ID: 958965952

View in Genome Browser
Species Human (GRCh38)
Location 3:100558421-100558443
Sequence GCATTTCCCGGCCATGAGTG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 77}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958965952_958965958 26 Left 958965952 3:100558421-100558443 CCACACTCATGGCCGGGAAATGC 0: 1
1: 0
2: 0
3: 8
4: 77
Right 958965958 3:100558470-100558492 GTTTTGGTCGTCTTTCTGACAGG 0: 1
1: 0
2: 0
3: 8
4: 172
958965952_958965956 10 Left 958965952 3:100558421-100558443 CCACACTCATGGCCGGGAAATGC 0: 1
1: 0
2: 0
3: 8
4: 77
Right 958965956 3:100558454-100558476 TGTGCACCAGCTGCTGGTTTTGG 0: 1
1: 0
2: 0
3: 29
4: 200
958965952_958965955 4 Left 958965952 3:100558421-100558443 CCACACTCATGGCCGGGAAATGC 0: 1
1: 0
2: 0
3: 8
4: 77
Right 958965955 3:100558448-100558470 CATCTTTGTGCACCAGCTGCTGG 0: 1
1: 0
2: 3
3: 12
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958965952 Original CRISPR GCATTTCCCGGCCATGAGTG TGG (reversed) Exonic
901084510 1:6602448-6602470 GCAGTTCCCGGCCGTGAAGGAGG - Exonic
902896232 1:19482042-19482064 GCATTTCCCAGCCTGGAGGGAGG + Intronic
910537779 1:88318996-88319018 GCGTTTCCCCGCCAGGAGGGTGG - Intergenic
922142849 1:222907450-222907472 GAATTTCCCGGTGAGGAGTGGGG + Intronic
1064709069 10:18104625-18104647 ACATTGCCCGGCCACGAGTCAGG - Intergenic
1064872586 10:19955386-19955408 GCATTTCCCGGAAATGGGTTGGG - Intronic
1071600803 10:86957929-86957951 CCATTTCCTGGCCAGCAGTGTGG - Intronic
1077409295 11:2396006-2396028 GCATGTCCCGCCCCTGGGTGGGG + Intronic
1078086614 11:8237230-8237252 GCAGTTCCCGGGCCTGGGTGTGG - Intronic
1078137993 11:8668458-8668480 CCAGTTGCCAGCCATGAGTGAGG - Intronic
1080388150 11:31822359-31822381 TCATTTCCGTGCCATGAGTGAGG + Intronic
1083895109 11:65616045-65616067 GCAATTCTGGGCCAGGAGTGGGG + Exonic
1085822896 11:79812039-79812061 GCATTTCCAGCCCATGGGAGAGG + Intergenic
1086663458 11:89450986-89451008 TCATTTCCCACCTATGAGTGAGG - Intronic
1093222990 12:16446372-16446394 CCATTTCCTGGACCTGAGTGAGG - Intronic
1097728472 12:63100870-63100892 GCATTTCCCAGCCCTAGGTGAGG + Intergenic
1112069348 13:95831051-95831073 TCATTTCCCACCTATGAGTGAGG - Intronic
1112507185 13:99982085-99982107 GCAGTTCCCGGCCATCGGGGTGG + Exonic
1115369323 14:32594059-32594081 GCAGTGCCAGGCAATGAGTGAGG - Intronic
1117715221 14:58573524-58573546 CCACTTCTCGGCCATGTGTGGGG + Intergenic
1202894652 14_GL000194v1_random:21-43 GCATTTGCTGGACATGAGGGGGG - Intergenic
1124169621 15:27360865-27360887 GCACTGTCTGGCCATGAGTGGGG + Intronic
1132251689 15:100340144-100340166 CCATCTGCCGGCCATGTGTGCGG + Intronic
1132500700 16:283430-283452 GCATTTGCCGGCAAAGGGTGGGG - Intronic
1138571082 16:57873597-57873619 ACATTTCCTGGCCAGGAGTAAGG + Intergenic
1140190341 16:72810472-72810494 TCATTTCCTGGCCAGGCGTGGGG - Intronic
1141895803 16:86957960-86957982 GCCTTTCCCAGCCGGGAGTGAGG + Intergenic
1143688531 17:8539558-8539580 GCATTTCCAGGCCATAATTGAGG + Intronic
1145224691 17:21118183-21118205 GGATTTCCCAGACAGGAGTGGGG - Intergenic
1147844137 17:43393116-43393138 TCATTTCCCTGCCTTGAATGTGG + Intergenic
1147958708 17:44153001-44153023 GCACTTCCAGGCCCTGGGTGGGG + Intronic
1150711840 17:67537574-67537596 ACATTTCCCGTCCATGAATATGG - Intronic
1151829767 17:76542698-76542720 GCAAGTCCCGGCCATGTGGGAGG + Intronic
1152142136 17:78542859-78542881 GGATTTCCCATCCATGAGTGTGG - Intronic
1161728679 19:5945778-5945800 GCATGTCCAGGTCAAGAGTGTGG + Intronic
1161989182 19:7674465-7674487 ACATTTCCCGGGCTTGGGTGGGG - Intergenic
1164513341 19:28914674-28914696 GCATATACCAGCCATGAGAGAGG + Intergenic
1165938555 19:39403648-39403670 GCATTTCCCATCCCTGAGTCAGG - Intergenic
1166093698 19:40526531-40526553 GCACTTCCTGGCCATGACTCTGG - Intronic
1166747784 19:45149933-45149955 GCCTTTCCCAGCAATGAGTCAGG - Exonic
925123495 2:1437701-1437723 GCATAACCTGGCCATGTGTGAGG + Intronic
926321971 2:11754765-11754787 GCATTTACCAGCTATGTGTGTGG - Intronic
930263868 2:49177254-49177276 GCATGTCCAGGCCAAGGGTGTGG + Intergenic
935308303 2:101759362-101759384 GAATTTCCCAGCCATGAGGAAGG + Intronic
935349704 2:102142744-102142766 GCAGTTCCCGGCCGCGAGGGCGG + Intronic
944116352 2:196191299-196191321 GAATTTCCAGGCCATGAGGCTGG + Intergenic
944462004 2:199959030-199959052 TCATTTCCCGGTCCTGAGAGTGG + Intronic
948359770 2:237412041-237412063 GCTTCTCTCGACCATGAGTGAGG + Intronic
1173941574 20:46915355-46915377 GCGTATCCAGGCCATGAGAGGGG - Intronic
1176614351 21:9016008-9016030 GCATTTGCTGGACATGAGGGGGG - Intergenic
1181755194 22:25019110-25019132 GCACTTCCCACCCATGAGAGTGG - Intronic
1182036858 22:27205690-27205712 GCGTTTCCTGGCCCAGAGTGAGG + Intergenic
1183819232 22:40331571-40331593 ACATTTCAAGGCCATGAGAGAGG - Exonic
951102212 3:18702585-18702607 GCATTGCTCGGCCCTGGGTGTGG + Intergenic
954423785 3:50432671-50432693 GGATCTCCTGGACATGAGTGTGG - Intronic
958586118 3:96090554-96090576 GCATTTCCTGGTAAGGAGTGAGG + Intergenic
958965952 3:100558421-100558443 GCATTTCCCGGCCATGAGTGTGG - Exonic
964518679 3:157540972-157540994 ACATTTCCCGGCAAAGATTGGGG - Intergenic
966879684 3:184343019-184343041 TCATTTCCCACCCATGAGTGTGG - Intronic
973596772 4:52499607-52499629 TCAATTCCCACCCATGAGTGAGG + Intergenic
981524678 4:145698058-145698080 GCATTTCCCTGAAATTAGTGAGG + Intronic
983580554 4:169305832-169305854 GCTGTTCCCTGCCATGAGAGGGG + Intergenic
990311322 5:54541578-54541600 GCATTTCTCTGCCATGGGTTAGG + Intronic
996079751 5:119244358-119244380 GCATTTACCTGCCATGACAGTGG + Exonic
1000849114 5:166318081-166318103 GGCTTTCCCGGCCCTGAGTAGGG - Intergenic
1001541179 5:172540820-172540842 GAAGTTCCTGGCCATGAGTGGGG + Intergenic
1002690903 5:181049923-181049945 TCATTTCCCGTCCATGGGCGGGG + Intronic
1018614842 6:165676943-165676965 TCATTTCTCGGGAATGAGTGAGG - Intronic
1019010973 6:168843126-168843148 GCATGTCCCAGCCATGTGTCAGG + Intergenic
1019968549 7:4521616-4521638 ATATTTGCCGGCCATGAATGAGG - Intergenic
1020180497 7:5918857-5918879 GTCTTCCCAGGCCATGAGTGCGG + Exonic
1020302434 7:6806025-6806047 GTCTTCCCAGGCCATGAGTGCGG - Exonic
1034259230 7:149744399-149744421 TCATCTCCCTGGCATGAGTGAGG + Intergenic
1038179440 8:25212822-25212844 GCATTTCCCTGCCATGGCTGGGG - Intronic
1047419309 8:124693231-124693253 GCAGTTGCCGGCCATGGGTGGGG + Intronic
1048459818 8:134612197-134612219 GCCTTTCTCAGCCATGAGTGTGG + Intronic
1049436051 8:142586771-142586793 GCATGTCCTGGCCAAGGGTGAGG + Intergenic
1052924184 9:34000782-34000804 GCCTTTCCAGGCCATGTGGGTGG + Intronic
1055725936 9:79228866-79228888 GCAGTTCCTGGCCATTTGTGAGG + Intergenic
1189324179 X:40103071-40103093 GCAGCCCCCGGCCCTGAGTGCGG + Intronic
1199677206 X:150198750-150198772 GGATATCATGGCCATGAGTGTGG - Intergenic
1199836384 X:151595907-151595929 GCACTTCCAGACCATGATTGAGG - Intronic
1200790700 Y:7296688-7296710 GCATCTCCAAGCCATGAGAGAGG + Intergenic
1200954111 Y:8927971-8927993 GCATGTCCAGCCCATGAGAGAGG - Intergenic
1201758878 Y:17517301-17517323 GCATTACCAGGCCCTGACTGTGG - Intergenic
1201842677 Y:18388689-18388711 GCATTACCAGGCCCTGACTGTGG + Intergenic