ID: 958972657

View in Genome Browser
Species Human (GRCh38)
Location 3:100629635-100629657
Sequence CTGCAGGAATGGTGGAACCT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 285
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 266}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958972651_958972657 -10 Left 958972651 3:100629622-100629644 CCCCTACAGAGTTCTGCAGGAAT 0: 1
1: 0
2: 1
3: 9
4: 149
Right 958972657 3:100629635-100629657 CTGCAGGAATGGTGGAACCTGGG 0: 1
1: 0
2: 2
3: 16
4: 266
958972649_958972657 2 Left 958972649 3:100629610-100629632 CCTCATCAAGCACCCCTACAGAG 0: 1
1: 0
2: 2
3: 13
4: 115
Right 958972657 3:100629635-100629657 CTGCAGGAATGGTGGAACCTGGG 0: 1
1: 0
2: 2
3: 16
4: 266

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958972657 Original CRISPR CTGCAGGAATGGTGGAACCT GGG Exonic
900215015 1:1476897-1476919 CTGGAGAATTGCTGGAACCTGGG - Intronic
901136014 1:6996072-6996094 CTGCAGGAATTGTCTAACCCTGG + Intronic
901352060 1:8606041-8606063 CTGGAGGATTGCTTGAACCTAGG - Intronic
903238927 1:21969554-21969576 CTGCAGAATTGCTTGAACCTTGG - Intergenic
903266258 1:22159880-22159902 TTTCAGGCATGGTGGCACCTGGG + Intergenic
903308954 1:22437511-22437533 CTGGAGAATTGCTGGAACCTGGG - Intergenic
905819306 1:40977672-40977694 CTGGAGGAATGCTTGAACCCAGG - Intergenic
907698044 1:56753813-56753835 CTGCAGGAACCGTAGAACATAGG + Intronic
908107146 1:60856633-60856655 CTACAGGAAATGTGGAAACTGGG - Intergenic
908693514 1:66810110-66810132 CTGCAGGAGGAGTGGAGCCTTGG + Intergenic
910123932 1:83819731-83819753 ATGCAAGAATGGTGGCAGCTTGG + Intergenic
911933245 1:103932107-103932129 CAACAGGAATAGTGGTACCTTGG - Intergenic
915379870 1:155430848-155430870 CTGGAGGATTGGTTGAACCCAGG - Intronic
916248390 1:162710860-162710882 CTGCAGGAAAGGTAGGACCCTGG - Intronic
918859262 1:189801071-189801093 CTGTAGGAATGGTGAAACTCTGG + Intergenic
920323650 1:205144125-205144147 CAGGAGAAATGGTGGAGCCTGGG - Exonic
920619721 1:207532800-207532822 AGACAGGAAAGGTGGAACCTGGG + Intronic
920621503 1:207551355-207551377 AGACAGGAAAGGTGGAACCTGGG + Intronic
920623129 1:207568450-207568472 AGACAGGAAAGGTGGAACCTGGG + Intronic
922219045 1:223543916-223543938 CTTCTGGAATGCTGGCACCTTGG - Intronic
923091470 1:230744422-230744444 CTGCAGGAAAGATGGACCCAGGG + Intergenic
924813868 1:247426054-247426076 TTTAAGGAATGGTGGGACCTGGG + Intronic
1063187571 10:3665003-3665025 CTCCAGCAGTGGTGGCACCTTGG - Intergenic
1063606614 10:7528145-7528167 CTGCGGGAATGTGGAAACCTGGG + Intergenic
1064020775 10:11806791-11806813 CAGCAGGATTGAAGGAACCTGGG + Intergenic
1064810297 10:19189636-19189658 ATGCAGGAATGGTTCAACCTAGG + Intronic
1066031862 10:31435746-31435768 TTGCAGGAATGATGGAACAATGG + Intronic
1066048959 10:31618179-31618201 CTGCAGGAAGGGTGGGAGGTGGG - Intergenic
1067345987 10:45439590-45439612 CTGCTGGCATGGAGGGACCTGGG + Intronic
1067445673 10:46342241-46342263 CTGAAGAATTGGTTGAACCTGGG + Intergenic
1067591703 10:47518502-47518524 CTGAAGAATTGGTTGAACCTGGG - Intronic
1067638818 10:48026576-48026598 CTGAAGAATTGGTTGAACCTGGG - Intergenic
1067874663 10:49993725-49993747 CTGAAGAATTGGTTGAACCTGGG + Intronic
1068263707 10:54619673-54619695 TAGCAGTAATGGTGGAAGCTAGG - Intronic
1068288223 10:54967022-54967044 CTGCAGGACTGGTGTTACTTTGG + Intronic
1071148491 10:82603523-82603545 CTGCAGGAAATGTGGACACTGGG - Intronic
1071171992 10:82877470-82877492 CTGCAGAATTGCTTGAACCTGGG - Intronic
1076585524 10:131544947-131544969 CGGGAGAAATGCTGGAACCTGGG - Intergenic
1079132457 11:17755408-17755430 CACCAGGAATGTTGGAACCTGGG + Intronic
1079345541 11:19648594-19648616 CAGCAGCAACGGTGGAACCAAGG - Intronic
1081393153 11:42553669-42553691 CTGAAGGAATGCTTGAGCCTAGG - Intergenic
1081659664 11:44880247-44880269 CGGCAGGAATGCTGGAGACTGGG + Intronic
1082092341 11:48100210-48100232 CTGCATGAAAGGAGGAACTTGGG - Intronic
1082784960 11:57311640-57311662 CTGCAGGAAAGGAGGAGCCAGGG - Intronic
1082983991 11:59151241-59151263 CTGGAGAAATGCTTGAACCTGGG - Intronic
1083042703 11:59702917-59702939 CAGCAGGATTGCTTGAACCTGGG + Intergenic
1083332903 11:61907259-61907281 CAGCAGGAATGGGTGAACCTAGG - Intronic
1083576102 11:63792910-63792932 CTGGAGGACTGCTTGAACCTGGG - Intergenic
1085253530 11:75159379-75159401 CTGCGGGAATGAAGGGACCTGGG - Intronic
1085383217 11:76139380-76139402 CTGCAGGACTGGTAGCTCCTTGG + Intronic
1086013445 11:82134279-82134301 CTTCAGAAATAATGGAACCTTGG + Intergenic
1086785318 11:90962002-90962024 CTGCACGAATGGTTCAACATAGG + Intergenic
1087076671 11:94132292-94132314 ATGCAGGATTCATGGAACCTGGG + Intronic
1088259562 11:107931067-107931089 CTGCAGAATTGCTGGAACCTGGG - Intronic
1088965467 11:114716522-114716544 CTTCTGGCATGGTGGGACCTGGG + Intergenic
1089210238 11:116795463-116795485 CTGGAGGAGTGCTTGAACCTGGG + Intergenic
1089334717 11:117715285-117715307 CTGAAGGAGAGGTGAAACCTGGG - Intronic
1089735157 11:120545930-120545952 GAGCAGGAAGGGTGGAGCCTGGG - Intronic
1090825358 11:130381351-130381373 CTGCAGGAAGAGTGAAGCCTGGG - Intergenic
1091021229 11:132101971-132101993 CTGTAGGAATGGTGGGAAATGGG - Intronic
1092098421 12:5862881-5862903 CTGGAGGATTGCTTGAACCTGGG - Intronic
1094640125 12:32266195-32266217 CTGCAGCAATGGTGGAAGGAGGG + Intronic
1094674158 12:32602020-32602042 CTGGAGGATTGATTGAACCTGGG + Intronic
1095084828 12:38049969-38049991 CAGTAGGAATGCTTGAACCTAGG - Intergenic
1095222069 12:39627556-39627578 CTGCAGGAAACATGTAACCTAGG + Intronic
1096299666 12:50415779-50415801 CAGGAGGAATGCTTGAACCTGGG - Intronic
1096756683 12:53805287-53805309 CTGTAGGAATTGTGAAACATTGG - Intergenic
1099208267 12:79753818-79753840 CTGGAGGAATGCTTGAGCCTGGG - Intergenic
1100184543 12:92125186-92125208 CTGGAGGAATGCTTGAGCCTGGG + Intronic
1100702893 12:97166839-97166861 CTGGAGAAACGCTGGAACCTGGG - Intergenic
1102582321 12:113897725-113897747 CTGCAGGAGTGGTGGCCTCTAGG - Intronic
1103787748 12:123446079-123446101 CTGCAGGAAGGGTGGTGCCCCGG + Intergenic
1103948036 12:124537932-124537954 CTGCAGGAAGGCTGGAAACAGGG + Intronic
1104380079 12:128299768-128299790 CTGGAGGAAAGGAAGAACCTGGG - Intronic
1104528287 12:129545282-129545304 CTTCAGGAATGGTTGAATCCAGG - Intronic
1105066799 12:133208117-133208139 CTGGAGGATTGCTGGAACCCAGG + Intergenic
1105545001 13:21344770-21344792 CTGCAGGAAAGATGCAACCTGGG - Intergenic
1105911227 13:24869858-24869880 CAGGAGGAATGGTTGAGCCTGGG - Intronic
1107002206 13:35560864-35560886 CTGCTGGTATGGTGGATGCTGGG - Intronic
1107579800 13:41771213-41771235 CAGGAGGAATGTTTGAACCTGGG - Intronic
1107844054 13:44492681-44492703 CTGGAGGAATGGTGGAGGATGGG + Intronic
1110398756 13:75065066-75065088 CTGGGGGAATGGTGTATCCTTGG + Intergenic
1110857078 13:80308834-80308856 TGGCAGGATTGTTGGAACCTGGG - Intergenic
1111328698 13:86733414-86733436 CTGGAGAATTGCTGGAACCTGGG + Intergenic
1111813853 13:93125719-93125741 CAGGAGGATTGCTGGAACCTGGG - Intergenic
1113432910 13:110265913-110265935 CAGCAGGCATGGTGGAGTCTGGG - Intronic
1116960556 14:50963943-50963965 CTGCTTGAATGCTTGAACCTGGG + Intergenic
1120267232 14:82266325-82266347 GTGCAGGATTGGAGCAACCTAGG + Intergenic
1121231532 14:92362291-92362313 ATGCCTGAATGGAGGAACCTTGG + Intronic
1121993963 14:98587216-98587238 GGGCAGGAATGGAGGAATCTTGG + Intergenic
1124591854 15:31060919-31060941 CTCCAGGAAGGCTGGAACCCTGG + Intronic
1127473794 15:59313639-59313661 TGGCAGGAATGGTGGAAGTTGGG - Intronic
1128806239 15:70533126-70533148 CTTCAGGAAGGGTGGGACCTGGG - Intergenic
1129350399 15:74952633-74952655 CTGGAGGATTGCTTGAACCTGGG + Intergenic
1129842707 15:78753547-78753569 CTGCCTGATTGGTGGATCCTCGG + Intergenic
1130111116 15:80966573-80966595 CAGCAGGAGGGGTGGAAGCTTGG - Intronic
1130355028 15:83121161-83121183 CAGGAGAAATGGTTGAACCTGGG - Intronic
1132936095 16:2482085-2482107 CTGCAGGAAAGGTCACACCTAGG + Intronic
1133809675 16:9151689-9151711 CTGCAGGATTGCTGGAACCCAGG - Intergenic
1134171262 16:11971585-11971607 CTGGAGGATTGCTTGAACCTGGG - Intronic
1134221838 16:12361036-12361058 CTGCAGGGATGCTGGAACCTTGG - Intronic
1134390235 16:13813169-13813191 CTCCAGGAATGCAGGAACTTGGG + Intergenic
1135129285 16:19838924-19838946 CTGCAGAATTGCTCGAACCTAGG + Intronic
1135420072 16:22299803-22299825 CAGCAGGATTGGTTGAACCCAGG - Intronic
1135705415 16:24670812-24670834 CTGAAGGGAGGGTGGACCCTTGG + Intergenic
1136575896 16:31124976-31124998 CTGGAGCAATGGTGCAATCTTGG - Intronic
1136597866 16:31264352-31264374 CAGGAGGAATGCTTGAACCTGGG + Intronic
1137285976 16:47016324-47016346 CTGCAGAACTGCTGGAACCCAGG - Intergenic
1139561119 16:67743068-67743090 TTGCAGGAATGCTGGCTCCTAGG + Intronic
1139791144 16:69436419-69436441 TGCCAGGAATGGTGTAACCTTGG - Intronic
1141096600 16:81167554-81167576 CTGCAGAATTGCTTGAACCTGGG - Intergenic
1141466393 16:84208536-84208558 CTGCAGGGAGGCTGGAACCGTGG + Intergenic
1143095234 17:4475338-4475360 CTGGAGGGATGGTGGGGCCTGGG + Intronic
1144025210 17:11271221-11271243 GTGCAGGAAGGGAGGGACCTGGG + Intronic
1144623840 17:16834454-16834476 CTGCAGGCATGGTGGGAGCCTGG - Intergenic
1144882591 17:18438262-18438284 CTGCAGGCATGGTGGGAGCCTGG + Intergenic
1145149643 17:20506124-20506146 CTGCAGGCATGGTGGGAGCCTGG - Intergenic
1146035703 17:29404695-29404717 CAGGAGGATTGCTGGAACCTAGG + Intronic
1146554556 17:33812582-33812604 ATGTAGGAATGATGGATCCTGGG + Intronic
1147578130 17:41614158-41614180 CTGCAGGCATGGTGGGAGCCTGG - Intronic
1148616272 17:49002766-49002788 TTGGAGGAAAGGTGGAAACTGGG + Intronic
1148711286 17:49683165-49683187 CAGGAGAAATGCTGGAACCTGGG - Intergenic
1150468096 17:65412354-65412376 CAGAAGGAAAGTTGGAACCTAGG - Intergenic
1150569399 17:66372964-66372986 CAGCAGAATTGCTGGAACCTGGG + Intronic
1150724924 17:67643857-67643879 TTGCAGGAATGGTGGCTCCGTGG + Intronic
1152621749 17:81368384-81368406 GTGCAGGAAGGGTGGGCCCTGGG + Intergenic
1152929622 17:83103211-83103233 CAGCAGGACAGGTGGATCCTGGG - Intergenic
1153187582 18:2502069-2502091 CAGGAGGAATGCTTGAACCTGGG - Intergenic
1153527152 18:6008265-6008287 CTGCAGGAAGGCTGTGACCTCGG + Intronic
1156219455 18:35037056-35037078 CTACAGCAATGGTGCAACATAGG - Intronic
1156459540 18:37313984-37314006 CTGCAGGAACGCTGGACACTTGG + Intronic
1156839131 18:41590625-41590647 CTGGAGGAGGGGAGGAACCTTGG - Intergenic
1157142191 18:45120833-45120855 CTGGAGGATTGCTTGAACCTGGG - Intergenic
1160334748 18:78028998-78029020 CTCCAGGAATTTGGGAACCTGGG - Intergenic
1160568975 18:79803778-79803800 CTGCTGGCATCCTGGAACCTTGG - Intergenic
1160785886 19:900147-900169 CTGCAGGAGTGGGGGAACAAGGG + Intronic
1161983881 19:7643791-7643813 CTGGATGAGGGGTGGAACCTTGG + Intronic
1162069323 19:8144302-8144324 CGGGAGGATTGGTTGAACCTGGG + Intronic
1162553456 19:11371671-11371693 CTGCAGGTAGGGTTGGACCTGGG - Intergenic
1162781152 19:13007584-13007606 AAGCAGGAATCTTGGAACCTTGG - Intronic
1162816061 19:13195419-13195441 CAGCAGGATTGCTTGAACCTGGG - Intergenic
1163696296 19:18765208-18765230 CTGCAGGACTGTGGGACCCTCGG + Intronic
1164956308 19:32389425-32389447 CTGGAGGATTGCTTGAACCTGGG + Intergenic
1166099971 19:40566015-40566037 CTGCAGGAATGGCAGAGGCTGGG - Intronic
1166476877 19:43134193-43134215 CTGGAGGAATGATGGAGACTGGG + Intronic
1166684921 19:44790661-44790683 CGGGAGGATTGCTGGAACCTAGG - Intronic
925066872 2:934728-934750 CAGGAGGATTGCTGGAACCTAGG - Intergenic
925387443 2:3472040-3472062 CTGCAGGAGTGGTGGGAAGTTGG + Intronic
930126725 2:47804201-47804223 CAGGAGGAAGGGTTGAACCTGGG - Intronic
932237801 2:70135080-70135102 CTGGAGGATTGGTTGAGCCTAGG - Intergenic
932237822 2:70135246-70135268 CTGGAGGATTGGTTGAGCCTAGG - Intergenic
933780723 2:85799134-85799156 CTGCTGGAATGGTAGCACTTGGG + Intergenic
933960227 2:87403556-87403578 CTGGAGGAATGCTTGAACCCGGG + Intergenic
937227102 2:120376231-120376253 CAGCACGAATGGTGGAAACTGGG + Intergenic
938779862 2:134575338-134575360 CAGCAGGAATGGTGGGCACTGGG - Intronic
938959511 2:136328667-136328689 CTGCAGCTATGGTGGAACCTTGG + Intergenic
939855016 2:147348030-147348052 ATGCAAGAATTGTGGACCCTTGG - Intergenic
940328182 2:152447191-152447213 CAGCAGGATTGCTAGAACCTGGG - Intronic
940391921 2:153142259-153142281 CTGCTGGAATTCTGGCACCTTGG + Intergenic
941944432 2:171079000-171079022 ATGCAGGAATGGTGAAAGGTAGG - Intronic
943448123 2:188015481-188015503 CAGGAGAAATGCTGGAACCTGGG - Intergenic
944067544 2:195634953-195634975 CAGAAGGATTGGTTGAACCTGGG + Intronic
946391926 2:219421317-219421339 CTGCAGGAGAGGGGGAACCCAGG - Intronic
946943624 2:224796619-224796641 CTGCAGGAATCTTGGAATCTTGG + Intronic
1169897970 20:10524244-10524266 CTCCAGGAAAGGAGGACCCTTGG + Intronic
1172152024 20:32797339-32797361 CTGCAGGAACGTAGGAGCCTTGG - Intronic
1172423732 20:34840067-34840089 CTGGAGGATTGCTGGAGCCTAGG - Intergenic
1172965052 20:38828604-38828626 CTGCAGGGATGGTGGCAACAAGG + Intronic
1173105414 20:40128868-40128890 CTGAGGCAATGGTTGAACCTGGG + Intergenic
1173974663 20:47178241-47178263 TTGCAGGATTGCTTGAACCTGGG + Intronic
1174819296 20:53713354-53713376 CTGCAGGAAGGAGGGGACCTGGG - Intergenic
1175813822 20:61873343-61873365 CTGCAGGAGTGGAAGCACCTTGG + Intronic
1176293498 21:5058704-5058726 GTGCAGGCAGGGTGGAGCCTGGG + Intergenic
1177798487 21:25804296-25804318 CTGCAGCTATGATTGAACCTGGG + Intergenic
1178116198 21:29419834-29419856 ATGGAGGAATGGTGAAACCGCGG - Intronic
1178600122 21:33987566-33987588 CTGCAGGACAGGTAGGACCTTGG + Intergenic
1179863762 21:44204944-44204966 GTGCAGGCAGGGTGGAGCCTGGG - Intergenic
1182116840 22:27761600-27761622 CGGCAGGGATGGGGGCACCTGGG + Intronic
1182541991 22:31048533-31048555 CTGGAGGATTGCTTGAACCTGGG + Intergenic
1182654637 22:31880266-31880288 CTGCAGGAATGGTGGAAAGGAGG - Intronic
1183043351 22:35200006-35200028 CTGGAGAATTGCTGGAACCTGGG + Intergenic
1184251392 22:43262424-43262446 CAGCAGGAATGGTGGGGCCGTGG - Intronic
950005885 3:9690658-9690680 CTGCAGGAATGGTGCCTCCTGGG + Intronic
952381133 3:32806369-32806391 CAGGAGGATTGGTGGAGCCTGGG - Intergenic
954182991 3:48896260-48896282 CTGGAGGATCGGTTGAACCTAGG - Intronic
955209358 3:56926349-56926371 CTGCAGGAAATGGGGAACCAGGG + Intronic
955818173 3:62869271-62869293 CTGCAGGAATGGCTGGATCTAGG - Intronic
956164040 3:66383096-66383118 CTGCAGGAAGGATGGGACCACGG - Exonic
957181819 3:76888273-76888295 CAGGAGGATTGCTGGAACCTGGG + Intronic
957839550 3:85650588-85650610 GTGCAGCATTGGTGTAACCTAGG + Intronic
958972657 3:100629635-100629657 CTGCAGGAATGGTGGAACCTGGG + Exonic
960545092 3:118905106-118905128 CTACATGAATGCTGGAAACTAGG + Intronic
965427444 3:168545162-168545184 CTGCAAAAATGGTGGTAACTAGG - Intergenic
965544284 3:169899522-169899544 ATGAAGGAAGGGTGGAACTTGGG + Intergenic
965755926 3:172027160-172027182 CAGGAGGATTGCTGGAACCTAGG - Intergenic
966496062 3:180582066-180582088 ATGGAGGGATGGTGGAACATAGG + Intergenic
966739742 3:183221566-183221588 CTGTGGGAAAGCTGGAACCTAGG + Intronic
968053035 3:195669104-195669126 CGGGAGGAATGCTTGAACCTGGG + Intergenic
968102779 3:195979259-195979281 CGGGAGGAATGCTTGAACCTGGG - Intergenic
968939462 4:3630519-3630541 CAGCAGGCACGGTGGGACCTCGG + Intergenic
969104824 4:4797742-4797764 CTACAGGAGAGGTCGAACCTAGG + Intergenic
969292784 4:6251534-6251556 CTGCAGGGATGTGGGAACCCAGG + Intergenic
969306061 4:6326951-6326973 CTGCAAGGATGTGGGAACCTGGG + Intronic
971304028 4:25464713-25464735 CAGGAGGACTGCTGGAACCTGGG + Intergenic
974774720 4:66464690-66464712 CTGGAGGATTGCTTGAACCTAGG - Intergenic
975564367 4:75738362-75738384 CAGGAGGATTGCTGGAACCTGGG + Intronic
976417163 4:84790255-84790277 CAGCAGAAATGCTTGAACCTGGG + Intronic
976628139 4:87208457-87208479 CTGTAGGATTGCTGGAGCCTGGG - Intronic
978286826 4:107088691-107088713 CTTATGGAATGGTGGAACTTAGG - Intronic
979172915 4:117624413-117624435 CTGAAGGGATGGAGGAATCTGGG + Intergenic
980663607 4:135899489-135899511 ATGCAAGAATGGTAGAAGCTTGG + Intergenic
982023048 4:151223523-151223545 CTGGAGGAATGGCGGATTCTGGG - Intronic
982123957 4:152168493-152168515 CAGGAGAAATGCTGGAACCTGGG + Intergenic
986215733 5:5717165-5717187 CTGCAGGAACACAGGAACCTGGG - Intergenic
986388336 5:7261311-7261333 CTGCAGGAGTGGGGGAACCGGGG + Intergenic
987261448 5:16207894-16207916 CTGAAGAAATGGTTAAACCTGGG - Intergenic
988581762 5:32474613-32474635 CAGCAGGGAGGGTGGAAACTTGG + Intergenic
988756873 5:34264614-34264636 CAGCAGGAAATTTGGAACCTAGG - Intergenic
989432365 5:41370836-41370858 CTGAATGAATTGTGAAACCTCGG + Intronic
990548442 5:56847501-56847523 CTGCAGAATTGCTTGAACCTGGG + Intronic
990630963 5:57668283-57668305 CTGCAGAAATGGAGAAAACTGGG + Intergenic
991439159 5:66628259-66628281 CGGGAGGAATGCTTGAACCTAGG - Intronic
991533223 5:67638009-67638031 CACCAGGTATGATGGAACCTGGG - Intergenic
993653570 5:90551666-90551688 CAGGAGGATTGCTGGAACCTTGG - Intronic
994448830 5:99913546-99913568 TTGCAGGAATGCTGAAACCTTGG - Intergenic
996138828 5:119878859-119878881 CTGCAGGATTGGTGGATCAGAGG + Intergenic
997175960 5:131778129-131778151 CTGCAGGACTGCTTGAGCCTGGG + Intronic
997413156 5:133705438-133705460 CTTCTGGAATGGTGGGACCCTGG + Intergenic
998512152 5:142722646-142722668 CTGGAGGATTGCTTGAACCTGGG - Intergenic
1000364833 5:160481126-160481148 CAGGAGGAATGCTTGAACCTGGG - Intergenic
1001989642 5:176105678-176105700 CAGCAGGACAGGTGGATCCTGGG + Intronic
1002227228 5:177732459-177732481 CAGCAGGACAGGTGGATCCTGGG - Intronic
1002327322 5:178418397-178418419 CTCCAGGAAAGCTGGAACGTAGG - Intronic
1003406618 6:5831734-5831756 CTGCAGGAAAGATGCAACCTGGG + Intergenic
1005487870 6:26318422-26318444 CTGGAGGATTGCTTGAACCTGGG + Intergenic
1006274309 6:32989634-32989656 CAGCAGGATTGGTTGAAGCTTGG - Intergenic
1007535207 6:42581104-42581126 CAGGAGGAAAGGTTGAACCTGGG - Intronic
1007838891 6:44699385-44699407 CTGCAGGAGATGTGGAACCCTGG + Intergenic
1012831655 6:104211031-104211053 CAGCAGGAATGCTAGAGCCTAGG + Intergenic
1014293089 6:119583731-119583753 CATCAAGAATGGTGGAAGCTTGG + Intergenic
1014350875 6:120343891-120343913 CTGCTGGAATGGTTGTTCCTGGG + Intergenic
1014406444 6:121057823-121057845 CTGCAGTAATGGTTGAGGCTGGG - Intergenic
1016515787 6:144891949-144891971 CTTCAGGAATGGCTGAATCTGGG - Intergenic
1016811766 6:148267781-148267803 CTGCAGGTATGGTGGGACTCTGG - Intergenic
1018959785 6:168440511-168440533 CTGCAGGGATGGGGGAATTTAGG - Intergenic
1019657785 7:2206037-2206059 CTGGAGGATTGCTTGAACCTGGG + Intronic
1019954169 7:4399809-4399831 TTGGAGGAATGGTGGAGCCGGGG + Intergenic
1022580497 7:31548603-31548625 CTCCAGGAAGGGTGGAAGATTGG + Intronic
1023220665 7:37917555-37917577 CTGCAGCATTAGTGGAACCCAGG + Intronic
1023274946 7:38508586-38508608 CTGCATGAAAGGTGGATCTTAGG + Intronic
1024531008 7:50392794-50392816 TTGGAGGAATGGGGGAATCTAGG + Intronic
1024602806 7:50999585-50999607 CTGGAGGACTGATTGAACCTGGG + Intergenic
1024624189 7:51190299-51190321 CTGGAGGATTGGTTGAACCCAGG - Intronic
1029518970 7:101048018-101048040 CTGCAAGAATGGAGGCACCTGGG + Exonic
1030102469 7:105958355-105958377 GTGCTTGAATGATGGAACCTGGG + Intronic
1032702409 7:134394053-134394075 CTCCAGGATTGGAAGAACCTCGG + Intergenic
1033558752 7:142511181-142511203 CTGGGGGAATGGAGGAAGCTGGG + Intergenic
1035528130 8:330315-330337 CTTCAGGAATGGTAGCTCCTAGG + Intergenic
1035532250 8:362084-362106 CTGCAGGATTCTTGGAAGCTGGG - Intergenic
1036474378 8:9079896-9079918 CTGGAGGACTGCTGGAGCCTAGG - Intronic
1036612998 8:10366053-10366075 CTGCAGGACTGGGGACACCTGGG + Intronic
1038330948 8:26608915-26608937 ATGCAAGAATTGTGCAACCTTGG + Intronic
1038563941 8:28603980-28604002 CTGCAGCAGTGGTGGAGCCTTGG + Intronic
1041992089 8:64005636-64005658 CTGAATTAATGTTGGAACCTTGG + Intergenic
1042958674 8:74279165-74279187 CTCAAGGAATGGTAGAGCCTTGG - Intronic
1044016313 8:87051900-87051922 CAGCAGGACTGATGGATCCTGGG - Intronic
1047926914 8:129691190-129691212 CTGCAGGAAGGCTGGAACAGTGG + Intergenic
1049050279 8:140189209-140189231 CTGAAAGAATGCTGGAACCAAGG + Intronic
1049685252 8:143936837-143936859 CCGTAGGTATGGTGGCACCTGGG - Intronic
1049996482 9:1039953-1039975 CTGCATGAATTGTGCAAACTAGG + Intergenic
1050039405 9:1473291-1473313 CTGCAGGAATGGTAGATTCAGGG + Intergenic
1051851785 9:21517804-21517826 GTGCAGAGATGGTGTAACCTTGG + Intergenic
1055625858 9:78176802-78176824 CTGCAGGAAGGGTGTACTCTTGG - Intergenic
1055646008 9:78362059-78362081 CTGGAGGAATGTAGGAACATGGG - Intergenic
1056796021 9:89659514-89659536 ATACAGGCATGATGGAACCTGGG - Intergenic
1060446542 9:123693918-123693940 CAGGAGGATTGCTGGAACCTGGG - Intronic
1060990835 9:127847893-127847915 CTGCAGGCATCGTAGAACCAGGG - Intronic
1186370688 X:8944074-8944096 CAGGAGGATTGGTTGAACCTGGG - Intergenic
1186756087 X:12672943-12672965 CCTCAGGAATGGTGGAAACCAGG + Intronic
1187080957 X:15987375-15987397 CTGCTTGCATGGTGTAACCTAGG + Intergenic
1187428064 X:19196629-19196651 CTGCAGTAGTGGTGGAAGTTGGG - Intergenic
1190102457 X:47532210-47532232 CTGGAGGATTGCTTGAACCTAGG - Intergenic
1192184036 X:68934492-68934514 CTTCAGGCATGGAGGATCCTTGG - Intergenic
1194832964 X:98648028-98648050 CTGCAGGATTCCTGGAATCTGGG - Intergenic
1194970104 X:100333418-100333440 TTGGAGGAATGGTGGAAGCCAGG - Intronic