ID: 958985283

View in Genome Browser
Species Human (GRCh38)
Location 3:100773586-100773608
Sequence CTTTGGACAAATACCTAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 301
Summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 266}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958985283_958985286 -7 Left 958985283 3:100773586-100773608 CCTTCCTAGGTATTTGTCCAAAG 0: 1
1: 0
2: 2
3: 32
4: 266
Right 958985286 3:100773602-100773624 TCCAAAGGAATGAAAGCATATGG 0: 1
1: 0
2: 2
3: 47
4: 531
958985283_958985288 19 Left 958985283 3:100773586-100773608 CCTTCCTAGGTATTTGTCCAAAG 0: 1
1: 0
2: 2
3: 32
4: 266
Right 958985288 3:100773628-100773650 TACAAAGACATGTACATGAATGG 0: 1
1: 2
2: 6
3: 41
4: 382

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958985283 Original CRISPR CTTTGGACAAATACCTAGGA AGG (reversed) Intronic
908734252 1:67259271-67259293 CCTTGGATAAATACCTAGGTAGG + Exonic
909247661 1:73308717-73308739 ATCTGGGTAAATACCTAGGAGGG - Intergenic
909989609 1:82207102-82207124 GCTTTGATAAATACCTAGGAGGG - Intergenic
910406486 1:86896581-86896603 CTTTGAAAAAATACCTATTAAGG + Intronic
910610541 1:89136871-89136893 CTCTGGAAAAATACATAAGATGG + Intronic
910811941 1:91247084-91247106 CTTTGGGTATATACCTAGTAAGG + Intergenic
910816227 1:91293690-91293712 CTTTGGGTATATACCTAGTAAGG - Intronic
911991872 1:104708159-104708181 CTTTGGACAAATACTCAGAGTGG + Intergenic
912034228 1:105291151-105291173 CTTTGGATATATACCCAGTAAGG + Intergenic
913373405 1:118125873-118125895 CTTTGGATAAATACCTAATAGGG + Intronic
916330152 1:163606786-163606808 CTGTGGTCAAAGACCTGGGAGGG - Intergenic
918019151 1:180667822-180667844 AAATGGACAAATTCCTAGGAAGG - Intronic
921271396 1:213473578-213473600 CTTTAAGCAAATTCCTAGGAGGG + Intergenic
921775986 1:219100584-219100606 ATTTAGAAAAATACCAAGGAGGG - Intergenic
922084085 1:222328888-222328910 CTTTGGAGAAATACCTATTCAGG + Intergenic
922844584 1:228673955-228673977 CTTTTGACAAATTCTTTGGAAGG - Intergenic
923424199 1:233852706-233852728 CTTTGGGTAAATATCAAGGAGGG - Intergenic
923792804 1:237126648-237126670 TCTGGGAGAAATACCTAGGAAGG - Intronic
1062869361 10:886438-886460 CTTTGGATAAATACTCAGAAAGG - Intronic
1063111468 10:3041646-3041668 TTTTACAGAAATACCTAGGAGGG - Intergenic
1063804217 10:9619548-9619570 TCTTGGACATATACCTAGGAAGG - Intergenic
1065561263 10:26966123-26966145 CTTTGGATATATACCCAGAAAGG - Intergenic
1066456162 10:35574046-35574068 CTTTTCACAAAAACCTATGAAGG - Intergenic
1069008468 10:63345019-63345041 ATTTGGGCAGATATCTAGGAGGG - Intronic
1069439956 10:68419085-68419107 CAGTAGACAAATACCAAGGAAGG - Exonic
1071307787 10:84314352-84314374 TTCTGGACAAATGCCCAGGAGGG + Intergenic
1072088598 10:92104854-92104876 CTTTGAAGAAATTCCTATGATGG + Intronic
1074057104 10:109932585-109932607 TCTTGGATAAATACCTAGGATGG + Intergenic
1075017609 10:118921795-118921817 CTTTACAGAAATACCTACGATGG + Intergenic
1075696641 10:124440821-124440843 CTTTGGTAAAATATCTAGGCCGG - Intergenic
1078172657 11:8940546-8940568 CTAAGGACACATAGCTAGGAAGG - Intergenic
1079665688 11:23102735-23102757 CTTTGGGCATATACCCAGTATGG - Intergenic
1080262823 11:30368246-30368268 TTTTGGACACAGACCCAGGATGG - Intergenic
1080367010 11:31586506-31586528 CTTTGGACAAAGACCGATGCTGG - Intronic
1082023747 11:47556117-47556139 CTTAGGATAAATTCCTAGAAAGG - Intronic
1083190018 11:61043350-61043372 TCTTGGGCAAATACCTAGGAGGG + Intergenic
1085995385 11:81906398-81906420 CTTTCTACAAATATCTAGGCTGG + Intergenic
1086382389 11:86269998-86270020 CTCTGGGTAAATGCCTAGGAGGG + Intronic
1086875021 11:92085363-92085385 CTTTGGTTATATGCCTAGGAGGG + Intergenic
1087201964 11:95354668-95354690 CTTTGGATAAATAACAAGTATGG + Intergenic
1087421576 11:97933105-97933127 ATTTAGACAAATACCAAAGAAGG - Intergenic
1087793517 11:102432036-102432058 CTTTGAAGAAATACCCAAGATGG - Intronic
1088804737 11:113341828-113341850 CTGTGGAAAAACACCTAGAATGG - Exonic
1089039199 11:115430071-115430093 CTTTGGAAAAATAACTTGTAAGG + Intronic
1090341911 11:126030969-126030991 CTTTGGGCAAGAACCTATGAGGG + Intronic
1092212302 12:6654705-6654727 GTTTGGAGCAATATCTAGGATGG - Intronic
1093052910 12:14523795-14523817 CTTTGGATAAATACCCAGCAAGG - Intronic
1093064071 12:14638357-14638379 CTTTGGATAAATACTCAGCAGGG - Intronic
1093606664 12:21098668-21098690 CTTTGGATAAATTCCCAGTAGGG + Intronic
1096954587 12:55512922-55512944 CTTTGGACCAATAAGCAGGAAGG - Intergenic
1097312439 12:58134997-58135019 CTTTGGAGAAATTCCAAGTATGG - Intergenic
1098945173 12:76581576-76581598 TTTTGGACAAAGACCTAGAAGGG - Intergenic
1101649496 12:106662064-106662086 CTTTGGGTAAATACCAAGAAGGG + Intronic
1102660041 12:114518401-114518423 TTTTGTACAAATACCTGGAATGG - Intergenic
1103594046 12:122012495-122012517 TCTTGGCCACATACCTAGGAAGG - Intergenic
1104168187 12:126254148-126254170 CTCTGGACAGATGCCTTGGAAGG + Intergenic
1104337085 12:127909273-127909295 TTTTGGGCAAATGCCTAGGATGG - Intergenic
1106585526 13:31053511-31053533 CTGTGGACAAGTGCCTGGGAAGG - Intergenic
1107334551 13:39340214-39340236 TTTGGCACAAATACCTAGGAAGG + Intergenic
1107632146 13:42353276-42353298 CTTTGGAAATATACCCAGAAAGG + Intergenic
1107663938 13:42669686-42669708 CTTTGGAAAAATATCAAGGAAGG - Intergenic
1109584477 13:64380630-64380652 CTTTGGATAAATACTCAGTAAGG + Intergenic
1109897043 13:68706407-68706429 CTTTGGATATATACCCAGTAAGG + Intergenic
1109920109 13:69045681-69045703 CTTTGGGAAAATACGAAGGAAGG + Intergenic
1112598624 13:100832941-100832963 GTTTGGACATTTACCTAGGGCGG + Intergenic
1112674798 13:101688579-101688601 CTTTGCACAAATCCCTCTGATGG - Intronic
1112794555 13:103041951-103041973 CCTTGGGTAAATACCTAGGAGGG + Intergenic
1114121497 14:19674806-19674828 CTTTGGGCATATACCCAGAAAGG + Intergenic
1115724982 14:36203936-36203958 TTTTGGATAAATACCCAGAATGG - Intergenic
1117607622 14:57446318-57446340 ATTTGGGTAAATACCAAGGAAGG + Intergenic
1117898335 14:60509724-60509746 CTGTGGACAAGTACCGAGTAAGG + Exonic
1118162581 14:63305121-63305143 CTTTGGTGATTTACCTAGGAGGG - Intergenic
1119178837 14:72590276-72590298 TCTTGGTTAAATACCTAGGATGG - Intergenic
1119692449 14:76686676-76686698 CCTTGAATAAATATCTAGGAGGG + Intergenic
1120742420 14:88122705-88122727 CTTTGGGTATATACCTAGTAAGG + Intergenic
1122847621 14:104509337-104509359 CTTTGGATAAATAGCTAGGAGGG - Intronic
1124717370 15:32077297-32077319 CTTTGGGTAAATACCAAAGAGGG + Intronic
1124724068 15:32139363-32139385 CTTTGGATAAATACAAGGGAAGG + Intronic
1125254133 15:37743653-37743675 CTTTGGACCACTCTCTAGGAAGG - Intergenic
1125368453 15:38944237-38944259 CTTTAAACAAATATCTAAGATGG - Intergenic
1125456485 15:39865190-39865212 CTTTGGGTAGATACCTAGTAGGG - Intronic
1126051624 15:44691255-44691277 CATTGGACAATTACCTATTATGG - Intronic
1126965957 15:54054125-54054147 CTTTGGGCATATACCTAGCAGGG + Intronic
1127572615 15:60259055-60259077 CATTGGACACAGACCTAGGCTGG + Intergenic
1128172742 15:65527309-65527331 CTTGGAATAAATACCTATGAAGG - Intergenic
1128287015 15:66445488-66445510 TCTTGGACAAATGCCTAAGATGG - Intronic
1130655217 15:85787832-85787854 CTGTGGACAGATACAAAGGAGGG + Intronic
1134810495 16:17163193-17163215 CCTTGGACAAATCCCCAGGAAGG - Intronic
1135842949 16:25893395-25893417 CTGTGGACAAAGTCCCAGGAAGG + Intronic
1138721159 16:59082025-59082047 CTTTGGGTATATACCCAGGAAGG - Intergenic
1139825976 16:69757467-69757489 CGTTGGACACATACTGAGGAAGG + Intergenic
1140248115 16:73269657-73269679 TTTTGGGTAGATACCTAGGAGGG + Intergenic
1141037086 16:80636694-80636716 CTTTGGGTATATACCCAGGATGG - Intronic
1141140137 16:81492106-81492128 ATTTGGAAAAATTCCCAGGAGGG + Intronic
1142725162 17:1808128-1808150 CTTAGGATAAATTCCTAGAAGGG - Intronic
1143422931 17:6809990-6810012 ATCTGGGCAAATACCAAGGAAGG + Intronic
1143559556 17:7685197-7685219 TCTTGGAGAAATACTTAGGAGGG - Intronic
1143755522 17:9064478-9064500 CTCAGGCCAGATACCTAGGAGGG + Intronic
1143997042 17:11015610-11015632 CCTTGGACAAAGTCCTAAGATGG - Intergenic
1147742903 17:42678846-42678868 CCTTGAAGAAAAACCTAGGAGGG - Intergenic
1148663111 17:49352623-49352645 TTGTGGGTAAATACCTAGGAGGG - Intronic
1149090693 17:52774648-52774670 CTTTGGGTATATACCTAGTAAGG + Intergenic
1149884065 17:60323135-60323157 CTTTGGATATATACCTTGCATGG - Intronic
1150293462 17:63995174-63995196 CTTTTGACAAATACATCGAATGG + Intergenic
1151166613 17:72209361-72209383 TTATGAACAAATACCCAGGAAGG + Intergenic
1153585896 18:6619911-6619933 CTTTGGATAAATACCCAAGCAGG - Intergenic
1154396148 18:13991221-13991243 ATTTGGATAAATACCCAGTATGG - Intergenic
1155553225 18:26989562-26989584 CTTGGGAAAAATGCCTAGGAAGG - Intronic
1157879866 18:51311198-51311220 TTTTGGGCATATACCTAGTAGGG - Intergenic
1158151097 18:54371491-54371513 TTTTGGATATATACCTAAGAGGG + Intronic
1160199617 18:76785713-76785735 CTTTCAGTAAATACCTAGGAGGG - Intergenic
1168628703 19:57939696-57939718 CTTTGGATAAATTCCCAGTAGGG - Intergenic
925044011 2:757299-757321 CTTTGGACAAATACCCAGAGTGG - Intergenic
925354208 2:3226140-3226162 CTTTGGATATATACCCAGAATGG + Intronic
925376912 2:3392822-3392844 CTTTGGATACATACCCAGAATGG - Intronic
927302515 2:21531947-21531969 ATATGGACAAATTCCTAGAAAGG - Intergenic
927795294 2:26042799-26042821 CTTTGGAGAAATACCTACAGAGG - Intronic
928008727 2:27587064-27587086 CTTTTGATAAATATCTAAGATGG + Intronic
928567133 2:32564467-32564489 CTTTGGTAATATACCTAGGATGG + Intronic
929000583 2:37344264-37344286 GGTTGGACAAGCACCTAGGACGG + Intergenic
929446635 2:42007130-42007152 TTTTGGATGAATTCCTAGGATGG - Intergenic
929563183 2:42968456-42968478 CTTTAGAAAGACACCTAGGAAGG + Intergenic
931307092 2:61040227-61040249 CTTTGGATATATACCCAGTAAGG - Intronic
932946787 2:76243246-76243268 CTTTGGATAAATACTCAGTATGG + Intergenic
934530213 2:95081368-95081390 TCTTGGATACATACCTAGGAAGG + Intergenic
935210497 2:100935800-100935822 TTTTAGAAAAATACCTGGGAAGG + Intronic
936266609 2:111015607-111015629 TCTTGGCCAAATATCTAGGAAGG - Intronic
936528137 2:113256142-113256164 CTTTGTTGAAATACCTAGGAAGG - Intronic
938043707 2:128097782-128097804 CTTTGGACAAATAACTGTGTTGG + Intronic
939124707 2:138164235-138164257 TCTTGGGCAAATACCCAGGAGGG - Intergenic
939370766 2:141297206-141297228 CTTTGGGTATATACCTAGTAAGG + Intronic
940194342 2:151076724-151076746 CTTTGGACATACACCCAGAAGGG - Intergenic
940452364 2:153855429-153855451 CTTTGGAGAAATGCCTAGCCAGG - Intergenic
943498973 2:188662432-188662454 ATTTGGATATATACTTAGGAGGG + Intergenic
944315930 2:198285815-198285837 CTTTGTTCAAATAACTAGTATGG - Intronic
945018730 2:205549279-205549301 CTTTGGGTAAATACTAAGGAAGG - Intronic
945197815 2:207253632-207253654 CCCTGGAGAAATACATAGGAGGG + Intergenic
945410455 2:209500345-209500367 GTTTGGAAAAATACCTAGCCTGG - Intronic
948156867 2:235790525-235790547 CTTTGGAAAGATACCTGGGGTGG - Intronic
948493328 2:238328086-238328108 TTTTGGATAAATACCCAGAAGGG + Intronic
948970408 2:241421329-241421351 GTTTGTACAAATCCCTAAGAAGG + Intronic
1169884031 20:10377852-10377874 CTTTGGACAATTACCTGTCACGG + Intergenic
1170224801 20:13980626-13980648 CTTTGGATATATACCTAGAGGGG - Intronic
1173707969 20:45127022-45127044 TTTTGGATAAATACCCAGAAGGG + Intergenic
1174690947 20:52503950-52503972 CTTTGGTCTAATCACTAGGATGG - Intergenic
1174986839 20:55463765-55463787 ACTTTGATAAATACCTAGGATGG + Intergenic
1175519758 20:59592998-59593020 CTTTGTGTAAATACCAAGGAAGG + Intronic
1176318974 21:5288692-5288714 CTTTGGGCATATACCCAGTAAGG + Intergenic
1176476957 21:7228201-7228223 CTTTGGGCATATACCCAGTAAGG + Intergenic
1178974202 21:37208001-37208023 CTTCTGAAAAATACCTAGAATGG - Intergenic
1180845229 22:18977406-18977428 TCTTGGGTAAATACCTAGGAGGG - Intergenic
1181869984 22:25890654-25890676 CTTTGGACAAATCACTATCATGG - Intronic
1183837865 22:40471428-40471450 CAATGGTCAAATTCCTAGGAAGG + Intronic
1184011534 22:41752241-41752263 CATTTGACAAGGACCTAGGAAGG - Intronic
950092966 3:10310124-10310146 CTTTGGAGAAATGACCAGGAGGG - Intronic
950476152 3:13216128-13216150 CTTTGGATAGATTCCTAGAATGG - Intergenic
950875056 3:16264406-16264428 CTTAGGGGAAACACCTAGGAAGG + Intronic
951447125 3:22795694-22795716 CTATGAAGAAATACCTAAGATGG - Intergenic
951996588 3:28736557-28736579 CTCTGTACACATCCCTAGGAAGG - Intergenic
952006339 3:28846510-28846532 CTTGGGATAAATACCTCTGAGGG - Intergenic
953156428 3:40378968-40378990 CTTTGGAGAAATACCTACTCAGG - Intergenic
953753335 3:45626231-45626253 ATTTGGGTAAATACCAAGGACGG - Intronic
954187513 3:48929550-48929572 CTTTGGACACAGACCAAAGAAGG - Intronic
954949272 3:54455094-54455116 CTTTGGATATATACCCAGTAGGG + Intronic
956078893 3:65536412-65536434 TTTTGTACAAATACCCAGGAAGG - Intronic
958593049 3:96184652-96184674 TTTTGGATAAATACCCAGAATGG - Intergenic
958985283 3:100773586-100773608 CTTTGGACAAATACCTAGGAAGG - Intronic
959166048 3:102779728-102779750 CTCTGGAAGAATACCCAGGAAGG + Intergenic
959738540 3:109689226-109689248 TTTTGGATATATACCGAGGATGG + Intergenic
960492107 3:118329851-118329873 CTTTGGATATATACCCAGAATGG - Intergenic
960607482 3:119522048-119522070 CTTTGGATAAATACCTAGTAGGG - Intronic
961187083 3:124924969-124924991 CTTTGGTTAAATACCAAGGAGGG - Intronic
961189375 3:124945156-124945178 CTTGGGATAAATTCCTAGAATGG - Intronic
961863301 3:129935184-129935206 CTTTGGAGAAATGTCTAGGGAGG - Intergenic
962553567 3:136523068-136523090 CTTTGGATAGATACCCAGTAAGG + Intronic
962911052 3:139850035-139850057 CTTTGGATATATACCCAGTAAGG + Intergenic
963478495 3:145836909-145836931 GTTTTGACAAATATCTAGAATGG - Intergenic
964604419 3:158544920-158544942 AGTTGGCCAAATACCTATGATGG + Intronic
964689946 3:159438990-159439012 CTTTGGATATATACCCAGTAAGG + Intronic
965526432 3:169724187-169724209 CTTTGGAAAAATACCAAGAAGGG - Intergenic
965891153 3:173515005-173515027 TTTTGGATAAATACCCAGAATGG + Intronic
966010356 3:175067730-175067752 TTTTGGATATATACCTAGTAGGG - Intronic
966339710 3:178912160-178912182 CTTTGGGTATATACCTAGTAAGG - Intergenic
966952066 3:184829529-184829551 TGTTGGGCATATACCTAGGAGGG + Intronic
970486613 4:16531085-16531107 CTTTTGACCCATACCCAGGAAGG + Intronic
970845341 4:20531117-20531139 TTTTGGACATATACATAGGAGGG - Intronic
971301570 4:25446434-25446456 ATTTGGAGAAATAACTTGGAGGG + Intergenic
972222381 4:36970573-36970595 TTTTGGATATATACCCAGGATGG - Intergenic
974235116 4:59171206-59171228 ATTTGGACAAATATTTAGAATGG + Intergenic
974622580 4:64379903-64379925 CATTGGATAAATACCCAGGGTGG + Intronic
974861598 4:67528820-67528842 TTTTGGGTATATACCTAGGAGGG + Intronic
975833383 4:78394013-78394035 CTTTGGAGAAATACCTATTTAGG + Intronic
977063589 4:92286490-92286512 CTTTGGATATATACCCAGTAGGG + Intergenic
977415040 4:96722036-96722058 ATTTGTACATATCCCTAGGAAGG - Intergenic
977477756 4:97535132-97535154 ATTTGGGCAAATACTTAGGATGG + Intronic
977547416 4:98400204-98400226 CTTTTGATAAATACCCAGTAAGG - Intronic
978252107 4:106643582-106643604 CTTTGGATAAATACCCAGTATGG + Intergenic
978584984 4:110267713-110267735 CTTTGGGTAAATATCAAGGAGGG - Intergenic
979346483 4:119593214-119593236 TTTTGGGTAAATACATAGGAGGG - Intronic
980514388 4:133835367-133835389 CTTTTGAGAAATACCTACTACGG + Intergenic
984714293 4:182912583-182912605 AGTTGGACAAATACCTATGCAGG + Intronic
985793132 5:1942529-1942551 TTTTGGATATATACCCAGGAGGG + Intergenic
986310828 5:6550075-6550097 TCTTGGGCATATACCTAGGAGGG + Intergenic
986421736 5:7591713-7591735 CTCTGGGCAAAAACCCAGGAAGG + Intronic
986507526 5:8468060-8468082 CTTTGGAGAAATGCCTAGCAGGG - Intergenic
987092978 5:14523788-14523810 CTTTGGGTAAATACTAAGGAGGG - Intronic
987199515 5:15561563-15561585 CTTTGGATATATACCCAGCAGGG + Intronic
988394887 5:30684163-30684185 CTTTGGATATATATCTAGAAAGG - Intergenic
988875466 5:35440799-35440821 AGTTGGATAAATACCTAAGAAGG - Intergenic
988980055 5:36558920-36558942 TTGTGAACAGATACCTAGGACGG - Intergenic
989657461 5:43760154-43760176 ATTTGTACATATCCCTAGGAAGG - Intergenic
990480916 5:56209800-56209822 CTTTGGACACATTCCTAGAAAGG + Intronic
990520848 5:56579084-56579106 CTTTAAAATAATACCTAGGAAGG + Intronic
990638615 5:57757576-57757598 CCTTGGGTAAATACCTAGAAGGG - Intergenic
991440337 5:66640732-66640754 CTTTGGGCATGTACCTAGAAAGG + Intronic
992177014 5:74159263-74159285 CTTTGGAGAAATACCTATTCAGG - Intergenic
993065444 5:83092156-83092178 CTTTTGACAAATACCTATTCAGG + Intronic
993212658 5:84974259-84974281 CTTTGGCTAGATACCCAGGAGGG + Intergenic
994360919 5:98847360-98847382 GTTTGGGTAAATACCAAGGAGGG - Intergenic
994466258 5:100136528-100136550 TTTTGGATAAATACCTACTAGGG + Intergenic
994976218 5:106810571-106810593 ATTTGGACACATATCAAGGAAGG + Intergenic
995130724 5:108627726-108627748 GAGTGGACAAGTACCTAGGATGG - Intergenic
995415360 5:111905218-111905240 ATTTGGGTAAGTACCTAGGAGGG + Intronic
995579040 5:113574738-113574760 GTTTGTACATATCCCTAGGAAGG - Intronic
996411204 5:123161518-123161540 CTTTGGGCAAAGACTTAAGATGG + Intronic
998322376 5:141244808-141244830 CTGTGGAAAAATACATATGAAGG - Intergenic
998843178 5:146277981-146278003 CTTTAGGTAAATTCCTAGGAAGG + Intronic
1000394240 5:160756374-160756396 TCTTGGATAAATACTTAGGAGGG + Intronic
1002149454 5:177215487-177215509 TTTTGGATAAATACCTAGAATGG + Intronic
1002334604 5:178469246-178469268 CTTTGGGGGTATACCTAGGAGGG + Intronic
1003396219 6:5754584-5754606 CTTTGAAGAAAGACCTAAGAAGG - Intronic
1006216444 6:32447624-32447646 CTTTGGATAAATACATAGAAGGG + Intergenic
1006916661 6:37599041-37599063 CTTTGGGTATATACCTAGTAAGG + Intergenic
1007843630 6:44736499-44736521 TTTTGGGCATATGCCTAGGAGGG - Intergenic
1008463609 6:51805020-51805042 CTTTGGATATATACCCAGTAAGG - Intronic
1010368986 6:75085596-75085618 CATTGCACAAATACTTGGGAAGG + Exonic
1011229654 6:85146102-85146124 CTTTGGATATATACCCAGTATGG + Intergenic
1011414479 6:87103096-87103118 TCTTGGATAATTACCTAGGAGGG - Intergenic
1011987063 6:93460598-93460620 TTTTGGATAAATACTAAGGATGG + Intergenic
1012688835 6:102288126-102288148 CTTTTGATAAATACCCAGTAGGG - Intergenic
1013173189 6:107655807-107655829 CTTTGGACAAAGACCAAACACGG - Intronic
1013279014 6:108617128-108617150 CTTTGGGTATATGCCTAGGAGGG + Intronic
1018271976 6:162089528-162089550 TTTTGGATATATACCTAGAAGGG - Intronic
1019177541 6:170167871-170167893 CTTTTGACACAGACCCAGGAGGG + Intergenic
1020489602 7:8763930-8763952 TTTTGGGTAAATACCTAAGAAGG + Intergenic
1020806568 7:12797063-12797085 CTTAGGACAAACACCTATAAGGG - Intergenic
1021535548 7:21700600-21700622 CTTTGGGTATATACCTAGAAAGG - Intronic
1024171592 7:46793234-46793256 CTTTGGATATATACCCAGAAGGG + Intergenic
1024630125 7:51240169-51240191 CCTTGGTCCAAGACCTAGGATGG + Intronic
1024777804 7:52808113-52808135 CTTAGAACAAATACCAAGGCCGG - Intergenic
1025185033 7:56850987-56851009 CACTGCACAAATACATAGGAAGG + Intergenic
1025686900 7:63725977-63725999 CACTGCACAAATACATAGGAAGG - Intergenic
1027891154 7:83977241-83977263 CTTATGACAAATTCCTAGAAGGG - Intronic
1028969572 7:96842726-96842748 CTTTGGATATATACCCAGTAAGG + Intergenic
1030522457 7:110615076-110615098 CTTTGGATATAAACCTAGTAGGG + Intergenic
1030735272 7:113040913-113040935 CTTAGGATAAATTCCTAGGGGGG - Intergenic
1033772842 7:144572756-144572778 TTTGGGATATATACCTAGGAAGG - Intronic
1039173603 8:34778926-34778948 CTTTGGATATATACCCAGTATGG - Intergenic
1039400387 8:37264093-37264115 TTTTGGATAAATACCCAGTAGGG - Intergenic
1039978181 8:42384587-42384609 CTTTGGCCAAAGTCCTGGGAAGG - Intergenic
1041221442 8:55655602-55655624 CTTGGTACAAATACTTCGGATGG - Intergenic
1041504053 8:58574485-58574507 CTTTGCCCAAATACCTAGAAGGG + Intronic
1042451536 8:68953036-68953058 TCTTGGGTAAATACCTAGGAGGG - Intergenic
1046151066 8:110226760-110226782 CTTTGGATATATACCTAGAAAGG + Intergenic
1046188116 8:110749417-110749439 CTTTGGACATATACCCAGAAGGG - Intergenic
1048347931 8:133591975-133591997 CTTTGGACAAATAGCCAAGGAGG + Intergenic
1050021069 9:1285190-1285212 CTTTCTACAAATACCAAAGAGGG + Intergenic
1051090092 9:13396554-13396576 CTTTCCACAAATACCTGGAAGGG - Intergenic
1052515372 9:29472807-29472829 ATTTGTACATATCCCTAGGAAGG - Intergenic
1053625446 9:39866303-39866325 CTTTGGATATATACCTAGATGGG + Intergenic
1053893242 9:42717439-42717461 CTTTGGATATATACCTAGATGGG + Intergenic
1054218442 9:62384398-62384420 CTTTGGATATATACCTAGATGGG - Intergenic
1056101830 9:83307311-83307333 TCTTGGGCATATACCTAGGATGG - Intronic
1057238672 9:93389200-93389222 CTTAGGATAAATACCCAGAAAGG + Intergenic
1058429821 9:104908277-104908299 ATATTCACAAATACCTAGGATGG - Intronic
1058554475 9:106152316-106152338 CTTTGGGTATATGCCTAGGAAGG - Intergenic
1058757168 9:108093874-108093896 CTTTGTACATATACCCAGGGAGG + Intergenic
1062522703 9:136964955-136964977 TTTTGGGTAAATACCCAGGAAGG - Intergenic
1203412390 Un_KI270579v1:30882-30904 CTTTGGGCATATACCCAGTAAGG + Intergenic
1185686393 X:1932358-1932380 CTTTGGATAAATTCCCAGCAGGG + Intergenic
1185753471 X:2633090-2633112 TTTTGGGTAAATACCCAGGAGGG + Intergenic
1186433669 X:9525381-9525403 ATTTGTCCAAATACCTAGGAAGG - Intronic
1188863275 X:35284429-35284451 CTTTGGATATATGCCCAGGAAGG - Intergenic
1189022540 X:37356223-37356245 CTTTGGAGAAATACAAAGCAGGG + Intronic
1189325404 X:40108364-40108386 GCTTGGACAAATAGCTGGGAGGG + Intronic
1191058425 X:56268304-56268326 CTTTGGATATATACCCAGAAGGG + Intronic
1191099698 X:56712191-56712213 GTTTGTACATATTCCTAGGAAGG - Intergenic
1192458080 X:71294340-71294362 CGTTGGACACATACTGAGGAAGG - Exonic
1194294005 X:92106299-92106321 TTTAGGACAAAAATCTAGGATGG - Intronic
1194588795 X:95771217-95771239 CTTTGGATATATACCCAGTAAGG - Intergenic
1195691700 X:107631545-107631567 CTTAGAATAAATCCCTAGGAAGG + Intronic
1195901710 X:109804939-109804961 CTTTGTGCAAATACATATGAAGG + Intergenic
1196088426 X:111711688-111711710 CTTTTGAGAAATACCTGGAACGG + Exonic
1197460964 X:126740399-126740421 CTTTGGTCAAATCTATAGGATGG - Intergenic
1198692668 X:139301226-139301248 CTTTGACCAAATGCCAAGGATGG + Intergenic
1199363375 X:146947882-146947904 CTTTGGTTAAATACGTAGGATGG + Intergenic
1199490477 X:148393438-148393460 CTTTGGATAGGTACCTAGTAGGG - Intergenic
1200611517 Y:5330814-5330836 TTTAGGACAAAAATCTAGGATGG - Intronic
1202246291 Y:22823627-22823649 CTGTGGACAAAAAACTAGGCAGG - Intergenic
1202399279 Y:24457375-24457397 CTGTGGACAAAAAACTAGGCAGG - Intergenic
1202471501 Y:25212711-25212733 CTGTGGACAAAAAACTAGGCAGG + Intergenic