ID: 958970890 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 3:100609214-100609236 |
| Sequence | GTGAGTGTGCATACTGGCAC AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 958970890_958970893 | 1 | Left | 958970890 | 3:100609214-100609236 | CCTGTGCCAGTATGCACACTCAC | No data | ||
| Right | 958970893 | 3:100609238-100609260 | AACTGCATCTGTCAAAATGTAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 958970890 | Original CRISPR | GTGAGTGTGCATACTGGCAC AGG (reversed) | Intergenic | ||