ID: 958962358

View in Genome Browser
Species Human (GRCh38)
Location 3:100522409-100522431
Sequence CTGTGAATTCAGAAGGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 443
Summary {0: 1, 1: 0, 2: 3, 3: 43, 4: 396}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958962358_958962361 0 Left 958962358 3:100522409-100522431 CCATCCTCCTTCTGAATTCACAG 0: 1
1: 0
2: 3
3: 43
4: 396
Right 958962361 3:100522432-100522454 AAACATCCACGCAAATAGACTGG 0: 1
1: 0
2: 1
3: 14
4: 176
958962358_958962363 6 Left 958962358 3:100522409-100522431 CCATCCTCCTTCTGAATTCACAG 0: 1
1: 0
2: 3
3: 43
4: 396
Right 958962363 3:100522438-100522460 CCACGCAAATAGACTGGCCTTGG 0: 1
1: 0
2: 0
3: 2
4: 53
958962358_958962364 11 Left 958962358 3:100522409-100522431 CCATCCTCCTTCTGAATTCACAG 0: 1
1: 0
2: 3
3: 43
4: 396
Right 958962364 3:100522443-100522465 CAAATAGACTGGCCTTGGCTCGG 0: 1
1: 0
2: 0
3: 13
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958962358 Original CRISPR CTGTGAATTCAGAAGGAGGA TGG (reversed) Intronic
900084076 1:878840-878862 CTCTGGAATCAGATGGAGGAAGG - Intergenic
900641931 1:3691668-3691690 CTGCTAATTGAGAAGGTGGAAGG + Intronic
900747613 1:4371868-4371890 CTGTCAATCTGGAAGGAGGAAGG - Intergenic
901642851 1:10701813-10701835 CTGTTAGTTCAGCAGGAGGCAGG - Intronic
903076952 1:20777843-20777865 CAGAGAATTCCAAAGGAGGATGG - Intronic
903282407 1:22257460-22257482 CTCTGGATCGAGAAGGAGGAAGG - Intergenic
903315598 1:22502461-22502483 ATATGAATTCAGGAGGAGGGAGG - Intronic
903467244 1:23560093-23560115 CTGAGATTGCAGAAGGAGGAGGG + Intergenic
903679408 1:25087304-25087326 AAGTGAATTGAAAAGGAGGAAGG - Intergenic
904804041 1:33118503-33118525 CTGTGACTGCAGAGGGAGGCAGG + Intronic
904882260 1:33709870-33709892 CTGTGGATTCACGAGGAGGAGGG + Intronic
905294670 1:36946693-36946715 CTGTGAAATGAGAAGGTGCATGG - Intronic
905300525 1:36983536-36983558 CTGTGAAATGAGAATGATGATGG - Intronic
905369880 1:37477299-37477321 GTTTGTATCCAGAAGGAGGAGGG + Intronic
907052636 1:51340023-51340045 CTGTGTCTTCACATGGAGGAAGG - Intronic
907394291 1:54178531-54178553 ATGTGGAGTCAGAGGGAGGAGGG + Intronic
907575020 1:55518635-55518657 AGGTGAAATCAGAGGGAGGAAGG + Intergenic
907695345 1:56721073-56721095 CTGTGAATACAAAAGGAGACTGG - Intronic
909053964 1:70800837-70800859 CTGAAGATTCAGAAGGAGCAGGG - Intergenic
910400651 1:86834866-86834888 CTGTGCATTCAGTAGGAATAAGG + Intergenic
910628892 1:89337074-89337096 CTGTGGATTCAGAGGGTGGAAGG + Intergenic
911466599 1:98262207-98262229 GAGTGAATTTAGAAGGACGATGG + Intergenic
913088493 1:115460072-115460094 CTGTGAAGTAAGTAGGGGGAAGG + Intergenic
914392888 1:147237539-147237561 CTGCCAACTCAGAAGGAGGCAGG + Intronic
915168051 1:153959486-153959508 CTGTGCTTTGAGAAAGAGGAAGG + Exonic
915815749 1:158963009-158963031 CTGAGGATTCATAGGGAGGAGGG - Intronic
915892042 1:159781602-159781624 CTGTGAGTTGTGAAGGAGAAGGG + Intronic
916115506 1:161481945-161481967 CTGTCCATCCAGAAGGAGGTTGG - Intergenic
917779957 1:178383741-178383763 CTGTGAATTCTGAATTAGGAGGG - Intronic
918077796 1:181183538-181183560 CTGTGTCCTAAGAAGGAGGATGG + Intergenic
918269127 1:182879202-182879224 CTGTGTATACACAAGGAGGATGG + Intronic
918279014 1:182984546-182984568 CTTTGAACCCAGAAGGTGGATGG + Intergenic
918625437 1:186651714-186651736 CTGAGAGTTCAGAAAGAAGATGG - Intergenic
918922041 1:190725148-190725170 CTGTGTCCTCAGAAGGTGGAAGG + Intergenic
920034622 1:203057952-203057974 TTCTGAGTTGAGAAGGAGGAGGG + Intronic
921095620 1:211884945-211884967 ATGAGCATTCAGAAGGTGGAGGG - Intergenic
921782661 1:219185596-219185618 CTAAGAATTCAGAAGGGGGATGG + Intronic
922664387 1:227456188-227456210 TTGGAAATTCTGAAGGAGGATGG - Intergenic
923809356 1:237295293-237295315 CAGGAAAGTCAGAAGGAGGAAGG + Intronic
923990294 1:239428389-239428411 CTGTGAATTGACAAGGAGTCAGG + Intronic
924154363 1:241160916-241160938 GTGTGAAATCAGAAGGAGTATGG + Intronic
924356793 1:243186513-243186535 CTTTGGATTGAAAAGGAGGAGGG - Intronic
924638304 1:245809450-245809472 CAGTGAGTTCAAAAGGAGGAAGG + Intronic
1062763170 10:43096-43118 CTCTGGAATCAGATGGAGGAAGG + Intergenic
1063383955 10:5604297-5604319 CTCAGACTTCAGAAGGAGGAGGG + Intergenic
1063560721 10:7124195-7124217 CTTTGGATTCAGAATGAGAATGG + Intergenic
1064204939 10:13314856-13314878 CTGTGAATTCAGGGTAAGGAAGG - Intergenic
1064706332 10:18076172-18076194 CTGTGAACTCAGAGGGGAGACGG - Intergenic
1068805167 10:61187064-61187086 ATTAGAATTCAGAAAGAGGATGG + Intergenic
1070376397 10:75835469-75835491 CTGTGAATTCATATGGAAAAAGG - Intronic
1070714281 10:78707927-78707949 GTGTGCATACAGAAGGAGGAAGG - Intergenic
1071239675 10:83691857-83691879 CTGTCACTGCAGAAGGGGGAGGG - Intergenic
1073141084 10:101248235-101248257 CTGTGTCTTCACATGGAGGAAGG + Intergenic
1075309653 10:121402993-121403015 CTGTGACCTCACAAGTAGGAAGG + Intergenic
1075631823 10:124005092-124005114 ATGTGAATTGAGGAGGAGGTGGG + Intergenic
1076167007 10:128290749-128290771 CTGTGACTAGATAAGGAGGAAGG + Intergenic
1076217552 10:128708507-128708529 CTGGGAATTTAGAAAGAGAAAGG - Intergenic
1076272046 10:129162216-129162238 CTGTTCATTCAGCAGGAGGTGGG + Intergenic
1077510366 11:2957201-2957223 CTGTGAATTCAGCGTGAAGAAGG - Intronic
1077737861 11:4810137-4810159 CTCTGTATACAGAAGTAGGAAGG + Intronic
1077829200 11:5846124-5846146 CTATGAATACAGAAGGAAAAGGG - Intronic
1078110828 11:8390435-8390457 CTGTGAAAGCAAATGGAGGAAGG + Intergenic
1078292767 11:10030330-10030352 CACTGAGTTCAGAAGGAGGTAGG + Intronic
1079363285 11:19787703-19787725 CTCTGAATTCAGACCCAGGAAGG + Intronic
1080709628 11:34734389-34734411 CTGAGCATGCAGAAAGAGGATGG - Intergenic
1080928256 11:36781186-36781208 CGGTGATATCAGAAGAAGGAAGG - Intergenic
1081067124 11:38557685-38557707 GTGGGAATTGAGAAGGAGGGTGG - Intergenic
1082655431 11:55850481-55850503 CAGTGAAGTCAGAAGGTGAACGG + Intergenic
1082720724 11:56672345-56672367 TTGTGAATTCAGAGGGATTAAGG - Intergenic
1084488563 11:69465194-69465216 CTTTGAATTTACAAGGAGCATGG + Intergenic
1084952521 11:72674443-72674465 CTGATAATGCAGAAGGGGGAGGG + Exonic
1085254066 11:75162481-75162503 CTGTGACCTAAGAATGAGGAAGG + Intronic
1085262905 11:75218507-75218529 GAGTGAATGCAGAAGGAGAAAGG + Intergenic
1085749163 11:79145330-79145352 CTTTTAATTCAGAGGTAGGAGGG - Intronic
1086869741 11:92022743-92022765 CTTTGAATTCTGAGGGAGAAGGG - Intergenic
1087477721 11:98657977-98657999 CTGTGTATTCACATGGTGGATGG - Intergenic
1087764670 11:102137610-102137632 CTGTGATTTCACATGGAGCAGGG - Intronic
1088257748 11:107916796-107916818 ATGTGGAGCCAGAAGGAGGATGG - Intronic
1089133785 11:116233416-116233438 CGATGAATTCAGAAGGAGTAAGG + Intergenic
1089188111 11:116634828-116634850 CTGTGACTTCACATGGTGGAAGG + Intergenic
1090213016 11:124936114-124936136 CTGTGTATTCAGAGGGAAGTTGG - Exonic
1090589258 11:128247435-128247457 CTGTTAATTCAGATTGTGGATGG - Intergenic
1090860822 11:130650963-130650985 CTGTGGACTCAGAATTAGGATGG + Intergenic
1091966498 12:4746652-4746674 CTGTGAGTACAGAAGCAGGCTGG - Intronic
1092648073 12:10601418-10601440 CCGTGAATTCAGAAGGACCCGGG + Intergenic
1094233452 12:28135873-28135895 CTGTGAATTCAGACAGATGTGGG - Intronic
1094813058 12:34160867-34160889 CTCTGAAATCAGATGGAGGAAGG + Intergenic
1096277464 12:50222323-50222345 TTGTCACTTCAGCAGGAGGATGG + Exonic
1096798606 12:54094367-54094389 CTGGGAATTCAGGTGGGGGAGGG - Intergenic
1096839250 12:54370589-54370611 CTGGGAATTCAGCAGTGGGAGGG - Intronic
1098285137 12:68899162-68899184 GTGTGGATTCAGAAAGTGGAAGG + Intronic
1100188889 12:92168853-92168875 CCATGAATTCATAAGGAAGAGGG - Intergenic
1101294308 12:103405133-103405155 CTGTTATTTAAAAAGGAGGAGGG + Intronic
1101791573 12:107932576-107932598 ATGTGAATTCAGCAAGAAGAGGG + Intergenic
1101817948 12:108160168-108160190 CTGTGAGTTCTGCAGGAAGATGG + Intronic
1102492448 12:113297422-113297444 CTGTGACTTCAGAAGGCAGGTGG + Exonic
1103277746 12:119727437-119727459 CTGTGGATTCAGAAGGGGGAAGG + Intronic
1104377352 12:128276547-128276569 CTGAGAACTCAGAAGGAGAAGGG - Intronic
1105540533 13:21312366-21312388 CTGTGAAATAAGAACCAGGAAGG + Intergenic
1105874620 13:24541137-24541159 CCCTGAATTCAGAGGGAGGCTGG + Intergenic
1106465161 13:30006916-30006938 CAGTGCTTTCAGAAGGAGCACGG + Intergenic
1106907784 13:34426936-34426958 CTGAGATTTCAGAAAGAAGAAGG - Intergenic
1107761812 13:43687722-43687744 CTGTAAATTCTGCAAGAGGAAGG - Intronic
1108240014 13:48454509-48454531 CTGGGAATACAGAAGTAAGATGG + Intronic
1110342815 13:74413396-74413418 CTGCCAATTCAGAAGGGGGCAGG - Intergenic
1110428996 13:75401267-75401289 CTGTGACTTCAGAGGAAGAAAGG - Intronic
1110567679 13:76972560-76972582 CTGTGACTTCACCAGCAGGAAGG + Intergenic
1110678013 13:78273362-78273384 CTGGTAGTTCAGAAAGAGGATGG - Intergenic
1110797185 13:79652955-79652977 CTGTGAACTGTGAATGAGGAGGG + Intergenic
1111598521 13:90441991-90442013 GTGTGAAAGGAGAAGGAGGAGGG - Intergenic
1111788713 13:92825149-92825171 CTGTGATTTCAGCTGGAGAAGGG - Intronic
1112033035 13:95474631-95474653 CTGTGTATTCAGAAACAGCAGGG + Intronic
1112201372 13:97279225-97279247 CTTTGAAATCAGAAGGACCAGGG + Intronic
1113405142 13:110031931-110031953 CTGGAAATTAAGAGGGAGGAAGG + Intergenic
1113866997 13:113532882-113532904 CTGCGACTTCAGTAGGAGGGAGG - Intronic
1113867033 13:113533101-113533123 CTGCGACTTCAGTAGGAGGGAGG - Intronic
1113954599 13:114090738-114090760 CTGTGAATTTAGAGGAAGCAAGG - Intronic
1114577271 14:23726317-23726339 ATTTGAAGTCAGAAAGAGGAGGG - Intergenic
1115145384 14:30220203-30220225 ATGTAAATTCATAAGGAAGATGG + Intergenic
1116147927 14:41099567-41099589 CTGTGACTTCAGAGGGTGGAAGG + Intergenic
1116528820 14:45941042-45941064 CTGTGTATTCACATGGTGGAAGG + Intergenic
1116950748 14:50876452-50876474 CTGAGAATACAGGAGCAGGAAGG + Intronic
1117162035 14:52999437-52999459 CTGTGAATGTAGAAGGTGGGGGG + Intergenic
1120823362 14:88933224-88933246 GTGTGAAGTCAGTGGGAGGAGGG + Intergenic
1121452063 14:94014986-94015008 CACTGAATTCAGAGGGAGGTTGG + Intergenic
1121675638 14:95750508-95750530 TTATGACTTCAGAGGGAGGAAGG + Intergenic
1122319133 14:100843198-100843220 CGGAGAAATCAGAAGCAGGAAGG - Intergenic
1122647565 14:103205659-103205681 CTGTGAAGTGAGAAAGATGAAGG + Intergenic
1123663380 15:22586299-22586321 CTGTGATTTCAACAGGACGAGGG + Intergenic
1124099128 15:26677187-26677209 CTGTGATTTCAGAGGTAGGAAGG + Intronic
1124259428 15:28175421-28175443 CTGTGATTTCAACAGGACGAAGG + Intronic
1124317210 15:28680731-28680753 CTGTGATTTCAACAGGACGAGGG + Intergenic
1124800062 15:32823878-32823900 CTGCGAACTCACAAGGTGGAAGG + Intronic
1126314582 15:47356628-47356650 CTGTGAAATGAGAGGGATGAAGG - Intronic
1126351642 15:47750565-47750587 ATGTGCATTCTGAAGGAGCAAGG - Intronic
1126474149 15:49048384-49048406 CTTTCAATTGTGAAGGAGGACGG - Intergenic
1128299983 15:66560577-66560599 CTGGGAATTTTGAAGGAGGAAGG - Intronic
1128965132 15:72051337-72051359 CTGTCAACTCAGAAGGTGGCAGG - Intronic
1130829375 15:87583967-87583989 CTGTGAATACGGAAGAAGCAAGG + Intergenic
1130915439 15:88300973-88300995 CTGTGAGCTCAGAAGCAGGATGG + Intergenic
1131302929 15:91215349-91215371 CTGCTAAAACAGAAGGAGGAGGG - Intronic
1132205588 15:99984118-99984140 CCGCGAATTCAGAGGAAGGAGGG - Intronic
1132620360 16:863822-863844 CTGAGATTTTAGAAAGAGGAAGG - Intronic
1132682004 16:1146265-1146287 CTGTGGAGTGGGAAGGAGGAGGG - Intergenic
1132858856 16:2060186-2060208 CTGTGAGCACAGAACGAGGACGG - Intronic
1133981684 16:10637385-10637407 CAGTGAATAAAGAAGGAAGAAGG + Intronic
1134083160 16:11338425-11338447 CTGTGTCTTCACAAGGTGGAAGG + Intronic
1135177424 16:20242900-20242922 CTGGGAATTGGGATGGAGGATGG + Intergenic
1135863189 16:26076257-26076279 CTGGCAATTCAGTAGGAGCACGG + Intronic
1136398005 16:30003509-30003531 CTGTGAAGACAGAAGCAGGTTGG + Intronic
1137510020 16:49090973-49090995 GTGAGCATTCAGATGGAGGAAGG - Intergenic
1138081416 16:54094522-54094544 CCGTGAATTCAGGCTGAGGAAGG - Intronic
1138426684 16:56938787-56938809 CTATAGATTCAGATGGAGGATGG + Intronic
1138440026 16:57028635-57028657 CTGGGATTTCAGAAAGAGGGAGG - Intronic
1139525977 16:67516959-67516981 GTGTTAAGTGAGAAGGAGGAAGG + Intergenic
1139625974 16:68188428-68188450 CTGCCAATTCAGAAGGTGGCGGG + Intronic
1141270337 16:82534035-82534057 CTGGGTAATCAGAATGAGGAAGG - Intergenic
1141417495 16:83887688-83887710 CGGGGAATTCAGAAGGAGGGAGG + Intergenic
1142107785 16:88315602-88315624 CTGTGACCCCAGAAGGAGGGTGG + Intergenic
1142541726 17:664920-664942 CAGGGAATGCAGGAGGAGGACGG + Intronic
1143741058 17:8954400-8954422 CTGTGTTTTCAGAGGGAGTAAGG - Intronic
1143858615 17:9871570-9871592 CTGTCATCTCAGAAAGAGGAAGG - Intronic
1145289462 17:21531776-21531798 CAGTGCATCCAGAAAGAGGAAGG + Exonic
1145921989 17:28616540-28616562 CTGAGACTTCAGAACGAGGATGG - Intronic
1146451686 17:32979561-32979583 CTCTGAACTCAGAAGGAGATCGG + Intronic
1147862269 17:43530475-43530497 CTGCGAGTTCAGGGGGAGGAGGG + Intronic
1149084171 17:52694379-52694401 CTGTGTTTTCACAAGGTGGAAGG - Intergenic
1149159199 17:53669762-53669784 CTGATAATTCAAAAGGAGGTAGG + Intergenic
1149604637 17:57916202-57916224 CTGAGAATGCAGAAGGCCGAGGG + Intronic
1150977581 17:70105991-70106013 CTGAGAATTCAGATGGAGTGCGG + Intronic
1151003081 17:70400875-70400897 ATGTGAATTCATATGGTGGATGG + Intergenic
1151709417 17:75793656-75793678 CTGTGAATAAAGAATAAGGAAGG - Intronic
1152158099 17:78648104-78648126 CTGTGGAGTCAGAAGGAAGCCGG + Intergenic
1152183420 17:78839938-78839960 AAGTGACTTTAGAAGGAGGAGGG - Intronic
1152956079 18:43427-43449 CTCTGGAATCAGATGGAGGAAGG + Intergenic
1153325092 18:3810512-3810534 CTGTGAATTACTGAGGAGGAAGG + Intronic
1156692246 18:39722263-39722285 CTGATAATTCAGAAGGTGGTGGG + Intergenic
1157301934 18:46485399-46485421 CTGGGAATGCAGCAGGAGGTGGG + Intronic
1157478495 18:48038048-48038070 AGGTGAATTCAGGAGGAGGTAGG + Intronic
1159095734 18:63899411-63899433 CTGGAAATTCAGAAGAATGAAGG - Intronic
1159362821 18:67427352-67427374 GTAGGAATGCAGAAGGAGGAAGG - Intergenic
1159403990 18:67976581-67976603 CATTGAATTCAGAATCAGGATGG - Intergenic
1160956070 19:1692198-1692220 TAGTGATTTCAGAAGGAGGGGGG - Intergenic
1161673293 19:5626671-5626693 CTGGGAATTCCAATGGAGGATGG + Intronic
1161715910 19:5876346-5876368 CTGGGAATTAAGCAGGAGGCAGG - Intronic
1162810997 19:13164251-13164273 ATCTGAAATCAGATGGAGGAGGG + Intergenic
1163272525 19:16262757-16262779 CTGGGGAGTCAGAAGTAGGATGG - Intergenic
1163775619 19:19215586-19215608 GTGTGAAGTCAGGAGGAGGATGG + Intronic
1164946686 19:32300400-32300422 CTGTAACTTCACATGGAGGAAGG - Intergenic
1165929843 19:39350353-39350375 CTCTTCATTCAGAAGCAGGATGG - Intronic
1166114165 19:40642543-40642565 CTGTAAATAAAGAAGGAAGAGGG + Intergenic
1168296528 19:55379728-55379750 CAGTGAAGACAGAAGGAGGCCGG + Intronic
1168363091 19:55759573-55759595 CTTTTAATTCAGAAAGAGAAAGG + Intronic
1168364043 19:55769573-55769595 CTTTTAATTCAGAAGGAGAAAGG + Intronic
924980815 2:219454-219476 CTGTGTCCTCACAAGGAGGAAGG - Intronic
925208933 2:2031193-2031215 CTGTGAATTCAGAAAGATTTTGG - Intronic
925238231 2:2297730-2297752 CTGGGAGGGCAGAAGGAGGAGGG - Intronic
925493651 2:4422968-4422990 CTGTGAATTCAGGAGCAGGCTGG + Intergenic
928098975 2:28423751-28423773 CTGTCAAATCAGGAGAAGGAGGG - Intergenic
930000740 2:46859983-46860005 CAGTGACCCCAGAAGGAGGAAGG + Intergenic
930505714 2:52280990-52281012 CTGTGTTCTCAGATGGAGGAAGG + Intergenic
931014410 2:57959924-57959946 TTGTGACTTCAGCAGGAGCAAGG + Intronic
931129004 2:59312000-59312022 CTGTAAGTTCTGAAGGAGCAGGG + Intergenic
931138999 2:59436425-59436447 CTGTGAATTCCTAATGAGGAAGG + Intergenic
931833609 2:66076878-66076900 CTGTGAAGTTATAAAGAGGAAGG - Intergenic
931879264 2:66549890-66549912 CTGTGAATGCAGGAAGAGGAAGG + Intronic
931897227 2:66745544-66745566 TTGTGAATTCATCAGGAAGAAGG - Intergenic
932624240 2:73284822-73284844 CTGTGAATCCGGAAGGGGGCGGG + Intergenic
933311341 2:80665407-80665429 CTGTGTATTAAGAAGCTGGAGGG + Intergenic
936169085 2:110152488-110152510 CTCTGAGTCCAGAAGGAGCATGG + Intronic
937398383 2:121559024-121559046 GTGTGAATTCAGACAGGGGATGG - Intronic
937961947 2:127466715-127466737 CTGTGCACTCAGAAGAAGGCTGG + Intronic
938089916 2:128424751-128424773 CTGTCAAGTCAGGAGGGGGATGG - Intergenic
939418730 2:141937293-141937315 CTGTGAAGCCAGGAGGTGGAAGG + Intronic
941892722 2:170598377-170598399 CTGTTTATTCAGATGGAGGCAGG - Intronic
941918779 2:170829074-170829096 CTGTATAAGCAGAAGGAGGAGGG - Intronic
942996202 2:182263570-182263592 CTGTGAATTCAGAGCTAAGAGGG - Intronic
944139056 2:196434967-196434989 CTGTGAACTCAATGGGAGGATGG - Intronic
944152057 2:196570325-196570347 TTGTGAATTCAGAAGGTAGCTGG - Intronic
946474505 2:219994618-219994640 CTGTGAATTCAAAAGTATTAAGG - Intergenic
947935431 2:233999645-233999667 CTGTGAATTTGGGAGTAGGACGG - Intronic
948302140 2:236915508-236915530 CAGGAAATTCAGAAGGAGGTTGG - Intergenic
1169358027 20:4924288-4924310 CTCTGACTCCAGAGGGAGGACGG - Intronic
1169801866 20:9518795-9518817 CTGTGCATCCAGAAGGCAGAGGG + Intronic
1169934111 20:10864711-10864733 CTGTGACTTCATAAGCAGAATGG + Intergenic
1169938977 20:10916598-10916620 TGGTGAATGCAGAAGGAAGAAGG - Intergenic
1169969108 20:11249416-11249438 CTGAGAATTCAGTGGGTGGAGGG - Intergenic
1170328833 20:15185752-15185774 CTCTGAACTAAGCAGGAGGATGG - Intronic
1170744276 20:19084782-19084804 CTGTCAATTCACAATGAGGCAGG - Intergenic
1170803096 20:19606679-19606701 CTGAGAATGCAGAGGGAAGAAGG + Intronic
1170846034 20:19962672-19962694 CTGTGAATTGAGGTGAAGGAAGG + Intronic
1171110161 20:22473348-22473370 GGGTGAATTCAGAAGGGAGATGG - Intergenic
1171161866 20:22933346-22933368 CTTGGAATTCAGAAGAAAGATGG + Intergenic
1171246269 20:23612214-23612236 TTTTGACTTCAGAATGAGGATGG - Intergenic
1171797813 20:29579973-29579995 CTGGGAATTCAGGTGGGGGAGGG + Intergenic
1171850434 20:30304188-30304210 CTGGGAATTCAGGTGGGGGAGGG - Intergenic
1172824261 20:37767099-37767121 GTGTGAATTTTGAAGGAGAAAGG - Intronic
1175608208 20:60328687-60328709 CTGTGAATTAGGGAGGTGGAGGG - Intergenic
1176152001 20:63596191-63596213 CTGTGCCTTTAGAAGGAGGAAGG - Intronic
1177782295 21:25634274-25634296 CTTTGAATTCAGAATTAGAATGG + Intergenic
1178178052 21:30127980-30128002 AGGTGAATTCACAAGGAGCAAGG - Intergenic
1178716911 21:34973327-34973349 CTGTGAATGGAGAAGAACGAGGG + Intronic
1180228870 21:46414455-46414477 CTGTGTGTCCAGGAGGAGGAGGG - Intronic
1180228973 21:46414857-46414879 CTGTGTGTCCAGCAGGAGGAGGG - Intronic
1180929368 22:19578544-19578566 CTGGGAATGCTGAAGCAGGAGGG + Intergenic
1181090498 22:20469278-20469300 CAGGGAATTAAGAAGGTGGACGG + Intronic
1182329647 22:29542047-29542069 CTGAGAGATGAGAAGGAGGAAGG - Intronic
1182630058 22:31678199-31678221 CTGTGGATAAGGAAGGAGGAGGG + Intronic
1183579494 22:38715424-38715446 CTGGGCCTGCAGAAGGAGGAAGG - Intronic
1184515140 22:44957096-44957118 CTGTGAGCTCAGAGGGAGGAGGG - Intronic
949551631 3:5116634-5116656 ATGTGGATGGAGAAGGAGGAAGG - Intergenic
949573155 3:5312598-5312620 CTTTCCATGCAGAAGGAGGAAGG - Intergenic
950658493 3:14452134-14452156 CTGTGAAAACAGAGGGAGGAAGG - Intronic
950899670 3:16486275-16486297 CTCTGGATTTAGAATGAGGAAGG - Intronic
951008479 3:17647633-17647655 CTGTGACTGCAGTAGGGGGAAGG + Intronic
951120438 3:18920698-18920720 CTGTGTTTTCAGAAGGAGGAAGG - Intergenic
952719639 3:36519025-36519047 CTGGGATTCCAGAAGGAAGAGGG + Intronic
953445051 3:42956315-42956337 CTGTGTACTCAGAAAGTGGAAGG + Intronic
953549876 3:43893974-43893996 CTGTTATTTCAGAGGGAGGGAGG + Intergenic
953663719 3:44910123-44910145 CTCAGAACTGAGAAGGAGGAAGG - Exonic
953810391 3:46107802-46107824 CTGTGACTTGAGGTGGAGGATGG + Intergenic
954595936 3:51824730-51824752 CTGTGCGTTAAGGAGGAGGATGG - Intronic
954894884 3:53966703-53966725 CTGTGAAGCTAGAAGCAGGATGG - Intergenic
955216978 3:56992284-56992306 CTGTGAAATCTGAAGAATGAAGG + Intronic
956011233 3:64833777-64833799 CAGTGAATTCAGAAAGGGGAAGG + Intergenic
956615940 3:71172726-71172748 CAGTGAATCCAGAAGGAAGAGGG - Intronic
956894062 3:73641638-73641660 CTGTGAATTCAGCTAGTGGAAGG - Intergenic
957034967 3:75285557-75285579 CTGTAAATGCAGAATGAGCAGGG + Intergenic
958962358 3:100522409-100522431 CTGTGAATTCAGAAGGAGGATGG - Intronic
959132953 3:102380660-102380682 CTATGAATCCAGGATGAGGATGG - Intronic
960422758 3:117467845-117467867 CTATCAATTCAGAAGGAAAATGG + Intergenic
960584484 3:119308471-119308493 CTTTGAAGACAGATGGAGGAAGG - Intronic
961078855 3:124007143-124007165 CTGTAAATGCAGAATGAGCAGGG + Intergenic
961304623 3:125949298-125949320 CTGTAAATGCAGAATGAGCAGGG - Intergenic
963800350 3:149669958-149669980 CTGTCAATAGTGAAGGAGGAGGG + Intronic
964967923 3:162521251-162521273 GTGTGTATTCTGCAGGAGGAAGG - Intergenic
965157579 3:165084163-165084185 TTGTGACTTCACAAGGTGGAAGG - Intergenic
965448746 3:168809947-168809969 CTGTGAAGACAGAAAGGGGAAGG - Intergenic
965910788 3:173772788-173772810 CAGTGAATACAGAAAAAGGATGG - Intronic
969282721 4:6181938-6181960 CTGTGCAGACAGGAGGAGGAGGG + Intronic
971155296 4:24075262-24075284 CTGTGTTTTCACAGGGAGGAAGG - Intergenic
971477184 4:27083517-27083539 TAGAGACTTCAGAAGGAGGATGG - Intergenic
973879691 4:55256959-55256981 CTGTGAATTCCTAAGGCTGAGGG + Intergenic
974212359 4:58795583-58795605 CTGTAAATTGAGAAGAAAGAAGG + Intergenic
975084498 4:70321414-70321436 ATGTGAAACCAGAAGGAGAAAGG - Intergenic
976053887 4:81040099-81040121 CTGAGAATTGAAAAGGAGGTTGG - Intronic
976437319 4:85033082-85033104 CTGTGTTTTCACAAGGTGGAAGG + Intergenic
976652889 4:87454974-87454996 CTGTTATTACAGAAGGAGAAAGG + Intronic
976895160 4:90100398-90100420 CTGTGAAATTAGAAGCAAGATGG + Intergenic
977180670 4:93869711-93869733 CTATGAACTCTGAAGGAGGCAGG + Intergenic
977603765 4:98961474-98961496 CTGTGTCTTCACATGGAGGAAGG - Intergenic
977920906 4:102641436-102641458 CTGAGACTACTGAAGGAGGAAGG + Intronic
978160763 4:105545311-105545333 TTGTGATTTCAGAAGAGGGAGGG + Intergenic
978464048 4:108988612-108988634 CTTTGAAGTCACAGGGAGGAGGG - Intronic
978530025 4:109703425-109703447 CTGTGGCTTCAGGAAGAGGAGGG - Exonic
978806008 4:112801103-112801125 GTGTGAATTCAGAATGAGGAGGG + Intergenic
979027153 4:115592159-115592181 CTTTGCATCCACAAGGAGGAGGG + Intergenic
979245026 4:118493089-118493111 CTTTGGATTGATAAGGAGGAGGG + Intergenic
979831018 4:125303111-125303133 CTGTGAATTCATAAGCAAGGTGG + Intergenic
981985258 4:150846558-150846580 CTCAGAACTCAGAAGGATGAGGG + Intronic
982572545 4:157068495-157068517 CTGTGTCTTCACATGGAGGAAGG + Intergenic
982592767 4:157336183-157336205 CTGTGTATTCATAAAGAGGAGGG + Intronic
983031802 4:162811939-162811961 CTGTGTATTCACATGGTGGAAGG + Intergenic
983620052 4:169751525-169751547 CCGTGAATAGAGAAGGAAGATGG - Intronic
985346441 4:189010353-189010375 GTCTGAATTCAGCAGGAGTAAGG - Intergenic
985440186 4:189978252-189978274 CTCTGGAATCAGATGGAGGAAGG + Intergenic
986696888 5:10365104-10365126 CTGTGAGATCAGAAGAAGCAGGG - Intronic
987369061 5:17176508-17176530 TCGTGAATTCAGAAGGATCAGGG + Intronic
987533299 5:19149676-19149698 CGGGGAATCCAAAAGGAGGAAGG + Intergenic
988768707 5:34409289-34409311 CTCTGCTTTCAGAAGGAGCAAGG + Intergenic
989082533 5:37638838-37638860 CTCAGACTTCAGAAGGAGAAAGG + Intronic
989112745 5:37922969-37922991 CTGAGAACTCAGAAGGAAGAAGG - Intergenic
989243284 5:39224344-39224366 CTGTGAAAACAGATGGGGGAGGG + Intronic
990091463 5:52056211-52056233 CTGAGATATCAGAAGGAGAAAGG + Intronic
991325173 5:65423154-65423176 CTGGAGATTCAGAAGGGGGAAGG + Intronic
991957518 5:72010326-72010348 ATGTGAATTCAGAAGTAGTTAGG + Intergenic
992071724 5:73154786-73154808 CTGGGAATGGAGAAGGAGGGAGG - Intergenic
992417231 5:76563282-76563304 ATTTAAATTTAGAAGGAGGAGGG + Intronic
992604933 5:78446170-78446192 CTGTACATACAGAAAGAGGAAGG + Intronic
992640564 5:78765327-78765349 CTGGGAAATCAGTGGGAGGATGG + Intronic
994673678 5:102794278-102794300 GTGTGATTTCAGTAGGTGGAAGG + Intronic
996215898 5:120865124-120865146 CTGTGAATACAGAAAGAGAATGG - Intergenic
996413454 5:123183802-123183824 CTGTTTAGTAAGAAGGAGGAAGG - Intronic
996428622 5:123344229-123344251 CTGTGAATTCAGATTCAGGCTGG + Intergenic
996714120 5:126572868-126572890 CTGTGTATTCAGAAGGATATAGG - Intronic
998520327 5:142794361-142794383 CTATAAATACAGAAGGAGGGGGG + Intronic
999131847 5:149289633-149289655 TTGTAAATTCAGAGGAAGGAAGG + Intronic
999575408 5:152971227-152971249 TTGGAAACTCAGAAGGAGGAGGG + Intergenic
999815005 5:155167329-155167351 CTGTGATCTCAGAAGAGGGAAGG + Intergenic
999833519 5:155343176-155343198 TTGTGAAATCAGGAGGAGGGAGG - Intergenic
1001352753 5:170985916-170985938 ATGTAAATTCAGAAGAATGAAGG - Intronic
1002018781 5:176348149-176348171 CTGTGGTTTCAGAGGGAGAAGGG - Intronic
1002451354 5:179320620-179320642 CTGTGCTATCAGAAGGAGAAGGG - Intronic
1002677998 5:180935049-180935071 CTATGAAGTGAGAAGCAGGAAGG - Intronic
1002805684 6:571996-572018 GTGTGACTGCAGAAGGTGGACGG + Intronic
1002829312 6:804803-804825 CTGTTAACAAAGAAGGAGGAAGG - Intergenic
1003073088 6:2959988-2960010 CTGTGAGTTCAGGCGCAGGAAGG - Exonic
1003162096 6:3644802-3644824 CTGTGACTTCTGAAGAAGGAAGG + Intergenic
1003199849 6:3949370-3949392 CTGTGAAGTTAGAAGCAAGATGG + Intergenic
1003412681 6:5879452-5879474 CTGTGAAATAAGAACCAGGAAGG - Intergenic
1004050747 6:12076540-12076562 CTGTGTCTTCACATGGAGGAAGG + Intronic
1004069951 6:12288773-12288795 TTTTGATTTTAGAAGGAGGAGGG + Intergenic
1005172882 6:23008482-23008504 CTGTAAATTCAGTGAGAGGAAGG - Intergenic
1006808386 6:36803950-36803972 ATGAGAATACAGCAGGAGGAAGG + Intronic
1010905542 6:81482917-81482939 CTTTGAATTCAGAAAGATCAAGG + Intergenic
1011636491 6:89379456-89379478 CTGTAAATTCTGAAGGGGGCTGG - Intronic
1011886745 6:92106059-92106081 CTGTGAATTCATATGGACCAGGG + Intergenic
1012539539 6:100345204-100345226 CTGTGACTTCAGATGGTGGGGGG - Intergenic
1012635224 6:101529772-101529794 ATGGGAATTCAGAAGAAGGATGG + Intronic
1013921444 6:115409349-115409371 CTGTGAATTCAAGAGCAAGATGG + Intergenic
1016005007 6:139080173-139080195 CTTTCTAATCAGAAGGAGGAGGG + Intergenic
1016166061 6:140945122-140945144 CTGTGAAAGCAGCAGGAGGAAGG + Intergenic
1018237221 6:161738371-161738393 ATGTGAATTCAGAAGATGGAGGG - Intronic
1018921254 6:168177450-168177472 GTGTGTATTCCGAAGGATGAAGG - Intergenic
1019029798 6:169000398-169000420 CTATAAATTCTGAAGGAAGAGGG - Intergenic
1019289272 7:242438-242460 CTGAGAAAGCAGAAGGAGGAGGG + Intronic
1019293126 7:260061-260083 CAGTGAATTCAGAGGCAGGACGG + Exonic
1019604615 7:1902171-1902193 CTGTGATTCCAGGAGGAGGCAGG - Intronic
1019647584 7:2139318-2139340 CTGTGAGCTCAGAGGGAGGGTGG - Intronic
1022270976 7:28807810-28807832 TTGAGAATGAAGAAGGAGGAAGG + Intronic
1022384657 7:29889990-29890012 CAATGAAATCAGGAGGAGGAGGG - Intronic
1022494735 7:30845734-30845756 CTGTGAAAGCAGATGGAGGATGG + Intronic
1023150527 7:37197483-37197505 CACTGAATTCAGAGGTAGGAAGG + Intronic
1023574589 7:41612874-41612896 CTCTAAATTCAGAGTGAGGAAGG - Intergenic
1024305401 7:47924748-47924770 CTGTGAAGTTAGAAGCAAGATGG + Intronic
1024457538 7:49626486-49626508 GTGAGAATTCAGGAGGAGCAAGG + Intergenic
1024674523 7:51626237-51626259 CTGTGAATACACCAAGAGGAAGG + Intergenic
1024999178 7:55299911-55299933 GTGTGAATTCAACAAGAGGAGGG + Intergenic
1026483820 7:70800800-70800822 TTGTGAATTTAGAAGCAAGATGG + Intergenic
1026519392 7:71103248-71103270 CTGTGAAGTTAGAAGCAAGATGG + Intergenic
1026962601 7:74418064-74418086 GTGTAAATTCAGAAGGAACATGG + Intergenic
1027936769 7:84615592-84615614 ATGGGAAATCACAAGGAGGAAGG + Intergenic
1029509000 7:100981532-100981554 GTGAGATTTCAGAAAGAGGAAGG + Intronic
1031173348 7:118318697-118318719 CTGTGACTTCACACGGTGGAAGG + Intergenic
1031290487 7:119928363-119928385 CTGTGGATTCAGAAGGTGCCAGG + Intergenic
1031305834 7:120125826-120125848 CTGTGTCTTCATATGGAGGAAGG - Intergenic
1031714870 7:125096541-125096563 CTGGAGATTCAGAAGGAGGAGGG - Intergenic
1031784049 7:126006335-126006357 TTGTGAATTCAGAATCATGATGG - Intergenic
1034175879 7:149099395-149099417 CTGTGAATTTGGAAAGGGGAGGG + Intergenic
1034902923 7:154918735-154918757 GTGTGAATGAAGAATGAGGAGGG + Intergenic
1035117130 7:156533839-156533861 CAGTGAAGGCAGAAGGAAGAGGG + Intergenic
1035133310 7:156675680-156675702 CTGTGAACTGAGGAGGAGGCGGG - Exonic
1035194677 7:157206823-157206845 CTGTGAAAGCAGGAGCAGGATGG + Intronic
1036298628 8:7555535-7555557 CTTGCAATTCAGATGGAGGAAGG + Intergenic
1036299933 8:7563185-7563207 CTTGCAATTCAGATGGAGGAAGG + Intergenic
1036799712 8:11781266-11781288 CTGGAAGTTCAGAAGGAGGGTGG + Intronic
1037192430 8:16142824-16142846 CTGGGAATACAGAGGGAGGGAGG + Intronic
1037705964 8:21315399-21315421 CTTTGAATTCAGAAAAAGGAGGG - Intergenic
1037916047 8:22774056-22774078 CTGTGAAACCAGCAGGAGGGAGG - Intronic
1040621780 8:49099998-49100020 AGGAGAATTCAGAAGGAAGATGG + Intergenic
1040937146 8:52793265-52793287 GTGTCAACTCTGAAGGAGGATGG + Intergenic
1041016599 8:53597779-53597801 CTAGGAAGTGAGAAGGAGGAGGG - Intergenic
1042317573 8:67440148-67440170 TAGAGAATTCAGAAGGTGGATGG - Intronic
1043695076 8:83207894-83207916 CTGTGGAGTCAGAAGGAGCCAGG + Intergenic
1044122807 8:88418685-88418707 TAGTGACTTCAGAGGGAGGATGG + Intergenic
1044385822 8:91587277-91587299 CTGTGACTTCACATGGTGGAAGG - Intergenic
1044431231 8:92109629-92109651 CTCTGCATATAGAAGGAGGATGG - Intergenic
1044631470 8:94283369-94283391 CTGTGGATTTAAAAGGATGATGG - Intergenic
1046101277 8:109616832-109616854 CTGGGAATGCAAAAAGAGGATGG + Intronic
1046658835 8:116926646-116926668 CTGCGAGTTCAGAAAGAGTAGGG + Intergenic
1048951530 8:139500876-139500898 TTGTGAATGGAGGAGGAGGAAGG + Intergenic
1049495762 8:142931563-142931585 CTGTGATTTCAGGAGGAGACGGG - Intergenic
1050288159 9:4125650-4125672 GTGTGTATTCAGAAAGAGAACGG + Intronic
1050348185 9:4714489-4714511 CAGTGAATTTAGAAGCAGGAGGG - Intronic
1051093410 9:13436985-13437007 CAGTGACTTCAGGAGGAGGCTGG - Intergenic
1051235971 9:14999543-14999565 CTGTGAATAGAGAAGGAAGATGG + Intergenic
1051310467 9:15765606-15765628 CTATCAATTGAGATGGAGGAAGG + Intronic
1052283237 9:26756219-26756241 CTGTGTACTCACATGGAGGAAGG + Intergenic
1052362055 9:27572661-27572683 CTTTGTATTCAGAAACAGGAGGG - Intronic
1052684236 9:31733936-31733958 CTGAGAGTTCAGAACTAGGAAGG + Intergenic
1052767869 9:32660086-32660108 CTGTGAAATCAAAAGCAGGTTGG + Intergenic
1053409319 9:37905245-37905267 CTGGAAATTCAGAAGCATGAGGG + Intronic
1053412143 9:37922812-37922834 CTGTGGATGCAGCAGGAGAAGGG - Intronic
1053788214 9:41667479-41667501 CTGGGAATTCAGGTGGGGGAGGG - Intergenic
1054156925 9:61647289-61647311 CTGGGAATTCAGGTGGGGGAGGG + Intergenic
1054476697 9:65578297-65578319 CTGGGAATTCAGGTGGGGGAGGG + Intergenic
1055114521 9:72592515-72592537 GGGTAAATTCTGAAGGAGGAGGG - Intronic
1056735176 9:89203312-89203334 CTGTGTCTTCACATGGAGGAAGG + Intergenic
1057054707 9:91951318-91951340 CTGTAAATCCAGTAGGAGAATGG + Intergenic
1057133527 9:92670694-92670716 CAGTGAATTTAGGAGAAGGAAGG - Intergenic
1057137785 9:92706043-92706065 CTGTAACTTCAGATGGTGGAAGG + Intergenic
1058603827 9:106699572-106699594 CTGTGAATCACGAAGCAGGAGGG - Intergenic
1058732375 9:107862480-107862502 ATGTGACTTCAGAGGGTGGAAGG - Intergenic
1058778748 9:108311966-108311988 CTGTGAGTTCAGAAGGGGCTGGG - Intergenic
1058910792 9:109518325-109518347 CTGTGAACTCTGCAGGAGGTGGG - Intergenic
1059373330 9:113861649-113861671 CAGAGAACTCAGCAGGAGGATGG - Intergenic
1059606604 9:115842086-115842108 CTTTGGATTGGGAAGGAGGACGG + Intergenic
1060999068 9:127892210-127892232 CTGTGAGGTCAGAAACAGGATGG - Intronic
1186299602 X:8185419-8185441 GGGTGAATGCAGAATGAGGATGG + Intergenic
1186387188 X:9121759-9121781 CTGTGTCTTCACATGGAGGAAGG - Intronic
1186799979 X:13083194-13083216 CTGTGAAATGGGAAAGAGGAAGG - Intergenic
1187081913 X:15998949-15998971 ATGGGATTTCACAAGGAGGAAGG - Intergenic
1187274891 X:17808569-17808591 CTGGGAAGTAAGAAGGAAGATGG - Intronic
1187369785 X:18695453-18695475 GTGTGAATTGACCAGGAGGAAGG + Intronic
1187641516 X:21295835-21295857 CTTTGACTGCAGCAGGAGGATGG - Intergenic
1187987469 X:24829730-24829752 CTGTGTATTTAGGAGGAGGGAGG + Intronic
1188287672 X:28347909-28347931 TGGTGAATTCAAAAGGGGGAGGG - Intergenic
1189368125 X:40405626-40405648 CAGTGAATCCAGAAGGAAAAAGG - Intergenic
1190171003 X:48111627-48111649 CTGTAAATGGAGAAGGAGCAGGG + Intergenic
1194876956 X:99201183-99201205 CTGTGGCTTCAGAGGGTGGAAGG + Intergenic
1199361470 X:146924420-146924442 TGGGGACTTCAGAAGGAGGAGGG - Intergenic
1200624069 Y:5490682-5490704 CCTCCAATTCAGAAGGAGGAGGG - Intronic
1201730254 Y:17194220-17194242 CTCAGAATTCAGAGGGAGCAAGG + Intergenic