ID: 958979837

View in Genome Browser
Species Human (GRCh38)
Location 3:100708578-100708600
Sequence GAAGATGCACAGATGGTCCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 271
Summary {0: 1, 1: 0, 2: 3, 3: 23, 4: 244}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958979837_958979839 14 Left 958979837 3:100708578-100708600 CCTAGGACCATCTGTGCATCTTC 0: 1
1: 0
2: 3
3: 23
4: 244
Right 958979839 3:100708615-100708637 TTCAGCAAAGAACCTTGTTAAGG 0: 1
1: 0
2: 0
3: 25
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958979837 Original CRISPR GAAGATGCACAGATGGTCCT AGG (reversed) Intergenic
900842944 1:5070461-5070483 GGAAGTGCACAGATGGGCCTAGG - Intergenic
900883859 1:5401814-5401836 GGAAGTGCACAGATGGGCCTAGG - Intergenic
901158104 1:7154225-7154247 GAAGATGAACAGATTGACCCTGG + Intronic
902516066 1:16990211-16990233 GACGATGATCAGATGCTCCTGGG + Exonic
903967310 1:27098965-27098987 GAGGATGGACAGATGGGCCGAGG + Exonic
904458093 1:30659138-30659160 GAAGAGGCACAGATGTCCCCAGG + Intergenic
906348414 1:45036185-45036207 GAAGTTGCACTGATGGGCCTGGG - Exonic
907128973 1:52077962-52077984 GAAGATGCCCAGAATCTCCTGGG - Intronic
909085691 1:71167702-71167724 GAAGCTGCACAGATCCTGCTTGG + Intergenic
909492410 1:76239843-76239865 TAAGATGCAAAGAAGGCCCTAGG + Intronic
909611026 1:77552001-77552023 GGAAGTGCACAGATGGGCCTAGG - Intronic
915102975 1:153513908-153513930 CAAGATGAACAGATGGTCCAAGG + Intergenic
915431154 1:155868166-155868188 GGAGAGACAAAGATGGTCCTGGG + Exonic
916721627 1:167488657-167488679 GAAAGTACACAGATGGGCCTAGG + Intronic
917313865 1:173704642-173704664 AAAGAAGCACAGACAGTCCTTGG - Intergenic
918287352 1:183070436-183070458 GTGGATGCCCAGATGTTCCTGGG + Intronic
920055883 1:203191363-203191385 GGAAGTGCACAGATGGGCCTAGG - Intergenic
922232572 1:223699670-223699692 GGAAGTGCACAGATGGGCCTAGG - Intergenic
922599536 1:226839041-226839063 GAAGGTGCACAGATGGGCCTAGG + Intergenic
922767553 1:228163743-228163765 GCAAGTGCACAGATGGGCCTAGG - Intergenic
922818214 1:228466306-228466328 GAAAGTGCACAGATGGACCCAGG - Intergenic
923462844 1:234222177-234222199 GAAGATGCACAGCTTCTCTTTGG - Intronic
923841652 1:237679078-237679100 GAAGATCCAAAGTTTGTCCTGGG + Intronic
924669129 1:246105229-246105251 TAAAATGCACAGATGGGCCCTGG + Intronic
924809892 1:247391736-247391758 GGAAATGCACAGATGGGTCTAGG - Intergenic
1064181350 10:13118733-13118755 GAACAAGCACAGCTGGTCCTGGG - Intronic
1069835454 10:71305118-71305140 GTATATGCACAGATCTTCCTAGG - Intergenic
1070058236 10:72955418-72955440 CAAGATCTACAGATGGTCCAAGG + Intergenic
1070320527 10:75351607-75351629 GAAGATCCTCAGAAGGTCTTTGG + Intergenic
1071000856 10:80828747-80828769 GAAGATGCAAGGAGGGTACTGGG - Intergenic
1071223111 10:83492987-83493009 GAAAGTGCACAGATGGGCCTAGG + Intergenic
1072506547 10:96073547-96073569 TAAGCTGCACAGTTGGTTCTGGG + Intergenic
1073230964 10:101969706-101969728 GAAGCTGAACAGATTGTTCTGGG + Intronic
1074058896 10:109946948-109946970 GAAGATGCACAGATGAATCGTGG - Intronic
1075121668 10:119669147-119669169 GGAAGTGCACAGATGGGCCTAGG + Intronic
1075127778 10:119714410-119714432 GAACAGGCACAGATCCTCCTGGG + Intergenic
1075933980 10:126324019-126324041 GCAGATGCCCACATGCTCCTTGG + Intronic
1076931251 10:133533370-133533392 GAAGATGCTCAGACAGTCCTGGG - Intronic
1077386557 11:2271982-2272004 GAAGGTGACCAGATGCTCCTGGG + Intergenic
1079093699 11:17497557-17497579 GAAGCTGACCAGATGGGCCTGGG - Intronic
1079899073 11:26158706-26158728 GGAGATGCAAATTTGGTCCTAGG + Intergenic
1082825012 11:57571262-57571284 GAAGATGCACTGAAGGTTCTTGG - Intergenic
1083131555 11:60629058-60629080 AAAGATGAACATATGGTCATTGG + Intergenic
1083949227 11:65944879-65944901 GAAGATGGCCAGGTGGGCCTGGG + Intergenic
1087357890 11:97117930-97117952 GGAAGTACACAGATGGTCCTAGG + Intergenic
1088418779 11:109619431-109619453 GAAGATGCACACATGGGTTTAGG + Intergenic
1088879005 11:113958939-113958961 GAAGATGCACACATTGCCTTGGG + Intergenic
1090070964 11:123544609-123544631 TGAGATGCACAGGAGGTCCTGGG + Intronic
1091333496 11:134749574-134749596 TAAAATGTACAAATGGTCCTGGG - Intergenic
1091634929 12:2189664-2189686 GAAGATGGCCAAATGTTCCTTGG - Intronic
1093170912 12:15859387-15859409 GAAGAAGCACGGAAAGTCCTCGG + Intronic
1094364490 12:29665690-29665712 GAAAGTACACAGATGGGCCTAGG - Intronic
1094502844 12:31036145-31036167 GAAGATGCACTGCTGCTGCTGGG - Intergenic
1096799147 12:54097909-54097931 GAAGATGGAGAGGTGGTCTTTGG + Intergenic
1097058683 12:56266756-56266778 GAAGCTGCAAAGATGGTTCGGGG - Intergenic
1097387089 12:58962937-58962959 GGAGGTGCACAGATGGGCCTAGG - Intergenic
1098516450 12:71382263-71382285 GAAGCTGGAAAAATGGTCCTTGG - Intronic
1098657846 12:73055926-73055948 TAAGATGAACAGATATTCCTCGG + Intergenic
1099926752 12:89027917-89027939 GGAAGTGCACAGATGGGCCTAGG - Intergenic
1100751366 12:97701934-97701956 GGAAATGCACAGATGGGCCTAGG - Intergenic
1101153840 12:101908779-101908801 GGAAGTGCACAGATGGACCTAGG + Intronic
1101880136 12:108620797-108620819 GGAAGTGCACAGATGGGCCTAGG - Intergenic
1102557137 12:113734462-113734484 GAGAATACACAGCTGGTCCTTGG + Intergenic
1103867164 12:124062447-124062469 GAAGATTCAAGGATGTTCCTAGG + Intronic
1104732542 12:131115938-131115960 GTAGATGCACAGCTGGTCCCGGG + Intronic
1107963355 13:45578044-45578066 GGAAGTGCACAGATGGACCTAGG - Intronic
1109542840 13:63802203-63802225 GAAGAAGCCTAGATGATCCTGGG - Intergenic
1110394506 13:75013871-75013893 GAAGATGCAAAGAGGGTACTGGG - Intergenic
1110829171 13:80010886-80010908 GAATATGCACAGATGAGCATAGG - Intergenic
1113236987 13:108288324-108288346 AAATATGCACAAATGCTCCTTGG + Intronic
1114538457 14:23437587-23437609 TAAGATGCACAAAGGGTGCTTGG + Intergenic
1118523236 14:66611019-66611041 GAAAGTGCACAGATGGGCCTAGG + Intronic
1120854590 14:89201668-89201690 AAAGATGCACTGGTGGTCCCTGG - Intronic
1121104079 14:91269560-91269582 GAGGCTGCAGAGATGGTCCTGGG + Intergenic
1121263303 14:92582100-92582122 TAGGAGGCACAGATGGGCCTAGG + Intronic
1122099381 14:99395004-99395026 GAAGCTGCCCTGCTGGTCCTGGG - Intergenic
1122717185 14:103702769-103702791 GGACGTGCACAGATGGGCCTAGG - Intronic
1125026360 15:35033822-35033844 GAAGATGGACACATTTTCCTGGG + Intergenic
1126901727 15:53321477-53321499 GGAAATGCACAGATGGGCCCAGG - Intergenic
1127222083 15:56890458-56890480 GAAGAAGCACAGATGTGCCCTGG + Intronic
1127971873 15:63968254-63968276 GAAGTTGCCCAGGTGGGCCTAGG + Intronic
1128514149 15:68331779-68331801 GATGAGGCACAGAAGCTCCTGGG + Intronic
1128820703 15:70650187-70650209 GGAAGTGCACAGATGGGCCTAGG + Intergenic
1128991170 15:72261616-72261638 GAAGAGGCACAGTTGGTTCAAGG - Exonic
1129514102 15:76146291-76146313 GAGGGTGCAAAGATGGTCATGGG + Intronic
1129945605 15:79536955-79536977 CAGGCTGCTCAGATGGTCCTGGG + Intergenic
1130868378 15:87951279-87951301 AAATAAGCAGAGATGGTCCTAGG - Intronic
1132268384 15:100500313-100500335 GAAGAAGCAACAATGGTCCTAGG + Intronic
1134147105 16:11774291-11774313 GATGATGGAGATATGGTCCTTGG - Exonic
1136484957 16:30565731-30565753 GAAGATTAACAGATGGGCTTAGG - Intergenic
1138104889 16:54282626-54282648 CAAGACGCACAGATGCTCCCAGG + Intergenic
1138761597 16:59550425-59550447 GGAAATGCACAGATGAGCCTAGG + Intergenic
1139380036 16:66524777-66524799 CAAGATGCACAGGTGGTTGTGGG + Intronic
1139612583 16:68069661-68069683 CAAGTTGCACAGCTGATCCTAGG - Intronic
1139898086 16:70304336-70304358 AAAGATGAACAGATGAACCTCGG - Intronic
1142414144 16:89932289-89932311 GCAGCTGCACAGCTGGGCCTGGG + Intronic
1143068412 17:4267989-4268011 GGAGCTGCACAGAAAGTCCTAGG - Intergenic
1143407310 17:6686025-6686047 CCAGATGCAGAGATGGTCATGGG - Exonic
1143847046 17:9780168-9780190 GAAGAAGCAGAGATGATTCTGGG + Intronic
1144459529 17:15447012-15447034 GAAAATCCACAGTGGGTCCTGGG - Intronic
1144588201 17:16501747-16501769 GGAAGTGCACAGATGGGCCTAGG - Intergenic
1144620789 17:16817264-16817286 CAAGTTGCCCAGATGGTCCATGG - Intergenic
1144783952 17:17821684-17821706 CAGGCTGCACAGTTGGTCCTTGG - Intronic
1147572178 17:41578167-41578189 CAAGTTGCCCAGATGGTCCATGG - Intergenic
1149530554 17:57391593-57391615 GAAGATGCACAGATGACTCACGG - Intronic
1152658003 17:81528872-81528894 GAAGCAGGACAGCTGGTCCTCGG - Exonic
1156474553 18:37397449-37397471 GGAGCTACCCAGATGGTCCTGGG - Intronic
1158350597 18:56561674-56561696 GAAGATGCTCAAATGCTCCAAGG + Intergenic
1158419618 18:57281284-57281306 GAACATGCAGATATGTTCCTGGG + Intergenic
1158884874 18:61817544-61817566 GAATATGAAAAGATGGCCCTCGG - Intronic
1159507452 18:69355785-69355807 GGAAATGCACAGATGGGCCTAGG - Intergenic
1165232202 19:34394184-34394206 CAAGGAGCACAGATGGACCTTGG - Intronic
1165722152 19:38087097-38087119 GGAGGTGCACAGATGGGCCTAGG + Intronic
1165907256 19:39201700-39201722 GGAGATACACAAAGGGTCCTCGG - Exonic
1166035542 19:40165571-40165593 GAAGAAGCACAGAGAGTCCGAGG - Intergenic
1166105801 19:40597486-40597508 GGAGATGCAAAGAGGGCCCTTGG + Intronic
1166197241 19:41215263-41215285 AAAGATGGACAGGTGGTGCTGGG - Intergenic
925479398 2:4253220-4253242 GGCGATGCAGAGATGGGCCTTGG - Intergenic
926441689 2:12895605-12895627 GGAGATGCAGAGATGGTTCTGGG + Intergenic
927832189 2:26361280-26361302 GAACATCCACAGAGAGTCCTGGG + Intronic
928065809 2:28163470-28163492 GAAAATGTACACATGGTGCTGGG + Intronic
929247444 2:39718410-39718432 GAATATCCACAGCTGGGCCTAGG + Intergenic
931150556 2:59568146-59568168 GGAGAAGCACAGATGGGCATGGG + Intergenic
931373850 2:61689474-61689496 GAAGATGCATCGCTGTTCCTTGG + Intergenic
932704508 2:74012648-74012670 CAACATGCAAAGACGGTCCTAGG - Intronic
938097641 2:128474047-128474069 CAAGATGCCCACATGGTCCCTGG + Intergenic
938977608 2:136494740-136494762 GAAGGTGCACCGAGGGGCCTGGG + Intergenic
939254301 2:139722560-139722582 GTAAATGCACAGATGGGCTTAGG - Intergenic
939597564 2:144145722-144145744 GAACTTGCAAAGAGGGTCCTAGG + Exonic
940311428 2:152282982-152283004 TAAGATTCTCAGAAGGTCCTGGG - Intergenic
942164881 2:173232141-173232163 GAAGATTCACACATGGTCAGTGG - Intronic
942906414 2:181186050-181186072 ACAGATGCACATATGGGCCTCGG + Intergenic
945067828 2:205961957-205961979 GAAAGTGCACAGACGGGCCTAGG - Intergenic
945539755 2:211070177-211070199 AAATATACACAGATAGTCCTTGG - Intergenic
947167877 2:227280938-227280960 GAAGGTGCATAGAGGGTCCCAGG + Exonic
947528948 2:230896475-230896497 GAAGCTGCACAAATGTTTCTCGG - Intergenic
949042291 2:241854931-241854953 AACAATGCACAGATGGTCCCAGG - Intronic
1171850973 20:30307722-30307744 GAAGATGGAGAGGTGGTCTTTGG + Intergenic
1172055640 20:32152521-32152543 GAAGATGCAGAGATGGGGGTGGG - Intronic
1172227779 20:33316757-33316779 AAAGCTGGAGAGATGGTCCTAGG + Intergenic
1172508060 20:35478948-35478970 GAAGATGCACACATAATACTGGG - Intronic
1174289759 20:49499662-49499684 GAAGCTCCACGGAAGGTCCTGGG + Intergenic
1174449132 20:50609097-50609119 GAAAATGGACAGAGGGTGCTGGG + Intronic
1175545421 20:59775026-59775048 GCAGATGCTCACAGGGTCCTTGG + Intronic
1175739107 20:61408197-61408219 CGAGATGCAGAGATGATCCTGGG - Intronic
1177760226 21:25394924-25394946 GAAAGTGCACAGATAGGCCTCGG - Intergenic
1178330209 21:31683732-31683754 AAAGATGCAAAGATGTTCCCTGG + Intronic
1178497684 21:33101295-33101317 GAATATGCACAGCTCCTCCTTGG + Intergenic
1178599107 21:33980673-33980695 CAAGATGCACAGCTGGCCCCAGG - Intergenic
1179100831 21:38354510-38354532 GCAGATCTACAGATGGCCCTTGG - Intergenic
1180709534 22:17830563-17830585 GAGCATGCACAGCTGGTCCAGGG - Intronic
1180865448 22:19116257-19116279 GAGGATGCCCAGAAGGTCCAGGG + Intronic
1183865279 22:40699445-40699467 GAAGGTGCACATATTGTCTTGGG + Intergenic
1184428903 22:44429497-44429519 CCAGATGCTCAGATGGGCCTGGG - Intergenic
1184746026 22:46456828-46456850 GAACCTACACAGATTGTCCTTGG + Intronic
952749833 3:36816204-36816226 GGAGAGGCCCAGCTGGTCCTTGG + Intergenic
955185965 3:56715401-56715423 GAAGATGGACAGTTGGGGCTGGG - Intergenic
955853574 3:63248062-63248084 GGTGATGCACAGAGGGGCCTTGG + Intronic
957802127 3:85098711-85098733 GAAGTCTCACAGTTGGTCCTGGG + Intronic
958626536 3:96632134-96632156 GAAGATACACATATATTCCTGGG - Intergenic
958979837 3:100708578-100708600 GAAGATGCACAGATGGTCCTAGG - Intergenic
959980902 3:112516552-112516574 GGAGGTGCACAGATGGGCCTAGG - Intergenic
960460579 3:117929891-117929913 GAAGCTGCAAAGACAGTCCTGGG + Intergenic
960686803 3:120302992-120303014 GAAGATCCACATATGGTCAAAGG - Intergenic
962312586 3:134337009-134337031 GAAGATGCTGAGCTGGGCCTTGG + Intergenic
962391772 3:134978274-134978296 GAAGATGCACTGAGGGGCCAGGG - Intronic
963774410 3:149423403-149423425 GGAAATACACAGATGGGCCTAGG + Intergenic
964071036 3:152633762-152633784 GATGATGCAGAGATGGTCAATGG - Intergenic
964684008 3:159375256-159375278 GAAGATGCTCAGATGAGCCCAGG + Intronic
965463115 3:168993450-168993472 GGAAGTGCACAGATGGGCCTAGG - Intergenic
965738489 3:171847908-171847930 GAAAGTACACAGATGGGCCTAGG + Intronic
966225620 3:177594341-177594363 GGAAATGCACAGATAGGCCTAGG + Intergenic
968911821 4:3480235-3480257 AAAGAGGCAGATATGGTCCTTGG - Intronic
970471258 4:16381471-16381493 GGAGGTACACAGATGGGCCTAGG + Intergenic
972463164 4:39325676-39325698 GAAGATTCACAGATGAGGCTGGG - Intronic
973321418 4:48814164-48814186 AAAGAGGGACAGATGGTTCTCGG + Intronic
974250235 4:59375895-59375917 GAACATGCAGAAATGGGCCTTGG - Intergenic
975914980 4:79313819-79313841 CAAGATGCCCAGATGGTGATGGG + Intronic
976332979 4:83852960-83852982 GAAAGTGCACAGATGGGCCTAGG - Intergenic
979689200 4:123542829-123542851 GGAAGTGCACAGATGGGCCTAGG - Intergenic
980159140 4:129138521-129138543 GAAGTTGCATTGATGGACCTGGG - Intergenic
980197090 4:129603309-129603331 GCAAGTTCACAGATGGTCCTAGG - Intergenic
986431736 5:7688024-7688046 GTAGATGAACAGATGCTACTGGG + Intronic
986865629 5:11983106-11983128 GAAGAGACAAAGATGGCCCTAGG - Intergenic
987111624 5:14693083-14693105 GAAGATGCACAGGTGGCTCCTGG + Exonic
991657608 5:68919784-68919806 GAAGAGGAAGAGAGGGTCCTCGG + Intergenic
993436733 5:87905035-87905057 GAAGATGAAAAGATGGTCCAGGG - Intergenic
993953365 5:94202098-94202120 GGAAGTGCACAGATGGACCTAGG + Intronic
995539700 5:113172606-113172628 TAAGATGGACAGATGGCCATGGG - Intronic
999202227 5:149824649-149824671 CAAGCTGGACAGATGGTTCTGGG + Intronic
1000157027 5:158562399-158562421 GAAGATTCTCAGCTGGTGCTTGG - Intergenic
1000193746 5:158938305-158938327 GAAGCTGCACAGGCTGTCCTGGG - Intronic
1000770403 5:165346293-165346315 GAAGATGGAAAGATGGTTCTGGG + Intergenic
1001330761 5:170760765-170760787 GAAAATGCACAGATGGACCTAGG - Intergenic
1002130168 5:177076365-177076387 GGAAGTGCACAGATGGACCTAGG - Intronic
1004972102 6:20921999-20922021 GAAGTACCTCAGATGGTCCTGGG + Intronic
1005214960 6:23515145-23515167 GGAAGTGCACAGATGGACCTAGG - Intergenic
1007279257 6:40698386-40698408 GAAGGTGTACAGATGGGCTTGGG - Intergenic
1008373101 6:50758894-50758916 GGAAATGCAAAGATGGGCCTAGG + Intronic
1010004816 6:70984102-70984124 GGAAGTGCACAGATGGGCCTAGG + Intergenic
1010508829 6:76692154-76692176 GGAAGTGCACAGATGGGCCTAGG + Intergenic
1011543816 6:88463204-88463226 GAAGGAGCACAGATGGTTCTGGG + Intergenic
1011825357 6:91299701-91299723 GGAGTTGCACAGATAGTTCTTGG + Intergenic
1013605477 6:111743532-111743554 GAAGAGGCACCGAGGGCCCTTGG - Intronic
1014479664 6:121920524-121920546 GAAGAAGGTTAGATGGTCCTTGG - Intergenic
1015996402 6:138999260-138999282 GGAAGTGCACAGATGGGCCTAGG - Intergenic
1018873499 6:167800675-167800697 GAAGCTGGACAGAAGCTCCTGGG + Intergenic
1022272372 7:28821722-28821744 GGAGACACATAGATGGTCCTAGG - Exonic
1025963449 7:66245569-66245591 AGAAGTGCACAGATGGTCCTAGG + Intronic
1026889994 7:73976278-73976300 GAAGATTCACAGAGGGACTTTGG - Intergenic
1027671585 7:81105903-81105925 GAATGTGTACAGATGGGCCTAGG + Intergenic
1029873244 7:103718235-103718257 TAAGATACACAGATGTTCTTAGG - Intronic
1030785057 7:113650030-113650052 GGAAGTGCACAGATGGGCCTAGG - Intergenic
1032767301 7:135009584-135009606 GGAGATGCATAGATGGGTCTGGG + Intronic
1033991048 7:147287422-147287444 GGAATTGCACAGATGGGCCTTGG + Intronic
1034450514 7:151134831-151134853 CCAGATGCAGAGATGGGCCTAGG - Intronic
1034574913 7:151988284-151988306 CAAGCTGCTCAGATGCTCCTGGG - Intronic
1035175502 7:157047167-157047189 GAAGAAGCACAGATGACCCTCGG + Intergenic
1036151690 8:6305074-6305096 GGAAGTGCACAGATGGGCCTAGG + Intergenic
1038166664 8:25092031-25092053 AAAGACTCACAAATGGTCCTCGG + Intergenic
1039733920 8:40309549-40309571 GGAAGTGCACAGATGGGCCTAGG - Intergenic
1039734246 8:40313877-40313899 GAAAGTGCACAGATGGGCCTAGG - Intergenic
1040547322 8:48408880-48408902 GAAGATGAGCAGATGCTGCTGGG + Intergenic
1042341507 8:67684728-67684750 GGAAATGGACAGATGGGCCTAGG - Intronic
1043041607 8:75270032-75270054 GAACATGCACATTTGGTCTTTGG + Intergenic
1044510323 8:93069947-93069969 GGAAGTGCACAGATGGGCCTAGG - Intergenic
1045578923 8:103456997-103457019 GAAGATAGACAGATGGTTCAAGG + Intergenic
1047441799 8:124885239-124885261 GGAAGTGCACAGATGGGCCTAGG + Intergenic
1047653296 8:126947919-126947941 GAAAATGCTCAGATGTTCTTTGG + Intergenic
1048567324 8:135615182-135615204 GGAGCTCCACAGATGGGCCTAGG + Intronic
1049310888 8:141933287-141933309 GAAGATGCTCAGGTGCTCCCAGG - Intergenic
1049505134 8:142992148-142992170 GGAAAGGCACAGATGGGCCTGGG + Intergenic
1050710924 9:8462302-8462324 GAAGAAGAGCAGATGGACCTGGG - Intronic
1051360473 9:16277589-16277611 GCAGATGCGCAGATGTTTCTTGG - Intergenic
1052129099 9:24819544-24819566 TAAGATGCAGAGCTGTTCCTTGG + Intergenic
1052620666 9:30905174-30905196 GAAGATGTAGAGATGGTACCTGG + Intergenic
1052669172 9:31533690-31533712 GAAGAGGAAGAGATGGTACTTGG - Intergenic
1052879958 9:33595685-33595707 GAAAATGCACAGATGCAGCTTGG + Intergenic
1053496015 9:38548535-38548557 GAAAATGCACAGATGCAGCTTGG - Intronic
1053537185 9:38937619-38937641 GGAAGTGCACAGATGGGCCTTGG + Intergenic
1053788752 9:41671014-41671036 GAAGATGGAGAGGTGGTCTTTGG + Intergenic
1054156387 9:61643754-61643776 GAAGATGGAGAGGTGGTCTTTGG - Intergenic
1054177033 9:61882353-61882375 GAAGATGGAGAGGTGGTCTTTGG + Intergenic
1054476160 9:65574764-65574786 GAAGATGGAGAGGTGGTCTTTGG - Intergenic
1054628950 9:67426311-67426333 GGAAGTGCACAGATGGGCCTTGG - Intergenic
1054660501 9:67698453-67698475 GAAGATGGAGAGGTGGTCTTTGG - Intergenic
1055595331 9:77860164-77860186 GCAGATGCCCAGGTGGTCATGGG - Intronic
1055673005 9:78626106-78626128 GTATATACACAGATGGTCATTGG - Intergenic
1055793507 9:79949076-79949098 GAAGATACAAGGATGATCCTTGG - Intergenic
1056037128 9:82618471-82618493 GAAAATGAACAGAGGGTCTTTGG + Intergenic
1056586124 9:87928346-87928368 GAAAATGCACAGATGCAGCTTGG - Intergenic
1056610758 9:88124597-88124619 GAAAATGCACAGATGCAGCTTGG + Intergenic
1057675944 9:97136053-97136075 GAAAATGCACAGATGCAGCTTGG - Intergenic
1059345878 9:113627598-113627620 TCAGATGTACAGATGGTCCCTGG - Intergenic
1059346715 9:113633982-113634004 GCAGGAGCACAGATGGTCCCTGG + Intergenic
1059747943 9:117220881-117220903 GAAAATGCAGAGATGTTCCCTGG - Intronic
1061494459 9:130963756-130963778 GGAAGTGCACAGATGGGCCTAGG + Intergenic
1061549276 9:131323966-131323988 GATGCTGCACAGAAGGTCCCTGG + Intergenic
1062216928 9:135394248-135394270 GCAGATGCACATGTGGGCCTTGG - Intergenic
1190110204 X:47584427-47584449 GGAAGTGCACAGATGGGCCTAGG + Intronic
1190279534 X:48920227-48920249 GAAGATGCACAGATGCTCCAGGG + Intergenic
1190379748 X:49828418-49828440 GGAAATGCACAGATGGGCCTAGG + Intergenic
1190761709 X:53442479-53442501 GAAGACCCGCAGATGGGCCTTGG + Intergenic
1190835093 X:54093362-54093384 GAAGTTGAACAGATTGTTCTGGG + Intronic
1194600050 X:95909696-95909718 GAGGAAGTACAGATGGGCCTAGG - Intergenic
1195645642 X:107228075-107228097 GCAGATTCACAGATTGACCTTGG + Intronic
1198401964 X:136277370-136277392 GAGGAAGCACAGATGTTCCAGGG + Intergenic
1199150657 X:144481624-144481646 GTAGATGATCAGATGGTCATAGG + Intergenic
1199196873 X:145042008-145042030 GAAGTTACAAAGAGGGTCCTTGG - Intergenic
1201476768 Y:14391056-14391078 GCAGATGTACAGATGGTTTTTGG + Intergenic
1201589648 Y:15601036-15601058 GGAAGTGCACAGATGGGCCTGGG - Intergenic