ID: 958970890

View in Genome Browser
Species Human (GRCh38)
Location 3:100609214-100609236
Sequence GTGAGTGTGCATACTGGCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958970890_958970893 1 Left 958970890 3:100609214-100609236 CCTGTGCCAGTATGCACACTCAC No data
Right 958970893 3:100609238-100609260 AACTGCATCTGTCAAAATGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958970890 Original CRISPR GTGAGTGTGCATACTGGCAC AGG (reversed) Intergenic