ID: 958959532

View in Genome Browser
Species Human (GRCh38)
Location 3:100495690-100495712
Sequence CCCAACCTGCAGGACCTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 270
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 252}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958959532_958959541 -9 Left 958959532 3:100495690-100495712 CCATCCAGGTCCTGCAGGTTGGG 0: 1
1: 0
2: 0
3: 17
4: 252
Right 958959541 3:100495704-100495726 CAGGTTGGGTGGGTAGGGATGGG 0: 1
1: 0
2: 5
3: 29
4: 401
958959532_958959544 26 Left 958959532 3:100495690-100495712 CCATCCAGGTCCTGCAGGTTGGG 0: 1
1: 0
2: 0
3: 17
4: 252
Right 958959544 3:100495739-100495761 GTTTTGGAGTCATTCCATGGTGG 0: 1
1: 0
2: 0
3: 6
4: 112
958959532_958959543 23 Left 958959532 3:100495690-100495712 CCATCCAGGTCCTGCAGGTTGGG 0: 1
1: 0
2: 0
3: 17
4: 252
Right 958959543 3:100495736-100495758 TGTGTTTTGGAGTCATTCCATGG 0: 1
1: 0
2: 0
3: 14
4: 199
958959532_958959542 10 Left 958959532 3:100495690-100495712 CCATCCAGGTCCTGCAGGTTGGG 0: 1
1: 0
2: 0
3: 17
4: 252
Right 958959542 3:100495723-100495745 TGGGCAGTGAGTCTGTGTTTTGG 0: 1
1: 0
2: 3
3: 37
4: 264
958959532_958959540 -10 Left 958959532 3:100495690-100495712 CCATCCAGGTCCTGCAGGTTGGG 0: 1
1: 0
2: 0
3: 17
4: 252
Right 958959540 3:100495703-100495725 GCAGGTTGGGTGGGTAGGGATGG 0: 1
1: 1
2: 8
3: 67
4: 731

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958959532 Original CRISPR CCCAACCTGCAGGACCTGGA TGG (reversed) Intronic
900393386 1:2443461-2443483 CCCAGCCGGCGGGACCGGGAAGG - Intronic
900551617 1:3259273-3259295 CCCCAGCTGCAGCCCCTGGAGGG - Intronic
900684582 1:3939960-3939982 CCCAGTCTGCAGGAGCAGGAAGG - Intergenic
901071148 1:6519238-6519260 CTCAAACTGCAGGGCTTGGAGGG + Intronic
901807198 1:11746000-11746022 CACACCCTGCAGGAGCTGGGAGG + Intronic
902360888 1:15942065-15942087 CCCAGCCTGCAGCACCTGCCCGG + Exonic
902538646 1:17136683-17136705 CCCAACCCTCAGGATCTGGTAGG + Intergenic
902610856 1:17596415-17596437 CCCAAGCTGCAGCACAGGGAGGG - Intronic
903168225 1:21536013-21536035 ACCAAACTGAAGGGCCTGGAAGG + Intronic
903445342 1:23419071-23419093 CCCCACCTGTAGTAGCTGGATGG + Exonic
904764219 1:32830530-32830552 CACAACTTGAAGGATCTGGAAGG - Intronic
904852066 1:33466904-33466926 CCCCAGCTTGAGGACCTGGAAGG - Intergenic
905028638 1:34867148-34867170 CCCACCTTCCAGGACCTGGCGGG - Exonic
905654396 1:39676783-39676805 CCGATCATGCAGGACCTGGAGGG + Intergenic
906174029 1:43753863-43753885 ACCCTCCTGCTGGACCTGGAAGG + Intronic
907176278 1:52526022-52526044 CCAAATCTTTAGGACCTGGAAGG + Exonic
907603660 1:55794379-55794401 CCCCACCTTCAGGACAGGGAGGG + Intergenic
909207069 1:72771701-72771723 CCCCACCTGAATGACATGGATGG - Intergenic
911797551 1:102092911-102092933 CCCAACCTTGATGAGCTGGAAGG + Intergenic
911992712 1:104722392-104722414 ACCAATCAGCAGGACATGGAGGG - Intergenic
917982347 1:180278163-180278185 CCCAGCCAGCAGGGTCTGGAAGG + Exonic
920178284 1:204116921-204116943 CCCAGCCTCCTGGTCCTGGAGGG + Intronic
922010171 1:221575490-221575512 CCCAACCCTCAGGCCATGGATGG + Intergenic
923127025 1:231041084-231041106 CACAACCGGCAGGACGTCGAGGG + Intergenic
1066066128 10:31762181-31762203 ACAAAACTGCAGGACCTTGAGGG + Intergenic
1067803537 10:49376967-49376989 CCCTACGTGAAGGATCTGGAGGG - Intronic
1067836632 10:49645561-49645583 CCCACCCGGCAGGACCTGTTGGG - Intronic
1069744839 10:70708608-70708630 CCCAACCTGCTGGGCCTGGTGGG + Exonic
1069824926 10:71249248-71249270 CCCAGGCTGCAGGCTCTGGAGGG - Intronic
1069861582 10:71475067-71475089 GGCACCCTGCAGGGCCTGGAGGG - Intronic
1069932410 10:71891647-71891669 CGCAGCATGCAGGCCCTGGAGGG + Intergenic
1070799378 10:79236157-79236179 CCCAGGCTGCAGGACCAGGCAGG - Intronic
1070973683 10:80588055-80588077 CGCAAGCAGTAGGACCTGGATGG - Intronic
1071708999 10:88030595-88030617 GCCACCCAGCAGGACATGGAGGG - Intergenic
1072660689 10:97361741-97361763 CCCAGCCTGCTGGCCCTGAATGG + Intronic
1073258428 10:102170513-102170535 CCCTACCTCCAGGTCCTGGCAGG + Intergenic
1073290516 10:102410991-102411013 CCAGACATGCAGGACCTGGGAGG - Intronic
1074139598 10:110660414-110660436 CCCAACCCCCAGGCCATGGACGG + Intronic
1076035327 10:127195390-127195412 CCCAACCCGCAGCCCCGGGAAGG + Intronic
1076084120 10:127610252-127610274 CCTAACCCGCAGGGCCAGGATGG + Intergenic
1076218673 10:128715956-128715978 CCCAGCACACAGGACCTGGATGG - Intergenic
1076450653 10:130554814-130554836 CCCAGCCTGCATCCCCTGGAGGG - Intergenic
1076729084 10:132429434-132429456 TCCCACCTGCCGGACCTGGCTGG + Intergenic
1079309022 11:19348078-19348100 CCCAACCAGCAGGAAGTGGGAGG - Intergenic
1079695561 11:23478010-23478032 CCCACCCATCAGGACCTGGGAGG - Intergenic
1079731628 11:23941870-23941892 ACCAATCAGCAGGACATGGATGG - Intergenic
1081692635 11:45088564-45088586 CCCAGCCTGCAGAGCCTGCAAGG + Intergenic
1081910386 11:46696392-46696414 CCCCAGCTGCAGGGCCTGGAGGG - Intronic
1083155277 11:60819051-60819073 CCCATCCTTCAGGCCCTGGTGGG - Intergenic
1083233520 11:61338013-61338035 CCCAACCTGCAGCTCCTGCAGGG + Exonic
1084422045 11:69065386-69065408 CCCATCCTGAGGCACCTGGAAGG + Intronic
1084427769 11:69094893-69094915 CACAACCTGCAGGGCCTGGGAGG - Intergenic
1084948251 11:72650601-72650623 TCCAGGCTGCAGAACCTGGAGGG + Intronic
1090837048 11:130461477-130461499 CCCACCCGGCAGGACCTGTGTGG + Exonic
1091574091 12:1715893-1715915 ACCAATCAGCAGGACATGGAGGG + Intronic
1091900873 12:4142919-4142941 CTCCACCTGGAGGACCTGGGTGG + Intergenic
1095964737 12:47859069-47859091 CCCACCCTGCCTGACCTGGTAGG - Intronic
1095990767 12:48033030-48033052 CCCAGCCTGAAGGTTCTGGAGGG - Intergenic
1097158581 12:57029804-57029826 CCCAAGCTGCAGAAGCTGAAAGG - Exonic
1097802431 12:63929052-63929074 CCCAACCCCCAGGCCATGGATGG - Intronic
1098469065 12:70823622-70823644 CCCACACTGCAGGAACTGTAAGG - Intronic
1103721334 12:122977076-122977098 CCAAACCAGCAGGAGCTGGAAGG + Intronic
1104211915 12:126697161-126697183 CCCAGCCTGCAGTGCCTAGAAGG + Intergenic
1104318106 12:127723034-127723056 GCCACCTTCCAGGACCTGGAAGG + Intergenic
1107170965 13:37341619-37341641 CCCCACCTTCAGGCCATGGACGG + Intergenic
1107942520 13:45387293-45387315 ACCAATCAGCAGGACATGGATGG - Intergenic
1108266952 13:48720416-48720438 GCAAACATGGAGGACCTGGAGGG + Intergenic
1109622212 13:64925406-64925428 CCCCACCTTCAGGCCATGGAGGG - Intergenic
1111729266 13:92052490-92052512 ACCAACCAGCAGGACATGGGCGG - Intronic
1112078466 13:95938788-95938810 CCAATCCAGCAGCACCTGGATGG + Intronic
1113961608 13:114129412-114129434 CCTCACCTGCAAGAGCTGGAAGG + Intronic
1114674523 14:24431454-24431476 CCCAACCAGGAGTACCTGAAGGG + Exonic
1116390658 14:44385506-44385528 ACCAATCAGCAGGACCTGGGTGG + Intergenic
1119674880 14:76546222-76546244 GCCAACCAGCAGGAGGTGGAGGG - Intergenic
1120871268 14:89339443-89339465 GCCAACCTGCAGGAGCTGGGAGG + Intronic
1121538520 14:94707852-94707874 CCCATCCTGCAGGGCCTTAAAGG + Intergenic
1121974043 14:98385842-98385864 CCCAACCTTCAGGACCTCCCTGG - Intergenic
1122307978 14:100777434-100777456 CCCAGCAAGCAGGGCCTGGAAGG + Intergenic
1123757300 15:23406976-23406998 CCCAACCTGATTGAACTGGATGG - Intergenic
1125714967 15:41814438-41814460 CCAAACCTGCAGGTCCAGGGAGG + Intronic
1125728954 15:41882263-41882285 CACTACCTGCAGGACCAGCAGGG + Exonic
1126064927 15:44819396-44819418 CCAAACCTCGAGGACCAGGAGGG - Intergenic
1126110761 15:45173511-45173533 CCCAACCCACAGGGCCTGGAGGG + Intronic
1127104129 15:55595197-55595219 CCAGCACTGCAGGACCTGGAAGG + Intergenic
1128596839 15:68959871-68959893 ACCAATCAGCAGGACATGGACGG + Intronic
1129856902 15:78831108-78831130 CGCAGCCTGCATGGCCTGGACGG + Intronic
1130486848 15:84402873-84402895 CCCAACCAGCAGGTCCTGCTGGG + Intergenic
1131481875 15:92789120-92789142 ACCAACCAGCAGGACATGGGCGG - Intronic
1132806825 16:1778797-1778819 CCCATTCTGCATGACCAGGAGGG + Intronic
1134459028 16:14415756-14415778 CCCAACCTGATTGAACTGGATGG + Intergenic
1134630320 16:15751546-15751568 CCCAACCCACAGGCCATGGATGG + Intronic
1134874046 16:17680366-17680388 CCAAATCTCCAGGACGTGGAAGG + Intergenic
1135284048 16:21178229-21178251 CCTGAGCTGCAGGCCCTGGAAGG - Intronic
1136068606 16:27775067-27775089 CCCATCCTGCCGGGCCTGGTGGG + Exonic
1136498911 16:30659961-30659983 CCCCACCTGCAAGGCCTCGAGGG - Exonic
1137735580 16:50720569-50720591 CCCAACCTGCAGCCCCAGGGTGG + Intronic
1137965942 16:52933838-52933860 CCCACTCTGCAGGTCCTGGTAGG - Intergenic
1139388464 16:66589476-66589498 CCCCACCTGAAGGACCTGCAGGG - Intergenic
1139443282 16:66979724-66979746 CCCCAACTCCAGCACCTGGAAGG - Intergenic
1139873821 16:70129020-70129042 CTCAACGTGCACGACCTGGTGGG + Exonic
1140361958 16:74352120-74352142 CTCAACGTGCACGACCTGGTGGG - Intergenic
1141183951 16:81773903-81773925 CCCATCATGCAGGACTTTGATGG + Intronic
1141426403 16:83947227-83947249 CCCAGCCCGCAGGTCCTGAAGGG - Intronic
1141956540 16:87375723-87375745 TCCAGCCTGCAGGGCCTGGCAGG - Intronic
1142067660 16:88072061-88072083 TGCACCCTGCAGCACCTGGAGGG - Exonic
1142354388 16:89595496-89595518 ACCGACATGCAGGTCCTGGACGG + Exonic
1143066027 17:4248158-4248180 CCCGACCTCCAGGCCGTGGACGG + Intronic
1143681612 17:8480197-8480219 GCCAAGCTGCAGGAACTCGAGGG - Exonic
1143731944 17:8886424-8886446 CCCCACCTGCCGGGCCTGCAAGG - Intronic
1144126753 17:12210119-12210141 ACCAATCTGCCGGGCCTGGAGGG + Intergenic
1144753823 17:17667822-17667844 CCCATCCCACAGGCCCTGGAGGG + Intergenic
1146343340 17:32040890-32040912 CACCACCTGCAGAAGCTGGAGGG + Intronic
1147587080 17:41658896-41658918 CCCAACTTGCAGGGCAGGGAGGG + Intergenic
1148052661 17:44776751-44776773 CCTAACCTGCACAAGCTGGACGG + Exonic
1148693099 17:49544372-49544394 CCCCACCTCCAGGCCCTGCACGG - Intergenic
1150366330 17:64589471-64589493 CCCAACCCCCAGGCCATGGATGG + Intronic
1150726826 17:67658086-67658108 CCCACTGTGCAGGACCTGAAGGG + Intronic
1150782605 17:68135120-68135142 CACCACCTGCAGAAGCTGGAGGG - Intergenic
1150950950 17:69801761-69801783 CCCCACCTTCAGGACAGGGAGGG + Intergenic
1151624813 17:75270298-75270320 TCCGTCCTGCAGGCCCTGGACGG + Intronic
1154324979 18:13383398-13383420 CACAACCCGCAGCACCTGGTCGG - Intronic
1155182689 18:23361696-23361718 CCCATCCTGCAGGAGACGGAAGG + Intronic
1155464601 18:26120751-26120773 TCCAGCCTGCAGGATTTGGAGGG + Intergenic
1156308911 18:35904920-35904942 CCCGACCTGCAGCACCTGCCTGG + Intergenic
1158230512 18:55249412-55249434 CCCCACCTGCAGGACTCTGAAGG + Intronic
1159950059 18:74476358-74476380 CCCATCCTGCAGTATCCGGAAGG - Intergenic
1160431334 18:78814853-78814875 CCCAAACAGCAGGAACTGGAGGG + Intergenic
1160660513 19:296137-296159 CCCAGGCAGGAGGACCTGGAGGG - Intergenic
1160733857 19:653016-653038 CCCAACCCGTGGGTCCTGGAGGG + Intronic
1160876895 19:1300595-1300617 CCCAACCTGGAGCACCAGGGGGG - Intergenic
1160989147 19:1853495-1853517 CCCCACCTGCAGGCCAGGGAGGG + Exonic
1161303181 19:3552938-3552960 CCCAGCCTGGGGCACCTGGAAGG + Intronic
1161417169 19:4153828-4153850 CCCAAGCTGCCAGAGCTGGAAGG + Intronic
1162231599 19:9271071-9271093 CCCTACCTTCAGGCCATGGAAGG + Intergenic
1162930646 19:13955904-13955926 CCGAACCTGCCGGACCTGTGAGG - Exonic
1162967080 19:14161115-14161137 CCCCACCTGCAGAACCTGCAGGG - Intronic
1163820656 19:19494703-19494725 CCTCACCTGGAGGCCCTGGAAGG - Intronic
1164789673 19:30965409-30965431 AGGAACCTACAGGACCTGGATGG + Intergenic
1165112903 19:33512641-33512663 CCCGCCCTGCAGGACCACGATGG + Exonic
1167570821 19:50288005-50288027 ACCACCCTACAGGCCCTGGAGGG - Intronic
1167612778 19:50515292-50515314 CCCGAGTTGCAGGCCCTGGAGGG - Intergenic
1168486249 19:56764834-56764856 CCGATCGTGGAGGACCTGGAGGG - Intergenic
924984657 2:259042-259064 CCTAAACTGCAGGACAAGGAGGG - Intronic
925514591 2:4666478-4666500 CCAAACCAGCAGCACTTGGATGG - Intergenic
927226164 2:20767642-20767664 CCCCACCTGCAGGCCAGGGAGGG + Intronic
930015607 2:46968451-46968473 CCAAGCCTGCAGCACCTGGGTGG + Intronic
933022486 2:77211244-77211266 GCCATCCTGGAGGAGCTGGAAGG + Intronic
933067453 2:77815699-77815721 ACCAATCAGCAGGACCTGGGTGG - Intergenic
936153187 2:110032749-110032771 CCTCACCTGCAGGACATGGCGGG + Intergenic
936191494 2:110338666-110338688 CCTCACCTGCAGGACATGGCGGG - Intergenic
936503317 2:113083751-113083773 CCCAACCTCCAGAACAGGGAAGG - Intergenic
937062610 2:118991769-118991791 TCACACCTGCAGGGCCTGGAAGG - Exonic
937475149 2:122208585-122208607 CCCAAACTACAGCTCCTGGATGG + Intergenic
944130893 2:196346621-196346643 CCCAACCTACAGGAGCTGGTGGG - Intronic
944474960 2:200094073-200094095 CCCAACCTGAAGGTTCTGAATGG - Intergenic
945648806 2:212536290-212536312 CCCACCCTGCCGCACCTGGCAGG - Intronic
947582110 2:231326704-231326726 CTCAACCTCCTGGGCCTGGAAGG - Intronic
947853382 2:233306599-233306621 CCCAACCTCCAGGACCAGATTGG - Intergenic
948120880 2:235529590-235529612 CACAAAATCCAGGACCTGGAAGG + Intronic
948701251 2:239761850-239761872 CCCTTCCTCCAGGACCTGCAAGG - Intergenic
948897022 2:240932397-240932419 ACCGACCTGCAGAACCTGGTTGG + Intronic
948943523 2:241208026-241208048 CCCAACTTACAAGACCTGGGCGG + Intronic
1168782933 20:510033-510055 CCCATACTGCAGGAGGTGGAGGG + Intronic
1171035081 20:21707544-21707566 CGCAAACTCCAGGACCTGCAAGG - Intronic
1171417384 20:24992381-24992403 CCGAACCTGAAAGACCTGGCAGG + Intronic
1174406146 20:50304635-50304657 CCCAGCCTGCTGGAGCTGGCGGG + Intergenic
1175996184 20:62813246-62813268 CCCGCCCAGCAGGACCTGCAGGG + Exonic
1175996205 20:62813306-62813328 CCCGCCCGGCAGGACCTGCAGGG + Exonic
1175996245 20:62813426-62813448 CCCGCCCGGCAGGACCTGCAGGG + Exonic
1175996266 20:62813486-62813508 CCCGCCCGGCAGGACCTGCAGGG + Exonic
1176022002 20:62966785-62966807 CCCACCCTGCAGCACCTCGGTGG - Intronic
1176899034 21:14417469-14417491 CCCACCCTCCAGGACCTGAGTGG + Intergenic
1177318143 21:19487757-19487779 CCTCACCTGCAGAACCTGGGAGG - Intergenic
1180624989 22:17188442-17188464 CCCCACCTGCAGGACAGAGAGGG + Exonic
1181064017 22:20297168-20297190 CCCAACATACAGGGCCTGGGTGG + Intergenic
1181821923 22:25483109-25483131 CCCAACCTGCAGATCTTGGATGG + Intergenic
1181895089 22:26100040-26100062 TCTTACCTGGAGGACCTGGATGG + Intergenic
1182159576 22:28107950-28107972 CCCGACCTTCAAGACATGGAAGG - Exonic
1182519557 22:30877730-30877752 CCCCGCCTGCAGGGACTGGAGGG - Intronic
1182548926 22:31090795-31090817 CCCAACCTGCCAGACGTGGCTGG + Exonic
1183453176 22:37907298-37907320 CACAACCTGCAGCACCCGGTTGG - Intronic
1183742575 22:39677170-39677192 CCACCCCTACAGGACCTGGAGGG - Intronic
1184518715 22:44979474-44979496 CCCTTCCTGCAGCCCCTGGAGGG + Intronic
1184684307 22:46089202-46089224 CCCAGGCAGCAGGAGCTGGAAGG - Intronic
1184729457 22:46364831-46364853 CCCAACCTGCAGGCCTGGTAGGG + Intronic
1184730713 22:46369635-46369657 CCAAACATGCATGAGCTGGAAGG - Intronic
1185326356 22:50227678-50227700 CCGGACCTGGAGGGCCTGGATGG + Intronic
1185372884 22:50469079-50469101 CACAGCCAGCAGGACCTAGAGGG + Intronic
949100286 3:135972-135994 CCCAGGCAGAAGGACCTGGATGG + Intergenic
950015477 3:9751928-9751950 CCCAGCCTGCAGGCCCTGGCTGG + Exonic
950445082 3:13032425-13032447 CCGAACCTGCAGGATGCGGATGG + Intronic
951521106 3:23611527-23611549 CCCAGCCTCCAGGGCCTGGGCGG + Intergenic
952919912 3:38277094-38277116 CCCCAGCTCCAGGTCCTGGAGGG - Exonic
952981914 3:38742948-38742970 CCCAACCAGCTGGACCTGGCTGG + Intronic
955692333 3:61603123-61603145 GCCACCCTGCTGGAACTGGATGG + Intronic
958959532 3:100495690-100495712 CCCAACCTGCAGGACCTGGATGG - Intronic
960589783 3:119354169-119354191 CCCAACCTGCTGGCCTGGGATGG - Intronic
961645039 3:128388383-128388405 CCCACCCTGGAGGAGCTCGAAGG - Intronic
961703721 3:128767245-128767267 CCCAACCCCCAGATCCTGGAAGG - Intronic
967976306 3:195036400-195036422 CTCAGCCTGCAGGACACGGAGGG - Intergenic
968501562 4:952523-952545 CCCTACCTGCACGACCCCGATGG - Intronic
969351353 4:6599815-6599837 TCCAACCTGCAGGCTCTGGAAGG + Intronic
969449173 4:7263359-7263381 CCCAGCCTGGAGGAGCAGGAAGG + Intronic
969976929 4:11112779-11112801 CTAAATCTGCAGGTCCTGGAGGG - Intergenic
972203899 4:36747933-36747955 CCCAACCTTCAGGCCAGGGAGGG + Intergenic
975910261 4:79258693-79258715 CCCCACCTTCAGGCCATGGAGGG + Intronic
977816249 4:101416887-101416909 CCCCACCTTCAGGACAGGGATGG - Intronic
985519575 5:367200-367222 CCCACCCTGGAGGAGCTGGGGGG + Intronic
985671392 5:1208766-1208788 CTCATCCTGCTGGTCCTGGAGGG + Exonic
985781217 5:1872771-1872793 CAGCACCTGCAGGCCCTGGATGG + Intergenic
990418845 5:55612884-55612906 ACCAATCAGCAGGACATGGATGG + Intergenic
990419531 5:55617707-55617729 ACCAATCAGCAGGACATGGATGG + Intergenic
992947900 5:81827434-81827456 CCAAACCTGCAGGACATTAATGG + Intergenic
994825658 5:104710171-104710193 CCCTTCCTGCTGGACCTGCAAGG + Intergenic
994954548 5:106511134-106511156 ACCAATCAGCAGGACGTGGATGG + Intergenic
997163130 5:131630442-131630464 CCAAACCTGCAGTATCTGGGAGG + Intronic
997522853 5:134534454-134534476 CACCACCAGCAGGACCAGGATGG - Intronic
997885979 5:137630298-137630320 CCTACACTGGAGGACCTGGAGGG - Intronic
997960431 5:138316510-138316532 CCCCACCTTCAGGACGGGGAGGG + Intronic
998422878 5:142003653-142003675 CCCAACCTGCACCACCAGCAAGG + Intronic
998728466 5:145045757-145045779 TCCAACCTACAGGACCTGCTGGG + Intergenic
999628062 5:153540986-153541008 CAAAACCTGCAGGACCCGGGAGG + Intronic
1000549828 5:162647309-162647331 ACCAACCAGCACGACATGGATGG + Intergenic
1001033107 5:168277094-168277116 CCCAAGAACCAGGACCTGGAAGG - Intergenic
1001705066 5:173735593-173735615 CAAGACCTGCAGGACATGGATGG + Intergenic
1001929691 5:175664131-175664153 CCCAACCTCCAAGAACAGGAGGG + Intronic
1002765109 6:232678-232700 CCCAACCCCCAGGGCATGGATGG - Intergenic
1004177116 6:13349640-13349662 CGCAACCTCCAGGCCATGGACGG - Intergenic
1004524132 6:16390332-16390354 CCCAAGATGCAGGGCATGGAGGG - Intronic
1006646210 6:35516032-35516054 CCCAGCCTGAAGGATCTTGAAGG + Intergenic
1010268468 6:73893612-73893634 CCCAACCAGCTGGACATAGAAGG - Intergenic
1015069776 6:129077951-129077973 CCAAACCCGCAGGACGTGCAAGG + Intronic
1017809836 6:157976896-157976918 CTCAAACTGTAGGTCCTGGAGGG + Intergenic
1017823462 6:158064905-158064927 CCCAACCAGCAGCAGCTTGATGG - Exonic
1019443173 7:1057568-1057590 CCCCAGCTGCAGGTCCTGGCAGG - Exonic
1019559537 7:1649085-1649107 CCCAGCCTCCATGACCTGCAAGG + Intergenic
1019771539 7:2886589-2886611 CCCAGCCTGCTGGAGCAGGAAGG - Intergenic
1021474709 7:21047888-21047910 CCCAATCAGAAGCACCTGGAGGG + Intergenic
1022965383 7:35467017-35467039 CCCCACCAGCCGGACTTGGAGGG - Intergenic
1023888844 7:44378516-44378538 CCCACCTTGGAGGACCAGGAGGG + Intergenic
1024196027 7:47059739-47059761 CCCAGCCAGCAGGGCCAGGAAGG + Intergenic
1029309130 7:99644935-99644957 CCCACCCAGCAGGAGCAGGATGG + Intergenic
1029706271 7:102277971-102277993 CTCACTCTGCAGGGCCTGGAGGG - Intronic
1029976039 7:104834732-104834754 CTCCGCCTGCAGGACCTGCATGG - Intronic
1031513166 7:122673296-122673318 ACCAATCTGCAGGATGTGGATGG - Intronic
1032224796 7:130022746-130022768 CCCAACCCCCAGGCCATGGATGG + Intronic
1034275304 7:149821389-149821411 CCCGACGTGGAGGACCTGGGTGG - Intergenic
1036688140 8:10925131-10925153 GCCTACCTGCAGGCCCTGGCAGG - Intronic
1037828370 8:22173647-22173669 CACAGCCTGCTGTACCTGGAAGG - Exonic
1046490807 8:114951203-114951225 CCCAATCAGCAGGACGTGGGTGG - Intergenic
1046781635 8:118221756-118221778 CCCTACCTGCAGAACCAGTATGG - Intronic
1047883437 8:129221182-129221204 CCCAACCACCATGACCTGGCAGG + Intergenic
1047908736 8:129502351-129502373 CAGAACCTGAAGGACCTGTATGG + Intergenic
1048466111 8:134665859-134665881 CCCAGCCTGCAGGACCTCAGGGG - Intronic
1048693147 8:136989895-136989917 CCCAACTTGCAGGGCCAGGGAGG + Intergenic
1050057440 9:1670519-1670541 CCCAACAAGCAGGAGCTTGAAGG + Intergenic
1051864281 9:21661895-21661917 CCCTACCTGCAGCACCTGAAGGG + Intergenic
1051955480 9:22687929-22687951 ACCAATCAGCAGGACGTGGACGG + Intergenic
1056204413 9:84306269-84306291 CCCAAACTCCAGGACCTCAAAGG + Intronic
1057792952 9:98135994-98136016 CCCTGCCTTCAGGGCCTGGAGGG - Intronic
1059423921 9:114209249-114209271 CCCTACATCCAGGACCTTGAAGG + Intronic
1061153899 9:128845638-128845660 CCCAACCTGCAGGGGCTGCCTGG + Intronic
1185837783 X:3361108-3361130 CACAAGCAGCCGGACCTGGAGGG - Intergenic
1192185133 X:68941597-68941619 CCCAACCTGCAGGGCGGGGGTGG - Intergenic
1192270920 X:69578550-69578572 CACTGCCTCCAGGACCTGGAGGG + Intergenic
1195439163 X:104882651-104882673 ACCAATCAGCAGGACGTGGATGG + Intronic
1197250254 X:124208800-124208822 CCCACCCTGCTGGAACTTGACGG - Intronic
1200136528 X:153877762-153877784 CCTAACCTGGAGCATCTGGAAGG - Intronic
1200216173 X:154369152-154369174 CCCAGCAGGCAGCACCTGGAGGG + Intronic
1200408940 Y:2842730-2842752 CCCAACCTTGAAGACCTGGCAGG + Intronic