ID: 958963657

View in Genome Browser
Species Human (GRCh38)
Location 3:100534974-100534996
Sequence GCGAGAACAGTGGTTCCTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 79}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958963657_958963662 18 Left 958963657 3:100534974-100534996 CCAATAGGAACCACTGTTCTCGC 0: 1
1: 0
2: 0
3: 3
4: 79
Right 958963662 3:100535015-100535037 AGCTCTCTATCATGTTGTCCTGG 0: 1
1: 0
2: 1
3: 16
4: 167
958963657_958963663 19 Left 958963657 3:100534974-100534996 CCAATAGGAACCACTGTTCTCGC 0: 1
1: 0
2: 0
3: 3
4: 79
Right 958963663 3:100535016-100535038 GCTCTCTATCATGTTGTCCTGGG 0: 1
1: 0
2: 1
3: 11
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958963657 Original CRISPR GCGAGAACAGTGGTTCCTAT TGG (reversed) Intronic