ID: 958968655

View in Genome Browser
Species Human (GRCh38)
Location 3:100586934-100586956
Sequence TTTCCTTCTCCCAGTTGGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958968655_958968664 30 Left 958968655 3:100586934-100586956 CCAAACCAACTGGGAGAAGGAAA No data
Right 958968664 3:100586987-100587009 AATCCAGACACCCTGTAATGGGG No data
958968655_958968659 -2 Left 958968655 3:100586934-100586956 CCAAACCAACTGGGAGAAGGAAA No data
Right 958968659 3:100586955-100586977 AAGAGGTGTTGGCAGCACCTAGG No data
958968655_958968663 29 Left 958968655 3:100586934-100586956 CCAAACCAACTGGGAGAAGGAAA No data
Right 958968663 3:100586986-100587008 CAATCCAGACACCCTGTAATGGG No data
958968655_958968662 28 Left 958968655 3:100586934-100586956 CCAAACCAACTGGGAGAAGGAAA No data
Right 958968662 3:100586985-100587007 CCAATCCAGACACCCTGTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958968655 Original CRISPR TTTCCTTCTCCCAGTTGGTT TGG (reversed) Intergenic
No off target data available for this crispr