGGCAGGG + Intronic
923755738 1:236789607-236789629 AGGACAACACAAAGTGGGAAGGG + Intergenic
924938164 1:248789897-248789919 TGGAAAACTCAAAGTGGGGCGGG + Intergenic
1063135861 10:3215569-3215591 GGGAAGACCCAACCGGGGCATGG + Intergenic
1064127825 10:12679648-12679670 GAGAAAACCCAAAGCAGGAATGG - Intronic
1064827426 10:19420835-19420857 GGGCAACTCCAAAGTGGGGAAGG + Intronic
1065209873 10:23392687-23392709 AGGACAACTCAAAGTGGGGAGGG + Intergenic
1065401334 10:25305402-25305424 AGGAAAACTCAAAGTGTGGATGG + Intronic
1065970265 10:30800410-30800432 GGGAAAACCCAAAGCAAGCCTGG - Intergenic
1067066930 10:43109396-43109418 GGGAGAGCTCACAGTGGGCAGGG + Intronic
1068196722 10:53726941-53726963 TGGAAAACCAAAAGGGGGGATGG + Intergenic
1068677426 10:59782360-59782382 CAGAAAACCCAAATTGGGCTGGG + Intergenic
1068727888 10:60323656-60323678 GGGAAAACGAAAAATGGACAAGG + Intronic
1069180489 10:65352503-65352525 GGGACAACTCAAAGTGGGGATGG - Intergenic
1070019484 10:72569898-72569920 GAGAAAAATCAAAGGGGGCATGG - Intronic
1070535526 10:77374576-77374598 GAGAAAACCCAAAGATGCCAAGG - Intronic
1070936016 10:80295797-80295819 GGGACAACTCGAAGTGGGGAGGG + Intergenic
1071599454 10:86950818-86950840 GGGAAAACCAAAAGTGTGCAAGG + Intronic
1071897140 10:90080001-90080023 GGGACAACTCAAAGCGGGGAGGG - Intergenic
1072216602 10:93292459-93292481 AGGACAACTCAAAGTGGGAAGGG + Intergenic
1072385678 10:94925020-94925042 GGGACAACTCAAAGTGGGGAGGG + Intergenic
1074612015 10:115030917-115030939 GGGAAGACTTAAAGTGGGGAAGG - Intergenic
1075848520 10:125567036-125567058 GGGACAACTCAAAGGGAGCAGGG + Intergenic
1076997516 11:305799-305821 GGGACAACTCGAAGTGGGGAGGG - Intergenic
1077381579 11:2244000-2244022 GAGAAAATCCAAAATCGGCAGGG + Intergenic
1078664562 11:13313896-13313918 AGGAAAACCCAAAGTGGGGTGGG - Intronic
1080332282 11:31153405-31153427 GGGAATTCCCAGAGTGGGGAAGG - Intronic
1080992865 11:37560671-37560693 GGGAGAAGCCAAAGTGGACAGGG + Intergenic
1085202879 11:74712423-74712445 GGAAAATCCCAAAGTCAGCAAGG + Intronic
1085240499 11:75050161-75050183 AGGAAGACTCAAAGTGGGGAGGG - Intergenic
1085678959 11:78552692-78552714 GGGAGAACTCGAAGTGGGGAGGG - Intronic
1086127979 11:83369318-83369340 GGGACAACTCAAAGTGGGGAGGG + Intergenic
1086287703 11:85268353-85268375 AGGAAGACTCAAAGTGGGGAGGG - Intronic
1087047703 11:93857025-93857047 AGGAAGACTCAAAGTGGGGAGGG + Intergenic
1088180733 11:107106299-107106321 ATGAAAACCAAAAGTCGGCAGGG + Intergenic
1088909504 11:114180207-114180229 TGGAGAACCCAAAATGGTCAGGG + Intronic
1089864133 11:121616947-121616969 AGGACAACTCAAAGTGGGCATGG + Intronic
1089882934 11:121792250-121792272 GGGAAAAGCCAAGGTGGGTGAGG + Intergenic
1089950258 11:122519202-122519224 TTGAAAACCCAAAGTTGGCCAGG + Intergenic
1089965802 11:122654386-122654408 TGGAAAACCCAGTGTGTGCAAGG + Intergenic
1090940118 11:131380053-131380075 AGGAAACCCCAAAGAGGCCATGG - Intronic
1093072129 12:14716544-14716566 AGGAAGACTCAAAGTGGGAAGGG + Intergenic
1093296896 12:17402398-17402420 GGGACAACTCAAAGTGGGGAGGG - Intergenic
1093689057 12:22088974-22088996 GGGAAAAACCCCAGTGGGCACGG + Intronic
1094838666 12:34333979-34334001 GGGCCAGCCCAAAGGGGGCAGGG + Intergenic
1095155187 12:38844029-38844051 GGGAAAAACCACAGTTGACATGG + Intronic
1096049342 12:48593507-48593529 GGGACAACTCAAAGAGGGCAGGG - Intergenic
1097138051 12:56875865-56875887 TGGACAACTCAAAGTGGGGAGGG - Intergenic
1097262036 12:57725706-57725728 GGGGAAGCCCAGGGTGGGCAGGG - Intronic
1098358221 12:69630767-69630789 GGGGCAACTCAAAGTGGGGAGGG + Intergenic
1098408976 12:70158722-70158744 GAGACAACTCAAAGTGGGGAGGG - Intergenic
1099933691 12:89101374-89101396 GGGAAAGCCCTATGTAGGCATGG - Intergenic
1100121420 12:91373378-91373400 GGGACAATTCAAAGTGGGGAGGG - Intergenic
1100392649 12:94157393-94157415 GGGAAACCCCAAAGTCGACTTGG + Intronic
1102433664 12:112903299-112903321 GGGACAACTCGAAGTGGGGAGGG + Intergenic
1103525827 12:121567576-121567598 GGGAAAACCACATGAGGGCAGGG + Intronic
1103747531 12:123135849-123135871 AGGAAATCCCAAAATGGGTAGGG - Intronic
1104757133 12:131276351-131276373 GGGAAGACTCGAAGTGGGGAGGG + Intergenic
1105216573 13:18290421-18290443 GGGAAAAAGAAAAGTGTGCATGG - Intergenic
1107510983 13:41084706-41084728 GGAAAACCCCATAGTGGTCATGG - Intergenic
1109217138 13:59602988-59603010 GGGAACACCAAAAGTGGGGAAGG + Intergenic
1109898848 13:68735117-68735139 GGCAACACCCAATGCGGGCAAGG - Intergenic
1110404446 13:75134125-75134147 GCCCAAACCCAAAGTGGGCAAGG + Intergenic
1110969321 13:81740948-81740970 AGGAAGACTCAAAGTGGGGAGGG - Intergenic
1111076064 13:83237120-83237142 GGGAAAACCCAAGATGAGAAAGG - Intergenic
1112196102 13:97227975-97227997 GGGAAAAACCAAAGTCTACAAGG + Intronic
1112447272 13:99475685-99475707 GGGACAACTCAAAGTGGGGAGGG - Intergenic
1113218288 13:108068983-108069005 GGGACAACTCAAAGTGGGTGGGG - Intergenic
1113573313 13:111374167-111374189 GGGAAAGGCCAAAGTGAGCCTGG - Intergenic
1114509987 14:23250828-23250850 GGGACAGCTCAAAGTGGGAAGGG + Intronic
1114737701 14:25059610-25059632 CAGAAACCCCAAAGTGGGAAAGG + Intergenic
1115244420 14:31280601-31280623 GGGATAACTCAAAGTGTGGAGGG - Intergenic
1115349407 14:32377383-32377405 GGGAAAAACAAAAGAGGACATGG - Intronic
1115814846 14:37152964-37152986 GGAAACACCAAAAGTGGGGAAGG + Intronic
1118170578 14:63385029-63385051 GGAAAATTCCAAAGTGGGCCAGG + Intronic
1118938927 14:70314708-70314730 GGGAGGACTCAAAGTGGGGAGGG - Intergenic
1120064812 14:80028357-80028379 GTGAAACCCCAAAATGGCCATGG - Intergenic
1120260796 14:82182838-82182860 AGGAAAATGCAAAGTGGGCCTGG - Intergenic
1120409516 14:84134687-84134709 GGAACAACTCAAAGTGAGCAGGG + Intergenic
1121239782 14:92420785-92420807 GAGAATACCCACGGTGGGCATGG + Intronic
1121506033 14:94477679-94477701 AAGAAAACCCAAGGAGGGCATGG + Intronic
1121654029 14:95581894-95581916 GGGAGGACCCAGAGTGGGCACGG - Intergenic
1124797594 15:32797354-32797376 GGGACATCCCACAGTGGGCCTGG - Intronic
1125343093 15:38693929-38693951 GGGAAAATCCCAAGGGGACAAGG - Intergenic
1125500728 15:40239123-40239145 GAGAAATCCCAAAGTGAGCCGGG + Intronic
1126145513 15:45469662-45469684 GGGAAGACTCAAAGCGGGGAGGG - Intergenic
1126180506 15:45780819-45780841 GGCAGAAGCCAAAGGGGGCAGGG - Intergenic
1127465692 15:59242297-59242319 GGGAAAATTCAAACTGGGCGTGG + Intronic
1128222632 15:65979932-65979954 GGGAAAAACCACTGTGGGAAAGG - Intronic
1128432185 15:67607440-67607462 GGGAAAAGCAAAGGTGGGAAAGG - Intronic
1128594851 15:68934964-68934986 GGAAAGACACAAAGTGGGCTTGG - Intronic
1128774526 15:70309529-70309551 GGGACGACTCAAAGTGGGGAGGG + Intergenic
1129877668 15:78987134-78987156 GGACAAACCCAATGTGGTCATGG - Intronic
1130431693 15:83854945-83854967 GGGAAAATTCAAGGTGGGCTTGG - Intronic
1130532945 15:84761354-84761376 GGGAAAGACCAGAGAGGGCAAGG + Intronic
1130566829 15:85003378-85003400 GGGAAAAACCAAGATGGGCCTGG + Intronic
1132050134 15:98600820-98600842 GGGAAATAACAAAGTGGCCAAGG + Intergenic
1132871177 16:2116446-2116468 GGCGAGACCCACAGTGGGCAGGG + Intronic
1133326484 16:4945216-4945238 GGGAAAAACCAGGGTGGCCAGGG - Intronic
1133458366 16:5963406-5963428 GAAAAAATCCAAAGTTGGCAAGG + Intergenic
1134279928 16:12808389-12808411 GAGACAACCCGAAGTGGGGAGGG - Intergenic
1134521350 16:14920448-14920470 GGCGAGACCCACAGTGGGCAGGG - Intronic
1134709025 16:16319099-16319121 GGCGAGACCCACAGTGGGCAGGG - Intergenic
1134716234 16:16359133-16359155 GGGGAGACCCACAGTGGGCAGGG - Intergenic
1134950580 16:18349546-18349568 GGCGAGACCCACAGTGGGCAGGG + Intergenic
1134958518 16:18393026-18393048 GGGGAGACCCACAGTGGGCAGGG + Intergenic
1135090422 16:19509944-19509966 GTTAAAACCCAAAATGGGCCGGG - Intronic
1135120705 16:19764034-19764056 GCCAAAATCCAAAGAGGGCAGGG + Exonic
1136385226 16:29921257-29921279 GGGAAAAAGGAAAGTAGGCAGGG + Intronic
1137817450 16:51412221-51412243 GGGAAAAACCAAAAGTGGCAAGG - Intergenic
1138296655 16:55891540-55891562 AGGACAACTCAAAGTGGGGAAGG + Intronic
1138410054 16:56832022-56832044 GGTAAAGCCCTATGTGGGCAGGG - Intronic
1139658965 16:68407225-68407247 GGGAAAACCAAACGTAGGCGAGG + Intronic
1140197335 16:72865934-72865956 GGGACAGCCCTAAGTGGGAAAGG + Intronic
1140985738 16:80156648-80156670 GGCAAGACTCAGAGTGGGCAGGG + Intergenic
1141177234 16:81729070-81729092 GGGACAACTCAAAGTGTGCAGGG - Intergenic
1146441401 17:32898327-32898349 AGGACAACTCAAAGTGGGGAGGG + Intergenic
1146627709 17:34446784-34446806 AGGAATACTCAAAGTGGGGAAGG - Intergenic
1146807196 17:35874129-35874151 AGGAAAAGCCAAAATGGGAAAGG - Intronic
1147513613 17:41095531-41095553 GGGACAACTCTAAGTGGGGAGGG - Intronic
1148344381 17:46893824-46893846 GGAAAAAGCCAAGGTGGCCAGGG + Intergenic
1149612018 17:57964763-57964785 GGGAAAACACAAAGTGAGCCTGG - Intergenic
1150562845 17:66309783-66309805 GGGGAAAAAAAAAGTGGGCAAGG - Intronic
1151190146 17:72392492-72392514 GGGAAAACTTAAATGGGGCAAGG - Intergenic
1152045933 17:77935735-77935757 GGGACAACTCAAAGTGGGGCAGG + Intergenic
1152137692 17:78514647-78514669 TGGTAAAGCCAATGTGGGCAGGG - Intronic
1152153994 17:78621190-78621212 AGGAAACCCCAAGCTGGGCATGG - Intergenic
1154055651 18:11011032-11011054 GTGAAAACACAAAGAAGGCATGG + Intronic
1155954921 18:31948803-31948825 GGGACAACTCAAAGTGGGGCAGG + Intronic
1157712111 18:49857323-49857345 GAGAGAACCCTAAGTGTGCATGG + Intronic
1158024347 18:52878078-52878100 AGGAAACCCCAAAGTGGGGAGGG - Intronic
1158886803 18:61836188-61836210 GGGAAAATACAAAGTGAGCCTGG + Intronic
1159918218 18:74204442-74204464 GGGACAACTCAAAGTAGGGAGGG - Intergenic
1160670855 19:362301-362323 GGCCAAGCCCAAAGTGCGCAAGG - Exonic
1160969398 19:1760710-1760732 GGGAAAAGCAAAAGCGGGGATGG - Intronic
1161784020 19:6312004-6312026 GAGAAAACCCGAAGTGGTCAGGG + Intronic
1162604044 19:11693622-11693644 GGGACAACACAAAGTGGGCGGGG + Intergenic
1163127447 19:15251860-15251882 GGCAAAACCCAAGGTGGGGAGGG + Intronic
1163642403 19:18469165-18469187 GGGAAGACACACAGAGGGCATGG + Intronic
1163657904 19:18558257-18558279 TGAAAAACCCCAAGTGGGGAGGG - Intronic
1164392933 19:27841389-27841411 GGGAAGACTCAAAGTGGGGAGGG - Intergenic
1165868578 19:38954222-38954244 GGAGGAAGCCAAAGTGGGCAAGG + Intronic
1165878301 19:39025146-39025168 GGGAAACCCACAAGTGAGCATGG - Exonic
1166131559 19:40748910-40748932 GTGACAACCCAGAGTGGTCAGGG - Intronic
1166312006 19:41968216-41968238 GGCAAAACCCAAAATGGGCTGGG + Intronic
1166645783 19:44530706-44530728 GTGACAACCCAGAGTGGGCAGGG + Intergenic
1166687253 19:44802784-44802806 GTGATGACCCAGAGTGGGCATGG + Intergenic
1167096213 19:47376247-47376269 CAGACAACCCAGAGTGGGCAGGG + Intronic
1168183371 19:54679270-54679292 GGGAAACCCAAAAGGGGGGAAGG + Intronic
927490829 2:23519799-23519821 AGGAAGACCCAAAGTGAGGAGGG + Intronic
927507431 2:23623527-23623549 AGGAAAGCTCAAAGTGGCCATGG + Intronic
927621860 2:24669476-24669498 GGGAAAACCTAAGGTAGGAATGG - Intronic
928604820 2:32935985-32936007 GGGACAACACAAAGTGGGGTGGG - Intergenic
929288027 2:40157646-40157668 GGAAAAACTCAAACTGGACAGGG + Intronic
929535670 2:42782782-42782804 GGGAAGACTCAAAGTGGGAAGGG - Intronic
929754574 2:44753476-44753498 AGGAAAATCCAAAGTTGCCATGG + Intronic
931300544 2:60974160-60974182 GAGAAGACCCACAGTGGGTAGGG - Intronic
932842579 2:75097336-75097358 CTGAAAACCCAGAGTGGGAAAGG - Intronic
933035512 2:77392292-77392314 GGGAAATCTCAAAGTGGGATGGG - Intronic
933227163 2:79764006-79764028 GGGAAAAGCAAAATTGGTCAAGG + Intronic
934100906 2:88652112-88652134 GGGAAAAGCAAAAGTGGGAAGGG + Intergenic
934297750 2:91756257-91756279 GGGAAAAAGAAAAGTGTGCATGG + Intergenic
935024944 2:99268043-99268065 GGGACAACTCAAAATGGGGAGGG - Intronic
935889609 2:107662098-107662120 GGGACAACCCAAAGAGGGGTGGG + Intergenic
936956363 2:118026552-118026574 GGGACAACTCAAAGTGGGGAGGG + Intergenic
939344780 2:140950060-140950082 GGGAAAAAGCAAAGAGGGAAAGG + Intronic
940111918 2:150164095-150164117 CCGCAAACCCAAAGTGGGAAAGG - Intergenic
943453143 2:188071247-188071269 AGGACAACTCAAAGTGGGGAGGG + Intergenic
944688420 2:202137918-202137940 GGCAAACGCCAAAGTGGGGATGG - Intronic
944695168 2:202194165-202194187 GAGAAAACCCAAGATGGTCAGGG - Intronic
945374168 2:209059817-209059839 ATGAAAACCCACAGTGGGGAGGG + Intergenic
946177677 2:217931393-217931415 GGGAAAACCCAAAGAGCCAAAGG + Intronic
946901872 2:224380811-224380833 GAGAAAACAAAAAGGGGGCATGG + Intronic
947660711 2:231864659-231864681 GAGACAACCCAAAGAGGGCCGGG - Intergenic
948259102 2:236589964-236589986 TGCAAAACCCAATCTGGGCACGG + Intergenic
948281199 2:236749087-236749109 GGGAACACCTACAGTGGGCCAGG + Intergenic
948813215 2:240495900-240495922 GGGAACACCAAAAGTGGGGAAGG - Intronic
1170568151 20:17618159-17618181 GAGAAAACCCACAGAAGGCACGG + Intronic
1171815033 20:29778415-29778437 GGGACAACCCAAACTGAGCCTGG + Intergenic
1172130696 20:32652876-32652898 GCGGCAACCCAAAGCGGGCAGGG + Intergenic
1172813879 20:37671082-37671104 GTGAACACCCACAGTGGGCAAGG - Intergenic
1173462161 20:43251798-43251820 GGGAAAACCCAAATTAAGCAGGG + Intergenic
1173897355 20:46561192-46561214 GGGACAACTCAAAGAGGGCAGGG - Intronic
1175977275 20:62717257-62717279 GTAAAATCCCAAAGTAGGCACGG - Intronic
1176289117 21:5034923-5034945 GGGAAGACCCACAGTGGGTCTGG - Intronic
1177589662 21:23146039-23146061 GGGACAACTCAAAATGGGGAGGG + Intergenic
1178032049 21:28539040-28539062 GAGAAATCCAAAAGTGGGGAGGG - Intergenic
1178955952 21:37022047-37022069 AGGAAAGCCCAAGTTGGGCATGG + Intergenic
1179299747 21:40096225-40096247 GGGACAACTCAAAGTGGGGAGGG - Intronic
1179868118 21:44228681-44228703 GGGAAGACCCACAGTGGGTCTGG + Intronic
1179957127 21:44747627-44747649 GGGACACCTCAAAGTGGGGAGGG - Intergenic
1180190619 21:46160940-46160962 GGGGAAACCCAAACTGGGACAGG + Intergenic
1180722674 22:17920931-17920953 GGGAAAAGCCAAGCTGGGAAAGG + Intronic
1182413825 22:30208364-30208386 GGCAGAGCCCTAAGTGGGCAAGG - Intergenic
1182501459 22:30751107-30751129 GGGACAACTTGAAGTGGGCAGGG - Intronic
1182793122 22:32969544-32969566 GGGAAAAACAAAAGATGGCATGG + Intronic
1183482023 22:38070447-38070469 GGGAAAACGCAACTTGGGGAGGG - Intronic
1184640016 22:45865732-45865754 GAGAAAACCCAGAGAGGGAAAGG - Intergenic
1184826323 22:46954253-46954275 GGTAAAACACAAACTGAGCAAGG - Intronic
950919873 3:16683660-16683682 GGGAAAACCTGAAGTAGGAAGGG - Intergenic
951195144 3:19815111-19815133 GGGAAGATCTAAAGTGGGCATGG - Intergenic
951298086 3:20963836-20963858 GGGAAGAATCAAAGTGGGGAGGG - Intergenic
952420520 3:33126831-33126853 AGGACAACCCAAAGTGGGAGGGG + Intronic
952548500 3:34449614-34449636 TGGAAAACCCAACGTGAGTATGG - Intergenic
953011479 3:39029519-39029541 GGGAAAGGACATAGTGGGCAGGG + Intergenic
955647840 3:61159490-61159512 GTGAAGACACCAAGTGGGCAAGG - Intronic
955700851 3:61680640-61680662 GGGAAAAAAAAAAGAGGGCATGG + Intronic
956165385 3:66394621-66394643 GGGAAAAACCAGAGGGGGGATGG - Intronic
956272706 3:67464889-67464911 GCTAAAACTCAAAGAGGGCATGG + Intronic
956731433 3:72200230-72200252 GGGACAACTCAAAGTGGGGAAGG + Intergenic
957299694 3:78375966-78375988 GTGACAACTGAAAGTGGGCAGGG + Intergenic
958264927 3:91426908-91426930 TGGAACACCCAGAGAGGGCATGG + Intergenic
958752804 3:98212593-98212615 GTTAAAACCCAAACTGGGTATGG + Intergenic
958953578 3:100442521-100442543 AGGAAGACTCAAAGTGGGGAGGG + Intronic
958954364 3:100451343-100451365 GGGAAAACCCAAAGTGGGCAGGG + Intronic
960066049 3:113374299-113374321 GGGAAAGCCAAAAGTGAGCCTGG + Intronic
961346288 3:126265542-126265564 TGAAAGACCCAAAGTGGGGAGGG - Intergenic
963576058 3:147061599-147061621 GGGACAATCCAAGGTGGGGAGGG - Intergenic
964859078 3:161180495-161180517 GGGAAGACTCAAAGTGGGGAGGG + Intronic
965114425 3:164469726-164469748 AGGACAACTCAAAGTGGGGAGGG - Intergenic
965365840 3:167798842-167798864 GGGAAGACGGAAAGGGGGCAAGG + Intronic
966308073 3:178559888-178559910 GGGAAAACTAAATATGGGCAAGG - Intronic
967438856 3:189483053-189483075 GGGTAAACACAAAGTGAACATGG + Intergenic
968127779 3:196172575-196172597 AGGAAAACCGAAAGAGGGCTGGG + Intergenic
969049310 4:4361388-4361410 GGGACAACTCAAAGTGGGGAGGG - Intronic
969313392 4:6367318-6367340 TGGAAAACCTCCAGTGGGCACGG + Intronic
970350932 4:15201222-15201244 GGGAAGGCATAAAGTGGGCAAGG + Intergenic
970829704 4:20322385-20322407 GGGACAACTCGAAGTGGGGAGGG + Intronic
971913194 4:32823494-32823516 GGGACAACTCAAAGTGGAGAGGG + Intergenic
972433779 4:39012004-39012026 GGGTATTCCCAAAGTGGGAAGGG + Intronic
975187980 4:71425671-71425693 AGGAAAACTCAAAGTGGGGGTGG + Intronic
975620471 4:76291324-76291346 GGCAGAACCCACACTGGGCATGG - Intronic
975704221 4:77095902-77095924 GGGATGACCTGAAGTGGGCAGGG - Intergenic
975735827 4:77380043-77380065 TGGTAAACCCACAGAGGGCAAGG + Intronic
977388003 4:96369504-96369526 ATGAAAACCAAAAGTGAGCAGGG - Intergenic
978356832 4:107884719-107884741 GGGACAACTCAAAGTGGGGAGGG - Intronic
979810139 4:125026690-125026712 GGCAAAAGTCACAGTGGGCAGGG + Intergenic
979848345 4:125545384-125545406 GGGACAACTCAAAGTGGGGAAGG + Intergenic
980259726 4:130432875-130432897 GGGACAACTCAAAGCGGGGAGGG + Intergenic
981193512 4:141891379-141891401 AGGAAAAGAGAAAGTGGGCAGGG + Intergenic
982258645 4:153473929-153473951 GAGAGCACCCAAAGTGGGCAGGG - Intronic
982985421 4:162200610-162200632 GGGAGAACCCAGGGAGGGCAAGG - Intergenic
983631773 4:169856689-169856711 GGGACAACTCAAAGCGGGGAGGG + Intergenic
984013427 4:174399284-174399306 GGGACAACTCAAAGTGGGGAGGG + Intergenic
984093217 4:175401773-175401795 GGGACAACTCAAAGCGGGGAGGG - Intergenic
985227299 4:187775539-187775561 AGGAAAACTCAAACTGGGAACGG - Intergenic
985479105 5:96150-96172 GGGAAAACCAAAAGTTGACCTGG - Intergenic
985903811 5:2817640-2817662 AGGAAAACGCAGACTGGGCAAGG + Intergenic
986275706 5:6273524-6273546 AGGAAAACCCAAAGTAGGGAAGG + Intergenic
986288737 5:6380637-6380659 GGGAAAACTCAAAGCAGGGAGGG + Intergenic
987460162 5:18199062-18199084 GGGAAGACTCAAAGTGGGGAGGG - Intergenic
987914635 5:24196192-24196214 AGGAAAAACCATAGGGGGCAAGG - Intergenic
989575777 5:42986881-42986903 GGAAAAACTCAAAGTGGAGAGGG + Intergenic
992541926 5:77774587-77774609 AGGACAACCCAAAGCGGGCTGGG - Intronic
993722307 5:91333814-91333836 GGGAAAACTCAAAGGGAGGAGGG - Intergenic
993733028 5:91445267-91445289 GGGACAACTCAAAGTGGGGAGGG - Intergenic
994828298 5:104744780-104744802 GGGAACTCCAAAAGTGGGGAGGG + Intergenic
995151777 5:108855813-108855835 GGGAAAACCCTAAATGGGCTGGG + Intronic
995607321 5:113870879-113870901 AGGAAAACCCAAAGAGTGTAAGG + Intergenic
998329024 5:141307025-141307047 GGGGAATCCAAAAGTGGGGAGGG + Intergenic
998571567 5:143263926-143263948 GGGACAACTCCAAGTGGGGAGGG + Intergenic
998844070 5:146288508-146288530 AGTAAATCCCAAAGGGGGCAGGG - Exonic
999359442 5:150970540-150970562 AGGACAACTCAAAGTGGGGAGGG - Intergenic
999636864 5:153632155-153632177 GGAAAAAGGGAAAGTGGGCAAGG + Intronic
999798419 5:155009613-155009635 CGGAGAAACCAAAGTGGTCAAGG - Intergenic
1000153027 5:158521716-158521738 TGGAAAACACAAAGGGGGCCGGG - Intergenic
1001565470 5:172696810-172696832 TGGGGAACCCAAAGTGGGCTTGG - Intergenic
1002689721 5:181042296-181042318 AGGAAAACCCAGTGTGCGCAAGG - Intronic
1003475180 6:6475114-6475136 AGGACAACTCAAAGTGGGGAGGG + Intergenic
1004291080 6:14368141-14368163 TAGAAAAGCCACAGTGGGCAGGG + Intergenic
1004367987 6:15028073-15028095 GGGAAAAAAGAAAGTGGGGAGGG + Intergenic
1005840549 6:29742313-29742335 GGCGGAACCCACAGTGGGCAGGG - Intergenic
1006060410 6:31414583-31414605 GGCAGAGCCCACAGTGGGCAGGG + Intronic
1006216234 6:32445256-32445278 AGGAAAACCTAAAGTGGGATTGG + Intergenic
1008087443 6:47259668-47259690 GGGAAAAGGCAATGTTGGCAGGG - Intronic
1008990456 6:57595752-57595774 TGGAACACCCAGAGAGGGCATGG - Intronic
1009179032 6:60494298-60494320 TGGAACACCCAGAGAGGGCATGG - Intergenic
1009361909 6:62825320-62825342 GGGAGAACTCGAAGTGGGGATGG - Intergenic
1010542489 6:77109162-77109184 GGGACAACTCAAAGTAGGGAAGG - Intergenic
1010897751 6:81386176-81386198 GGGAAAATCCAAAATGTGCTTGG + Intergenic
1011559885 6:88603556-88603578 GGGACAACTCAAAGTGGGGAGGG - Intergenic
1012491992 6:99792345-99792367 GGCAAAACTTAAACTGGGCATGG - Intergenic
1013409255 6:109869522-109869544 GGGACAACTCAAAGCGGGGAGGG + Intergenic
1013599107 6:111687580-111687602 AGGAAAACCCAAAGTGGGGTGGG + Intronic
1013807201 6:114009331-114009353 GGGAAAACTCAAAGCAGGGAGGG + Intronic
1014235671 6:118951569-118951591 GGGAAGACTCAAAGTGGGGAGGG - Intergenic
1014619806 6:123652951-123652973 GGGTAAACCCAAATTAGACATGG - Intergenic
1016393356 6:143597153-143597175 GGGAAAACCCATTGTAGGGAGGG + Intronic
1018446502 6:163863615-163863637 GGGAAACCCAAAATTGGGGAAGG - Intergenic
1019085473 6:169471652-169471674 TGGAAAAGCCAAGGTGGTCAGGG - Intronic
1019122952 6:169819384-169819406 GGGACAACTCAAAGTGGGGAGGG - Intergenic
1019123206 6:169821844-169821866 GGGACAACTCAAAGTGGGGAGGG - Intergenic
1019233444 6:170587665-170587687 GGGACAACTCGAAGTGGGGAGGG + Intergenic
1019709811 7:2513055-2513077 GGGAGAACCCACTGTGGGCTGGG - Intronic
1021147455 7:17106626-17106648 GGGACAACTCAAAATGGGGAGGG - Intergenic
1021686125 7:23188077-23188099 AGGAACACCCAGAGTGGGCTTGG - Intronic
1022105619 7:27194598-27194620 CAGATAACCTAAAGTGGGCATGG - Intronic
1022554509 7:31279319-31279341 GGGAAAACACCAGCTGGGCATGG + Intergenic
1023115078 7:36854887-36854909 GTGCAGACGCAAAGTGGGCATGG + Exonic
1023687557 7:42752211-42752233 GAGAAAAGACAAACTGGGCAGGG - Intergenic
1024557379 7:50615251-50615273 GGGAAAACCCAAAGTACGGTTGG - Intronic
1024599438 7:50966629-50966651 GGGACAACTCAAAGTGAGGAGGG - Intergenic
1024600599 7:50977104-50977126 GGGACAACTCAAAGCGGGGAGGG + Intergenic
1024927426 7:54632258-54632280 AGGAAGACCTAAAGTGGGGAGGG - Intergenic
1025112789 7:56233776-56233798 GGGACAACTCAAAGTGGGGAGGG - Intergenic
1026308730 7:69166072-69166094 GGGACAACTCAAAGTGGGGGAGG + Intergenic
1027521555 7:79215649-79215671 GGGACAACTCAAAGTGGGAGGGG - Intronic
1027632817 7:80628849-80628871 AGGACAACTCAAAGTTGGCAGGG + Intronic
1027972633 7:85105023-85105045 AGGAAAAAGAAAAGTGGGCAGGG - Intronic
1029008138 7:97231285-97231307 GGGAAATCCCACAGCAGGCATGG + Intergenic
1029181535 7:98705439-98705461 GGGAACACCAAGAGTGGGGAGGG - Intergenic
1030236784 7:107272332-107272354 GGGACAACTCAAAGCGGGGAGGG - Intronic
1030825840 7:114156531-114156553 GGAACAACACAAAGTGGGAATGG - Intronic
1033213789 7:139479865-139479887 GGCAAACCTCAAGGTGGGCAGGG + Intronic
1034359280 7:150479955-150479977 GGAAGAAGCCAAATTGGGCAGGG + Intergenic
1038492571 8:27981381-27981403 GGGAAAAGCCCAGGTGGACAGGG + Intronic
1038641204 8:29330315-29330337 GGGATGACCCAAAGTGGGGATGG + Intergenic
1038727004 8:30090570-30090592 GGGACAACTCAAAGTGGGGAGGG - Intergenic
1038987986 8:32834217-32834239 TGGAGAGTCCAAAGTGGGCAGGG + Intergenic
1039664892 8:39514572-39514594 GGCAATAGCCAAAGTGGGTAAGG - Intergenic
1039811705 8:41054818-41054840 GTAAAAACCAAAAGTGGGCCAGG - Intergenic
1040694722 8:49981821-49981843 CTGAAAGCCCAAAGAGGGCAAGG - Intronic
1040714137 8:50226667-50226689 GTGACAACCCAAAGTGGGTGGGG - Intronic
1041025291 8:53679367-53679389 GGGACAGCTCAAAGTGGGGAGGG - Intergenic
1042052577 8:64727147-64727169 GGGAAACCCTTAAGTGGGCAGGG - Intronic
1042745529 8:72102311-72102333 GGGAAAACCCCAAGAGGGAAGGG - Intronic
1042863025 8:73332833-73332855 CTGAAAACCCAAAGGGGGCCAGG + Intergenic
1043676867 8:82967711-82967733 GGGACAACTCAAAGTGGGGACGG + Intergenic
1044007176 8:86952107-86952129 AGGACAACTCAAAGTGGGGAGGG - Intronic
1044615810 8:94139601-94139623 AGGAAGAACCATAGTGGGCAGGG + Intronic
1044694172 8:94906210-94906232 GAGAAGAACCAAAGAGGGCAGGG - Intronic
1045399381 8:101797005-101797027 GGGATAACTCAAAGTAGGGAGGG - Intronic
1046198032 8:110888831-110888853 TGGAACACCCAGGGTGGGCATGG + Intergenic
1046222594 8:111235483-111235505 GGGAAAACTCAAAGTGGGGAGGG - Intergenic
1046241604 8:111502762-111502784 GGGACAACTCAAAGCAGGCAGGG + Intergenic
1048049560 8:130804618-130804640 GGCATAAACCAAAGTGGGAAGGG - Intronic
1048388497 8:133936981-133937003 GGGACAACTCCAAGTGGGGAGGG - Intergenic
1049449452 8:142652433-142652455 GGGACAACTCAAAGTGGGGCAGG + Intergenic
1049942802 9:564639-564661 GAGAACACCAAAAGTAGGCATGG - Intronic
1052183550 9:25562086-25562108 GAGACAACCCTAAGTGGGGAGGG + Intergenic
1052320852 9:27165782-27165804 GGGCAAACCCAGAGAGAGCACGG - Intronic
1055019648 9:71656132-71656154 GGGACAACTCAAAGCGGGGAGGG - Intergenic
1055487211 9:76767857-76767879 GAGAATAGCCATAGTGGGCATGG - Intronic
1055653953 9:78435431-78435453 GGGAGAACACAAAGGTGGCAGGG + Intergenic
1056058218 9:82851853-82851875 GAGACAACTCAAAGTGGGAAAGG - Intergenic
1057467078 9:95323914-95323936 GGGACAACTCGAAGTGGGGAGGG + Intergenic
1057910254 9:99014823-99014845 AGGACAACTCAAAGTGGGGAGGG + Intronic
1058638887 9:107064038-107064060 GGGACAACTCAAAGTGGGGGTGG - Intergenic
1058997472 9:110314211-110314233 AGGACAACTCAAAGTGGGGAGGG - Intronic
1059436174 9:114277780-114277802 GGGCAAAACCAGAGAGGGCAGGG - Intronic
1059574123 9:115472182-115472204 GGAAAAACCAAGAGTGGGGAAGG - Intergenic
1059814672 9:117899352-117899374 GGGAGAACCCAAGGTGTTCAAGG - Intergenic
1060267548 9:122121197-122121219 GGGAAAACCACAGGTGGGGAAGG + Intergenic
1060774268 9:126359158-126359180 GAGAAAACCCAGGCTGGGCATGG - Intronic
1061309519 9:129753071-129753093 GGGAAAGCACAAAGTGGGAGGGG + Intergenic
1185728392 X:2441524-2441546 GGGCAAAACCAAAATGTGCAGGG + Intronic
1185782870 X:2864324-2864346 GGGACAACTCAAAGTGGGGCGGG + Intronic
1186053831 X:5627898-5627920 GGGACAACTCAAAGTCGGGAGGG - Intergenic
1186440314 X:9580373-9580395 GGGACAACTCAAAGTGGGGAGGG + Intronic
1186540187 X:10392515-10392537 GCAGAAACCCAAACTGGGCATGG + Intergenic
1186853301 X:13601555-13601577 GGGAAAACCCAGGATGGGCTGGG - Intronic
1187075252 X:15928347-15928369 GGGAAAACCAATAGAGGGTAGGG + Intergenic
1187139854 X:16583218-16583240 GGGACAACTCAAAGTGCGGAGGG - Intergenic
1187952725 X:24486406-24486428 GGGAAAACCCGAAGGCTGCAGGG - Intronic
1188204271 X:27333298-27333320 GGGAAATCCAAAAGTGCACAAGG + Intergenic
1188971273 X:36618501-36618523 GGGAAAACACAAAAACGGCAAGG - Intergenic
1189551212 X:42095569-42095591 GGGACAACTCGAAGTGGGGAGGG + Intergenic
1190426614 X:50339284-50339306 GGGACAACTCGAAGTGGGGAGGG + Intronic
1192600434 X:72458140-72458162 GGGAAAGCCCAAAGGTGTCATGG - Intronic
1194010534 X:88555008-88555030 AGGAAAAAACAAAGTGGGGAGGG - Intergenic
1194044888 X:88990203-88990225 GGGACAACTCAAAGTGGGGAGGG - Intergenic
1194199077 X:90933302-90933324 GAGACAACTCAAAGTGGGGAAGG - Intergenic
1195286410 X:103388930-103388952 GGGACAACTCGAAGTGGGGAGGG - Intergenic
1196884946 X:120235568-120235590 GGGACAACTCGAAGTGGGGAGGG - Intergenic
1198306455 X:135388558-135388580 GGGACAACTCAAAGTGGGGAAGG - Intergenic
1198751337 X:139939065-139939087 GGGAAAACTCGAAGTGGGGAGGG - Intronic
1200545074 Y:4509734-4509756 GAGACAACTCAAAGTGGGGAAGG - Intergenic
1201630413 Y:16065466-16065488 GGGACAACTCAAAGTTGGTAGGG + Intergenic