ID: 958983286

View in Genome Browser
Species Human (GRCh38)
Location 3:100750661-100750683
Sequence CCTTCAATCTATGAGCTGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 149}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958983286_958983288 -2 Left 958983286 3:100750661-100750683 CCTCACAGCTCATAGATTGAAGG 0: 1
1: 0
2: 1
3: 8
4: 149
Right 958983288 3:100750682-100750704 GGATGTCGTTGACTAGCTGAAGG 0: 1
1: 0
2: 0
3: 3
4: 63
958983286_958983289 18 Left 958983286 3:100750661-100750683 CCTCACAGCTCATAGATTGAAGG 0: 1
1: 0
2: 1
3: 8
4: 149
Right 958983289 3:100750702-100750724 AGGCTAATCTTAGTGAAGCGAGG 0: 1
1: 0
2: 1
3: 4
4: 47

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958983286 Original CRISPR CCTTCAATCTATGAGCTGTG AGG (reversed) Intronic
901260925 1:7870124-7870146 CCTTCAACATATGAGTTTTGGGG - Intergenic
905525819 1:38638691-38638713 TCTTCATTTTATTAGCTGTGAGG - Intergenic
905912796 1:41665162-41665184 CCTTCTTTCTCTGAGCTCTGAGG - Intronic
907158238 1:52353633-52353655 CCTTCCATCCAGGACCTGTGAGG + Exonic
909154648 1:72057961-72057983 GCTTCAAGATATGAGCTTTGAGG + Intronic
910302218 1:85719027-85719049 CCTTCAATGTATGTCCTGTTGGG - Intergenic
917497645 1:175555854-175555876 CCTTCCAACCATGAGTTGTGTGG + Intronic
918177671 1:182059904-182059926 GCTGCTGTCTATGAGCTGTGTGG - Intronic
919537804 1:198810094-198810116 TCTTCAGTCTATGACTTGTGAGG + Intergenic
919854611 1:201696625-201696647 GCTTCATTCTGTGAGCTGTGAGG + Intronic
920630437 1:207646341-207646363 GCTTCAGTTTATGAGCTGTAGGG - Intronic
921799505 1:219385979-219386001 CCTCCAAACTATCACCTGTGTGG + Intergenic
922893720 1:229083158-229083180 GCTTCAATCTATGAATTTTGAGG - Intergenic
923449897 1:234106690-234106712 GCTTCAATATATGAATTGTGGGG + Intronic
1066004858 10:31136674-31136696 CCTCCTACCTATTAGCTGTGTGG - Intergenic
1066696339 10:38081651-38081673 CTATCACTCTATGAGCTTTGAGG - Intergenic
1068798057 10:61106154-61106176 CCATCACTCTATTAACTGTGAGG - Intergenic
1072370497 10:94761964-94761986 TCTGCCAGCTATGAGCTGTGTGG + Intronic
1072386694 10:94937940-94937962 TCTGCCAGCTATGAGCTGTGTGG + Intergenic
1072511501 10:96130427-96130449 CCTACATTCTAGGAGCTGGGTGG + Intronic
1072536580 10:96368899-96368921 CTTTCAAACTATGAGGTCTGTGG - Intronic
1078144634 11:8714433-8714455 CCTTCAGACTTTGGGCTGTGAGG - Intronic
1078483361 11:11699803-11699825 TCTTCCATTGATGAGCTGTGTGG - Intergenic
1079109203 11:17594704-17594726 CTGCCAATCTGTGAGCTGTGGGG + Intronic
1079905843 11:26246055-26246077 CCTTCATTCTGTGATCTGGGAGG + Intergenic
1081475541 11:43426668-43426690 CCTTCTATCTAGGACCTATGAGG + Intronic
1087609472 11:100416781-100416803 ACTTCCTTCTAAGAGCTGTGAGG + Intergenic
1088619762 11:111670218-111670240 CCTTTAATCTATGTGTTATGGGG + Intronic
1089551114 11:119278981-119279003 GCTTCAACCTACTAGCTGTGTGG - Intronic
1089787720 11:120920117-120920139 TCTGCCAGCTATGAGCTGTGTGG + Intronic
1090568078 11:128017699-128017721 CCTTCATTATAGTAGCTGTGCGG + Intergenic
1093100342 12:15020681-15020703 CCTTGAGATTATGAGCTGTGAGG - Intergenic
1102664929 12:114563718-114563740 GCTTCAATATATGAACTTTGGGG + Intergenic
1104341183 12:127950542-127950564 TATTCAATCTATGATTTGTGGGG - Intergenic
1106178105 13:27348385-27348407 CCTTCATTCCCTGAGCGGTGAGG + Intergenic
1107271009 13:38615992-38616014 CCTTCAACATATGAACTTTGAGG + Intergenic
1108179822 13:47829466-47829488 CCTCCAATCCATGAGCAGTCAGG - Intergenic
1113625244 13:111790187-111790209 CCTTCTATTTATTAGCCGTGTGG - Intergenic
1114497882 14:23146472-23146494 CCTTCAAACTATCAGCTCTGTGG + Intronic
1116967764 14:51031927-51031949 ACCTGACTCTATGAGCTGTGTGG + Intronic
1119737883 14:76995546-76995568 CCTCCTTTCTGTGAGCTGTGGGG - Intergenic
1120697192 14:87657712-87657734 CCCTCAGTCTATGACCTGAGTGG + Intergenic
1120945158 14:89987903-89987925 CCCTCAATCTATGGGATCTGAGG - Intronic
1121249218 14:92487375-92487397 CTTTCAAACTCTGTGCTGTGAGG - Intronic
1124209437 15:27750955-27750977 TCTTCAATCAATGACCTGTGAGG - Intergenic
1126634468 15:50767361-50767383 TCGTTAAACTATGAGCTGTGGGG - Intergenic
1128508867 15:68301456-68301478 CCTTCCATCTATGGCCAGTGTGG - Intronic
1130886048 15:88093523-88093545 ACTGCCATTTATGAGCTGTGTGG - Intronic
1134022718 16:10932443-10932465 TCTGCCATTTATGAGCTGTGTGG - Intronic
1135209601 16:20513123-20513145 TCTGCAATCTAGGGGCTGTGTGG - Intergenic
1135529763 16:23242964-23242986 CCCGCAATCTATGAGCAGTGTGG + Intergenic
1135637572 16:24091894-24091916 CCTTCTCTCTATGGGCTGTCTGG + Intronic
1135955240 16:26951460-26951482 CCTGTCCTCTATGAGCTGTGAGG - Intergenic
1137384142 16:48025871-48025893 CCTCCACTCCATGAGCTCTGGGG - Intergenic
1140882916 16:79215113-79215135 CTATCAATTTATGAGCTGTATGG - Intergenic
1140999332 16:80293649-80293671 CCGTCAATCTAGGGACTGTGGGG + Intergenic
1144081468 17:11767853-11767875 CCTAGAATCTAGGAGCAGTGGGG - Intronic
1147467618 17:40622819-40622841 CTGTCAATCTGTGAGCAGTGGGG - Intergenic
1148273336 17:46281228-46281250 CCTGCACTCTATGAGGGGTGGGG - Intronic
1148994977 17:51701547-51701569 CCTTTAATATATGAGCTGGTAGG + Intronic
1150268289 17:63845178-63845200 CATTCAATCTAAGAGCAATGGGG - Intergenic
1150409720 17:64933333-64933355 CCTGCACTCTATGAGGGGTGGGG + Intergenic
1157104226 18:44758193-44758215 CTCTCAGTCTATGAGCTCTGGGG - Intronic
1157772476 18:50361332-50361354 CCTTCAATCTTTGTGCTTAGAGG + Intergenic
1159377107 18:67606383-67606405 CGTTCATTCTATGATCTGTCAGG - Intergenic
1163603211 19:18260836-18260858 CCACCAACCTATGACCTGTGTGG - Intronic
1166595455 19:44044690-44044712 CCTACTATCTAGGAGCTGAGGGG + Intergenic
927510252 2:23639899-23639921 CCTGGAATCTATGGGCTGTGGGG - Intronic
931163190 2:59717005-59717027 CATTTAATCTCTGTGCTGTGTGG - Intergenic
933400776 2:81794377-81794399 TCTTCAATATATGAACTTTGTGG - Intergenic
935154221 2:100468253-100468275 GCTTCAACCTATGAATTGTGGGG + Intergenic
936058876 2:109281670-109281692 CCCTGAATCTAAGAACTGTGGGG - Intronic
936271504 2:111052855-111052877 CCCCCAATCTAGGAACTGTGGGG + Intronic
936895526 2:117423358-117423380 GCTTCAATATATGAGTTTTGGGG + Intergenic
937705555 2:124916551-124916573 TATTCAATCTTTGAGCAGTGAGG + Intergenic
938180170 2:129175440-129175462 ACTTCAAGCTATAAGCTGTAAGG + Intergenic
938206851 2:129431511-129431533 CCCGCAATCTGTGAGCGGTGGGG + Intergenic
938394706 2:130935394-130935416 TCTTCCATCTATTAGCTTTGGGG + Intronic
941509166 2:166384377-166384399 TCTTCCATATATTAGCTGTGTGG - Intergenic
941578090 2:167260855-167260877 GCTTCAACATATGAGCTTTGTGG + Intergenic
941618955 2:167755492-167755514 CCTCCAATCAATGAGGGGTGAGG + Intergenic
944140339 2:196449248-196449270 CCTTGAAACTATGAGTTGTATGG + Intronic
944343784 2:198635954-198635976 TGTTCAATCTAAGGGCTGTGAGG - Intergenic
945235754 2:207629885-207629907 TCTGCAATTTATTAGCTGTGAGG + Intergenic
946031244 2:216706884-216706906 TCTTCTATCTAGTAGCTGTGTGG - Intergenic
947328298 2:229001673-229001695 GCTTCAATATATGAGTTGTGGGG - Intronic
1175851164 20:62093893-62093915 ACTTCAACATATGAACTGTGGGG - Intergenic
1175916942 20:62430376-62430398 CCTTTTATCTCTGAGCTGGGAGG + Intergenic
1176079121 20:63262846-63262868 CCTTCGACTTCTGAGCTGTGGGG - Intronic
1177328479 21:19625691-19625713 CCTTCAATATATGACATTTGGGG + Intergenic
1178464094 21:32830847-32830869 CATTTAATCTATGATCTGTCTGG + Intergenic
1181915095 22:26273572-26273594 CCTCCATTCTTTGAGTTGTGGGG - Intronic
1182163169 22:28144222-28144244 TCTGCCATTTATGAGCTGTGTGG - Intronic
1183087185 22:35493588-35493610 CCTTCCATAGATAAGCTGTGTGG - Intergenic
953573946 3:44097936-44097958 CCTGCAATCCATGGGCTATGTGG + Intergenic
955291876 3:57699596-57699618 TCTTCAATCAAAGAGATGTGAGG + Intergenic
955513518 3:59705095-59705117 TCTTCAATACATGAACTGTGAGG - Intergenic
958983286 3:100750661-100750683 CCTTCAATCTATGAGCTGTGAGG - Intronic
959074393 3:101734929-101734951 TCTGCTATCTATTAGCTGTGTGG + Intronic
959405579 3:105958635-105958657 GCTTCAATATATGAGTTTTGAGG + Intergenic
960953506 3:123014828-123014850 ACTTCAACCTGTGAGCTTTGTGG - Intronic
964641350 3:158913216-158913238 CCTGAAGTCTATCAGCTGTGGGG + Intergenic
968751865 4:2394264-2394286 CCATGAATCTATGAGGTGTGTGG - Intronic
969240099 4:5892079-5892101 CCTTCCAGCTTTAAGCTGTGTGG + Intronic
969507970 4:7599785-7599807 GCTTCATCCTAAGAGCTGTGGGG + Intronic
975809322 4:78149880-78149902 CCTTCAACCTCTTGGCTGTGAGG + Intronic
976074500 4:81282130-81282152 GCTTCAATCTATGAATTTTGTGG - Intergenic
981269491 4:142828266-142828288 CCTTAAATCTATGTTATGTGGGG + Intronic
981505211 4:145492250-145492272 CCTTCAATCTGTGGGATCTGAGG - Intronic
987506038 5:18774097-18774119 CCTGCAATCTAAAAGATGTGTGG - Intergenic
993369981 5:87080825-87080847 CCTTCAAACCATGAGTTGTTTGG + Intergenic
994541686 5:101107742-101107764 GCTTCAATATATGAATTGTGGGG + Intergenic
996487378 5:124052749-124052771 GCTTCAGTCTATGACCTTTGAGG - Intergenic
997834502 5:137181385-137181407 CCTTCATTCTATCAGCAATGAGG + Intronic
997837605 5:137208383-137208405 TCTCCCATCTATGAGTTGTGTGG - Intronic
997979563 5:138460305-138460327 TCTCCTCTCTATGAGCTGTGAGG + Intergenic
1001877205 5:175212095-175212117 TCTTCAATCTTAGAGATGTGAGG + Intergenic
1002894072 6:1364906-1364928 GCTTCAACATATGAGCTCTGGGG + Intergenic
1005399550 6:25417537-25417559 CCTTCAAGCTGAGAGCTTTGTGG + Intronic
1007273671 6:40657797-40657819 CCTTCTCTGCATGAGCTGTGGGG + Intergenic
1009347246 6:62629434-62629456 CTATCAATATATAAGCTGTGTGG - Intergenic
1012459723 6:99447249-99447271 ACTTCAAGCCATCAGCTGTGTGG - Intronic
1013203126 6:107920692-107920714 CATTCAATGTAAGAGCTATGTGG + Intronic
1017549075 6:155484880-155484902 CCTTCAATCTAGAAGATGTAGGG + Intergenic
1017634488 6:156430711-156430733 CATTAAATTTATGAGGTGTGAGG - Intergenic
1018992386 6:168684207-168684229 CCTGTTATCAATGAGCTGTGAGG + Intergenic
1020992458 7:15217139-15217161 CCTTGAATCTATGAGGGCTGTGG + Intronic
1023792124 7:43761072-43761094 TCTTCCGTCTTTGAGCTGTGAGG + Intronic
1024499413 7:50087805-50087827 CTTTCAATCTATGAACTTGGGGG - Intronic
1028880483 7:95874514-95874536 CCTTCAATATATGAATTGTGGGG - Intronic
1032341924 7:131081951-131081973 CCCTCAATCCAAGAGCTGAGTGG + Intergenic
1034256116 7:149725467-149725489 CCTTCACTGTGTGATCTGTGGGG - Exonic
1038866117 8:31440430-31440452 ACTTCAATCTATGTGGTGTATGG + Intergenic
1039551903 8:38449795-38449817 CCTGCAAACTAGGGGCTGTGGGG - Intronic
1044805779 8:96006511-96006533 CCTTCAAACAATGAGCTGATTGG - Intergenic
1045552899 8:103188225-103188247 ACTTGAATCTGGGAGCTGTGAGG - Intronic
1045871819 8:106935554-106935576 CATGCAAGCTTTGAGCTGTGTGG - Intergenic
1045972185 8:108091523-108091545 TCTTCATTCAATGAGCTCTGGGG + Intergenic
1046065511 8:109192048-109192070 CCTTCACTCTATGTGGTGAGTGG - Intergenic
1046986275 8:120391765-120391787 CCATAAATGTAGGAGCTGTGTGG - Intronic
1053534282 9:38910669-38910691 CCTCCAATCTCTGAGGGGTGGGG - Intergenic
1054206505 9:62135088-62135110 CCTCCAATCTCTGAGGGGTGGGG - Intergenic
1054631852 9:67453258-67453280 CCTCCAATCTCTGAGGGGTGGGG + Intergenic
1056801787 9:89697194-89697216 CTTTAAATCAATGAACTGTGAGG + Intergenic
1057199232 9:93131527-93131549 CCTTCAACCTGCGGGCTGTGAGG + Intronic
1058084560 9:100734469-100734491 CCATCAATCTATGAGCACGGTGG - Intergenic
1058439406 9:104993265-104993287 CATTCAACCTATGAACTGGGTGG + Intergenic
1058459428 9:105169310-105169332 CATATAATCTATGAGCTGGGAGG - Intergenic
1058765819 9:108181694-108181716 CCTCCACTCTGGGAGCTGTGGGG + Intergenic
1060312830 9:122478231-122478253 CCTTCAATATATGAGCTGGGTGG + Intergenic
1060940356 9:127539865-127539887 TCTGCCACCTATGAGCTGTGTGG + Intronic
1186762464 X:12737085-12737107 CCTTGATTCTATCAGCTCTGTGG - Intergenic
1189172617 X:38924455-38924477 CCAGGAATCTATGAGCTCTGTGG + Intergenic
1189651763 X:43197485-43197507 CCTTCAACCTTTAAGCTCTGGGG + Intergenic
1190431276 X:50379854-50379876 CCTTCCTCCCATGAGCTGTGAGG + Intronic
1192238081 X:69308814-69308836 CATTCAAATTCTGAGCTGTGTGG + Intergenic
1194043174 X:88969232-88969254 ACTTCAATGTATGAATTGTGGGG + Intergenic
1199104055 X:143840886-143840908 CCTTGGATCTGTGAGTTGTGTGG + Intergenic
1199297379 X:146174431-146174453 CCTTCAATTTCTGAACTCTGAGG + Intergenic