ID: 958983935

View in Genome Browser
Species Human (GRCh38)
Location 3:100758558-100758580
Sequence TCGATCTTTCCAATAACCCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 52
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 48}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958983935_958983939 26 Left 958983935 3:100758558-100758580 CCACGGGTTATTGGAAAGATCGA 0: 1
1: 0
2: 0
3: 3
4: 48
Right 958983939 3:100758607-100758629 TGCCATCAACATAGATCCACAGG 0: 1
1: 0
2: 0
3: 6
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958983935 Original CRISPR TCGATCTTTCCAATAACCCG TGG (reversed) Intronic
907583347 1:55591909-55591931 TCAATGTTTCAAATAACCCCTGG - Intergenic
911100174 1:94089368-94089390 TTGAAGTTTCCAATAACCTGTGG - Intronic
911544870 1:99204012-99204034 TTGATCTTTTCAATAACCTTAGG + Intergenic
914932232 1:151945424-151945446 TCTTCCTTTCCTATAACCCGAGG + Intergenic
1063534801 10:6872976-6872998 TCAATCTTTGCAAGAACCAGAGG - Intergenic
1063893899 10:10659051-10659073 TTGATTTTTCCAATAATCAGAGG - Intergenic
1073519148 10:104109968-104109990 TCAATCTGTCAAATAACCCTGGG - Intergenic
1081542319 11:44044889-44044911 TCTACCTTTCCATTCACCCGGGG - Intergenic
1086047562 11:82550571-82550593 TCGATCTTTCCAACAACACTAGG + Intergenic
1092581361 12:9846441-9846463 TTGATCTTTTCAAAAACCAGCGG + Intergenic
1094689031 12:32750560-32750582 TCCTTCTTTCCAATAAACAGGGG + Intronic
1095719328 12:45383824-45383846 TAGATCATTCCAAAAACCCTAGG - Intronic
1097728087 12:63097391-63097413 ATGATCTTTCTAATGACCCGAGG - Intergenic
1102421281 12:112804753-112804775 TTGATCTTTACAAGAACCCTAGG - Intronic
1110410093 13:75195441-75195463 TCTTTCTTTCCAATAACTCATGG - Intergenic
1113325293 13:109275691-109275713 TCAATCTTTCCATTAACCCCTGG - Intergenic
1113681655 13:112248714-112248736 TCTGTCTTTCCACAAACCCGGGG + Intergenic
1115334588 14:32232082-32232104 TCAATCTTCACAATAACCCTAGG - Intergenic
1115343447 14:32317170-32317192 TTGATCTTTAGAATAACCTGGGG + Intergenic
1116020685 14:39456529-39456551 GTGATCTTCCCAATAACCCTAGG - Intergenic
1133618220 16:7499961-7499983 TCCATATTTCCAAAAACCCCTGG + Intronic
1137242622 16:46669818-46669840 TTGATCTTCCCAACAACCCTAGG - Intronic
1137562628 16:49512713-49512735 TCCATCTTCACAACAACCCGAGG + Intronic
1138442263 16:57042139-57042161 TTAATCTTTACAATAACCCCAGG - Intronic
1143173141 17:4941539-4941561 TTGATCTTCACAATAACCCTAGG - Intronic
1143998612 17:11031715-11031737 TTGATCTTCCTAATAACCCTGGG - Intergenic
1148835926 17:50465739-50465761 TCGCCCTTACCAATAACCCCTGG - Exonic
1152495301 17:80667047-80667069 TGGATTTTCCCAATAACCCCGGG + Intronic
1153378051 18:4403799-4403821 TAGATCTTGCAAATAACCCATGG - Intronic
926295790 2:11567644-11567666 TTGATCTTTCCAACAACCGCTGG + Intronic
928878862 2:36073779-36073801 TCCATGTTTCCAATAGCCAGTGG + Intergenic
940754608 2:157667792-157667814 TTAATCTTTACAATAACCCTGGG + Intergenic
1175603489 20:60294116-60294138 TTTATCTTTGCAATAACCTGTGG + Intergenic
1176695855 21:9977401-9977423 TGGATCCTTCCCATAACACGTGG - Intergenic
1177413701 21:20767131-20767153 TTGACCTTTCCAATAATCCTAGG - Intergenic
958983935 3:100758558-100758580 TCGATCTTTCCAATAACCCGTGG - Intronic
967597676 3:191346728-191346750 CCCATTTTTCCAATAACCAGAGG - Intronic
972026230 4:34381932-34381954 TAGTTCTGTCCAATAAGCCGTGG + Intergenic
976657486 4:87504496-87504518 TTGATCTTTACAACAACCCCAGG + Intronic
978069170 4:104445400-104445422 TAGATCTTTACAATATCCCTAGG - Intergenic
1000299642 5:159944683-159944705 TCAATCTTTACAACAACCCTGGG + Intronic
1007336688 6:41159760-41159782 TGGGTCTTTCCTAAAACCCGTGG - Intronic
1020853913 7:13393011-13393033 TCCATCATTCTAATAACCAGTGG - Intergenic
1028138209 7:87244695-87244717 TGGATCTCTCCCATAACACGTGG - Intergenic
1028615074 7:92756756-92756778 TCTATCTTTCCAATAACAAATGG + Intronic
1053632838 9:39963356-39963378 TGGATCCTTCCCATAACACGTGG - Intergenic
1053772920 9:41500177-41500199 TGGATCCTTCCCATAACACGTGG + Intergenic
1054211050 9:62287341-62287363 TGGATCCTTCCCATAACACGTGG + Intergenic
1054313932 9:63561510-63561532 TGGATCCTTCCCATAACACGTGG - Intergenic
1059915223 9:119092229-119092251 TTGACCTTTCCAATAACCCTGGG - Intergenic
1061841657 9:133361990-133362012 TCGATCTTACCAATATTCGGGGG + Exonic
1188549402 X:31346028-31346050 TGGATCTTTTTATTAACCCGTGG + Intronic