ID: 958987703

View in Genome Browser
Species Human (GRCh38)
Location 3:100801651-100801673
Sequence CAATTTTCCTAGAGGCAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 249
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 230}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958987703 Original CRISPR CAATTTTCCTAGAGGCAAGA TGG (reversed) Intronic
901640764 1:10691999-10692021 AACTTTTCCTAGAAGCTAGAAGG - Intronic
902311290 1:15583932-15583954 CAATTTTCCTAGGATCAAGTCGG - Intronic
903308111 1:22428926-22428948 CAATATTCCAACCGGCAAGAAGG - Intergenic
903450614 1:23451547-23451569 CAATTTGCCCAGAGGGAAGCTGG + Intronic
904582496 1:31556131-31556153 CAGTATTACTAGAGGTAAGATGG - Intergenic
906669958 1:47647241-47647263 CAGTTTTCCTATAAGCAACATGG - Intergenic
906740487 1:48178241-48178263 CAATTTTTTGAGAGGAAAGAAGG + Intergenic
908250552 1:62262164-62262186 CATTTTCCCTAGAGGCAGTACGG + Intronic
910708777 1:90157197-90157219 CAATTGTGGTAGAGGCAACATGG + Intergenic
911034426 1:93525649-93525671 CAATTGTTCTAAAGGCAAGTTGG - Intronic
911908294 1:103597371-103597393 CAATTTTCCATGGGGCAAGAAGG - Intergenic
911910660 1:103630419-103630441 CAATTTTCCATGGGGCAAGAAGG - Intergenic
911914624 1:103682095-103682117 CAATTTTCCATGGGGCAAGAAGG + Intronic
911918075 1:103724544-103724566 CAATTTTCCATGGGGCAAGAAGG - Intronic
912097211 1:106160287-106160309 CACTTTTCCTGGAGTCAAAATGG - Intergenic
912165190 1:107035208-107035230 CAATCTTCCTGGAGCCAAAACGG - Intergenic
912442294 1:109708466-109708488 CACTTTTCCTGGAGTCAAAACGG - Intronic
914020576 1:143863007-143863029 CAATTTTCCTAGAAAAAAGGGGG - Intergenic
914659074 1:149770925-149770947 CAATTTTCCTAGAAAAAAGGGGG - Intergenic
916009087 1:160688408-160688430 CACTTTTCCTGGAGTCAAAATGG + Intronic
916949828 1:169768265-169768287 CCTTTTTCCTACAGGCAAGGAGG - Intronic
917306951 1:173636961-173636983 TAATTTTCTTAGAGGAAGGATGG - Intronic
917701299 1:177584248-177584270 CAATTTTACCATAGGCAAGTGGG - Intergenic
917747521 1:178025200-178025222 CAATTATCCAGAAGGCAAGAAGG + Intergenic
917999820 1:180482277-180482299 CAATTTTGCAAAAGGCTAGATGG + Intronic
920806662 1:209241038-209241060 CATTTTTCCTATTGGCAAAATGG - Intergenic
922754254 1:228086038-228086060 CAATTTTCCCAGAGTGGAGAGGG + Intronic
923376686 1:233371053-233371075 CAATATTACCAGAGGAAAGAGGG - Intronic
1064766323 10:18677206-18677228 CAATCTTACTAGATACAAGAAGG - Exonic
1064920641 10:20513534-20513556 TTATGGTCCTAGAGGCAAGAAGG + Intergenic
1064920723 10:20514938-20514960 TTATGGTCCTAGAGGCAAGAAGG - Intergenic
1065474461 10:26119048-26119070 AAACCTTCCTAGAGGAAAGAAGG - Intronic
1066789889 10:39050417-39050439 CACTTTTCCTGGAGTCAAAATGG - Intergenic
1070539302 10:77404702-77404724 TAATTTTCCTAAAGGAAAGTGGG - Intronic
1074559041 10:114518886-114518908 CAATCTTCCTAGAAGCAGGTGGG + Intronic
1080405293 11:31973317-31973339 CAATTTGCCTAGAGGGCCGAGGG - Intronic
1081343243 11:41952970-41952992 CAATTTTCTCAGAGGGAAAAAGG + Intergenic
1082309655 11:50631366-50631388 CACTTTTCCTGGAGTCAAAATGG + Intergenic
1082572919 11:54764330-54764352 CACTTTTCCTGGAGTCAAAATGG - Intergenic
1084224128 11:67704493-67704515 CACTTTTCCTGGAGTCAAAACGG - Intergenic
1085260282 11:75200564-75200586 CAATTTTCTTATCTGCAAGATGG - Intronic
1085916884 11:80900833-80900855 CATTTGTCCTAGAAGGAAGAAGG + Intergenic
1088246422 11:107822290-107822312 TAAGTTTCCTAGAAGAAAGAAGG - Intronic
1091069169 11:132547193-132547215 CACTTTTCAAAGAGGGAAGAAGG - Intronic
1091879657 12:3966897-3966919 CAATTTTCTTATAGGTAAGATGG - Intergenic
1092870170 12:12799351-12799373 CCTTTTTCCTAGAGGCGATAAGG + Intronic
1093340659 12:17968899-17968921 CAATTTTTCTACAGACAGGAAGG - Intergenic
1093407688 12:18825100-18825122 CATTTTTACTAGAGCTAAGATGG + Intergenic
1096783386 12:54003587-54003609 CAAGTTTCCTGGTGGCTAGATGG + Intronic
1098046438 12:66405704-66405726 AAATATTCCTAGAAGCAGGATGG - Intronic
1098915230 12:76250484-76250506 CTATTTTCCTAGAGCTAAGGGGG + Intergenic
1100156940 12:91810717-91810739 CCACTGTCCTAGAGGCAAGTCGG - Intergenic
1100812551 12:98353673-98353695 AAATTTTCCTAGGGGAAAAATGG - Intergenic
1101501985 12:105312564-105312586 CACTTTTCCCAGAGTCAAAATGG - Intronic
1101560617 12:105854245-105854267 AAATTTTTCAAGAGGCAGGATGG + Intergenic
1103281122 12:119758794-119758816 CAATTTGGCTAGAGGTAACAAGG + Intronic
1104376667 12:128269101-128269123 CAGTTTTCCTAGATGCAAAGTGG + Intronic
1104561453 12:129848971-129848993 CAATTATACGAGAGGCAGGAAGG - Intronic
1104619725 12:130302003-130302025 CATTTTTCCCAGAGGGAAGAGGG - Intergenic
1105335754 13:19466747-19466769 GATTTTTCCTACAGCCAAGAGGG - Intronic
1109307088 13:60652793-60652815 CAAGTTTCCTATGGACAAGATGG - Intergenic
1110425851 13:75365788-75365810 CCATTTTCCTAGTGGCCACAGGG - Intronic
1110873768 13:80484445-80484467 CAATTTGCCTAGATTCAAGCAGG - Intergenic
1110990309 13:82034351-82034373 CAATTTTCCTTGATGCATCAAGG + Intergenic
1111941228 13:94609956-94609978 AAATTTTCCTAGTGGAAAGTTGG - Intronic
1112236275 13:97640662-97640684 CAATTTTCTTATATCCAAGATGG - Intergenic
1116044689 14:39730285-39730307 CAATTTTTCTAGATGAAAGCAGG - Intergenic
1116765196 14:49062012-49062034 CAATTTTTCTTGATGAAAGATGG + Intergenic
1118147211 14:63152152-63152174 GAGTATTCCTAGTGGCAAGAAGG - Intergenic
1118859623 14:69652555-69652577 CACTTCTCCTAAAGGCAAGAGGG - Intronic
1120219606 14:81717391-81717413 CAATTTCCATAGGGGCAGGAAGG - Intergenic
1120259031 14:82159320-82159342 CTATGATTCTAGAGGCAAGATGG - Intergenic
1121793151 14:96713848-96713870 TGGTTTTCCTAGATGCAAGAAGG - Intergenic
1123907572 15:24935762-24935784 CACTTTTTCCAGAAGCAAGAAGG - Intronic
1124243428 15:28050855-28050877 CATTTTCCCTAGTGGCATGAGGG - Intronic
1128412520 15:67413832-67413854 TAAATTTCCTAGAGGAAAGTCGG - Intronic
1131873602 15:96783241-96783263 CAACTCTCCTAGAAGCAAAAAGG - Intergenic
1132774685 16:1586487-1586509 CAGCTTTCCTAGAGGCCAGTTGG + Intronic
1134621777 16:15694798-15694820 CAAATTTCCTAGAGGAAAAACGG - Intronic
1135176823 16:20237364-20237386 CAATTTTCTTATATGCAAAATGG - Intergenic
1138406677 16:56800863-56800885 CCATTTTCATAAAGGGAAGAGGG - Intronic
1139045358 16:63051363-63051385 CAATTTTCTTAGATACAATATGG - Intergenic
1140133708 16:72186516-72186538 AAATTTATCTAGAGGCAACAGGG + Intergenic
1140716806 16:77734022-77734044 CAGTTCTCCTAAAGGCAGGAAGG + Intronic
1140947342 16:79781825-79781847 CACTTTTCTCAGAGGCAATATGG - Intergenic
1141437132 16:84006429-84006451 CAGTTTCCCTAGCGGCAAAATGG - Intergenic
1144308935 17:13994590-13994612 CAGTGTTCCAAGAGGAAAGAAGG + Intergenic
1145801386 17:27688092-27688114 CACTTTTCCTGGAGTCAAAATGG + Intergenic
1146366530 17:32233296-32233318 GAATTTTCCTAGGGGAAAGAGGG - Intronic
1148592033 17:48823668-48823690 AATTTTTCCTAGGGGCAAGCAGG - Intergenic
1149407197 17:56365281-56365303 AAATTTTATTTGAGGCAAGAGGG + Intronic
1149772735 17:59333481-59333503 CCATGCTCCTAGAGGGAAGAAGG - Intronic
1150189587 17:63224160-63224182 CAATGTTTCTAGTGGCAAGATGG - Intronic
1150692139 17:67375979-67376001 TAATCTTCCCAGAGGCAGGAAGG - Intergenic
1152746170 17:82040340-82040362 CACTTTTCCTAGAGTCAAAACGG + Intergenic
1153638334 18:7132459-7132481 GAACTTTACTAGGGGCAAGAAGG + Intergenic
1153757221 18:8296494-8296516 CAATCTTACTAGATGCAAAAAGG - Intronic
1157073979 18:44444515-44444537 AATCTTTCCTAGAGGAAAGAGGG - Intergenic
1157505339 18:48222227-48222249 ATGCTTTCCTAGAGGCAAGAGGG - Intronic
1157668608 18:49509780-49509802 GAATTTTACAAGAGGAAAGATGG - Intergenic
1158192507 18:54846127-54846149 TAATGTTCCTAAAGGCAAGCAGG + Intronic
1158255486 18:55543266-55543288 CATTTTTCTTAGATGCAAAATGG + Intronic
1159559309 18:69976830-69976852 CAATGTTCCTAGAAGTAAAATGG - Intergenic
1162260202 19:9526816-9526838 AAATTTTCATAGAAGCCAGAGGG + Intergenic
1164288831 19:23849067-23849089 CACTTTTCCTGGAGTCAAAATGG + Intergenic
925529110 2:4839934-4839956 AAATTTTCAGAGGGGCAAGAAGG + Intergenic
925797568 2:7563418-7563440 TAATTTCCGTAGAGGAAAGAAGG - Intergenic
926463306 2:13160836-13160858 CAAGTGTCATAGAGGGAAGATGG - Intergenic
927110098 2:19858426-19858448 CAACTTTGCCAGAGGCAAGGTGG + Intergenic
927408510 2:22799060-22799082 CTATTTTCCTAGAGTCATGATGG - Intergenic
928290306 2:30030903-30030925 CATTTTTCTTTGAGGCAGGATGG - Intergenic
928873729 2:36012291-36012313 CAATTTCCCTAGAGAAATGAGGG - Intergenic
929441477 2:41968601-41968623 AATTTGTCCTAGAGGGAAGAGGG - Intergenic
929686161 2:44036837-44036859 CAATTTTCCTCCAGGCCAAATGG + Intergenic
932947442 2:76252603-76252625 CATTTTTCCTAAAAACAAGAAGG + Intergenic
933309463 2:80642285-80642307 CAATTTACCTTGAGTCAAGTAGG - Intronic
936065075 2:109325057-109325079 TGTTTTTCCTAGAGGCTAGAAGG + Intronic
936656203 2:114490431-114490453 CTAATTTCCTTGAGGGAAGAAGG + Intronic
941456896 2:165719924-165719946 CAATTATGCTAGAGGTAAGATGG - Intergenic
941653453 2:168118252-168118274 CAAATTTCCCAAAGGCAAAAAGG + Intronic
944313159 2:198257817-198257839 CATTTTTCCTGGTGGAAAGAGGG + Intronic
945291869 2:208134920-208134942 CAATTCTTCTAGAAGCATGAAGG - Intergenic
946926119 2:224628620-224628642 CTGTTTCCCTAGAGGCAAAATGG - Intergenic
947314802 2:228844625-228844647 CATTTTTTCTAGAGGTGAGAAGG - Intergenic
1170856238 20:20058191-20058213 CAATTTTACTAGAGGGCAGTAGG + Intronic
1171014914 20:21531316-21531338 CTATTTTCCCTGAGGGAAGATGG + Intergenic
1176737816 21:10568246-10568268 GATTTTTCCTACAGCCAAGAGGG + Intronic
1177342784 21:19826597-19826619 CAATTATCCTAGAAGCAATGAGG - Intergenic
1178037146 21:28597849-28597871 GATATTTCCTAGAGACAAGAAGG + Intergenic
1181061426 22:20283854-20283876 CAATTATCCCTGAGGCAAGCTGG + Intergenic
1181859557 22:25807642-25807664 CAAGTTTCCAGGAAGCAAGATGG + Intronic
1182924645 22:34110829-34110851 CTAATTTCCTAGATGCAGGATGG + Intergenic
1183116391 22:35695581-35695603 CATTTTTCCTAAAGGGCAGAGGG - Intergenic
950085340 3:10253467-10253489 CAACTGTCCTGGAGGTAAGAAGG - Intronic
950461711 3:13126214-13126236 TAATCCTTCTAGAGGCAAGAGGG - Intergenic
951576938 3:24123680-24123702 CAATTTTACTAAAGGCATAAGGG - Intronic
954194727 3:48989891-48989913 TACTTTTCCCGGAGGCAAGAGGG + Exonic
954259150 3:49426162-49426184 CAATATACCAAGAGGGAAGAGGG - Intronic
954713212 3:52514974-52514996 CATTTCTCCTAGAGGGAAAAAGG - Exonic
958119995 3:89273860-89273882 CAGTGTTCCTAAATGCAAGAAGG - Intronic
958987703 3:100801651-100801673 CAATTTTCCTAGAGGCAAGATGG - Intronic
960073710 3:113459496-113459518 TAATTATCCTATAGGTAAGAAGG - Intronic
960117810 3:113914347-113914369 CTATTTTGCTAGAGGCATAAAGG - Intronic
961922756 3:130445340-130445362 CACTTTTCCTGGAGTCAAAATGG + Intronic
961945592 3:130683632-130683654 CAAAGAGCCTAGAGGCAAGAGGG + Intronic
962488096 3:135864333-135864355 CAATTCTTCTAGGGGGAAGAGGG - Intergenic
964515628 3:157504722-157504744 CAGTTTTCTTGGTGGCAAGAGGG - Intronic
965085412 3:164089550-164089572 TAGTTTTCATAGAGGAAAGAAGG - Intergenic
969008811 4:4043975-4043997 CACTTTTCCTGGAGTCAAAATGG + Intergenic
969941349 4:10735016-10735038 GAATGTTCCTAGAGTGAAGACGG + Intergenic
970090713 4:12404520-12404542 CAGTTTTTCTGGAGGCAAGGTGG - Intergenic
970295962 4:14630454-14630476 CAAATTTCCAAGCGGCAATATGG + Intergenic
970414010 4:15838578-15838600 CAATTTTCCTGGAGGAGAGGAGG - Intronic
970830255 4:20330235-20330257 CAATATTCCAGGAGGCAACATGG + Intronic
972102155 4:35433440-35433462 AATTTTTCATTGAGGCAAGAGGG - Intergenic
972176517 4:36413888-36413910 CAGTTTTCTTAAAGGCCAGAAGG + Intergenic
973318864 4:48789682-48789704 CCATGTTCCTAGATGCAAGCTGG + Intergenic
973589403 4:52425387-52425409 CACTTTACCTAGGAGCAAGAGGG - Intergenic
974605219 4:64143046-64143068 CATTTTTCCTGGAGTCAAAACGG + Intergenic
975826845 4:78329252-78329274 CACTTTTCCTGGAGTCAAAATGG - Intronic
975954962 4:79826242-79826264 CATTTTTCCTGGAGTCAAAATGG + Intergenic
976314039 4:83640375-83640397 CAACCTTCCTTGAAGCAAGATGG - Intergenic
976317480 4:83673938-83673960 TAATTTTCTTGGAGGCAAGGAGG + Intergenic
976636896 4:87295361-87295383 CACTTTTCCTGGAGTCAAAATGG + Intergenic
977523354 4:98113480-98113502 AAATATTCCTAGAGGAAATAAGG - Intronic
983925397 4:173395845-173395867 GAATTTACCTACAGCCAAGAAGG + Intronic
984231801 4:177109379-177109401 GAGTGTTCCTACAGGCAAGAGGG + Intergenic
985033819 4:185818892-185818914 CAACTTTCCTATAGGCATAAAGG + Intronic
985514853 5:336352-336374 CTATTTTCCAAGAGACAACATGG - Intronic
985855384 5:2420505-2420527 TAATTTTCATAGAGCAAAGATGG - Intergenic
986164361 5:5260818-5260840 CAATTTTCCTTAAGTCAGGAAGG + Intronic
986281212 5:6324202-6324224 AAAAATTCCTAGAGGTAAGATGG - Intergenic
987233810 5:15922733-15922755 CACTTTTCCTTTAGGCAAGACGG - Intronic
989318753 5:40110902-40110924 CACTTTTCCTGGAGTCAAAAGGG - Intergenic
990810856 5:59721540-59721562 CAATTTTCCTATATGTAAAATGG - Intronic
991335071 5:65537841-65537863 CATTTTTCTTACAGGCAAAAAGG - Intronic
993585461 5:89722002-89722024 CAATTTTCCTAGAAACTAAATGG - Intergenic
994546947 5:101178941-101178963 CAATTATTCTAAAAGCAAGATGG + Intergenic
995965609 5:117904191-117904213 AATTTTTCCTAAAAGCAAGAAGG - Intergenic
996878461 5:128266178-128266200 CAATTTTATTAGAGACAAGCTGG + Intronic
1000595543 5:163211318-163211340 CACTTATCCTAGAGGTAACAGGG + Intergenic
1003116127 6:3284882-3284904 CGCTCTTTCTAGAGGCAAGAGGG + Intronic
1004210534 6:13637564-13637586 TAACTTTACTAGAGGGAAGAAGG + Intronic
1005421478 6:25655784-25655806 CACTGTTCCTAGAGGAAAAAAGG - Intronic
1006846914 6:37068792-37068814 CGATTTTTATAGAGGGAAGATGG - Intergenic
1008334149 6:50279967-50279989 CATTTTTCCTAAGTGCAAGAAGG - Intergenic
1012133637 6:95527549-95527571 CAATTTTCCTACAGGTAAGTTGG - Intergenic
1012867667 6:104637187-104637209 CAGTTTTCCTATAGGTATGATGG + Intergenic
1012871781 6:104681702-104681724 TAATTTTCTTAGAGGGAAAAAGG - Intergenic
1015273171 6:131358013-131358035 CCATCTTCCTAGAAGCAAAAGGG - Intergenic
1016102363 6:140118288-140118310 GAATTCTACTAGAGGTAAGAAGG + Intergenic
1016909979 6:149189228-149189250 CAAGTTACCTAAAGTCAAGAAGG - Intergenic
1017393194 6:153963961-153963983 CATCTTCCCTAGAGGCAGGAAGG + Intergenic
1017549940 6:155495378-155495400 CAAGTTTCCAAAAGGAAAGAGGG - Intergenic
1019308009 7:345264-345286 CAATTTTCCTTTGGGCTAGAGGG - Intergenic
1021377595 7:19927125-19927147 CAGGTTTACTAGAGGCAAGTAGG + Intergenic
1021689559 7:23218628-23218650 TTATTTTCCTAGATACAAGATGG - Intergenic
1022743371 7:33144677-33144699 TAATGTTCCTAAAAGCAAGAAGG + Intronic
1022799310 7:33760670-33760692 CAATTTTCCTATTGGTAAAATGG - Intergenic
1024168866 7:46763946-46763968 TAATTTTTCTAGAGGCCACAGGG - Intergenic
1027418611 7:77998280-77998302 CAACTTCCCTAGAGGAAAAAAGG + Intergenic
1027936168 7:84605545-84605567 CAAATTTCCTAGAGACCACATGG - Intergenic
1028547242 7:92016039-92016061 TAATTCTCCTAGATGCAAGGCGG - Intronic
1029025401 7:97411964-97411986 CAATATTCCAAGAGGGAAGTGGG + Intergenic
1030966151 7:115995454-115995476 CAATTATACAAGTGGCAAGAGGG + Intronic
1032924256 7:136584926-136584948 CAAATTTCATATAGGTAAGAGGG + Intergenic
1033859127 7:145603367-145603389 CTATTTTCCTAGAGGACATAGGG + Intergenic
1034833011 7:154326066-154326088 AATTTTTCCTAAAGGCAAGGAGG - Intronic
1034989545 7:155539424-155539446 CAATTTTCCTACTCGCTAGAGGG - Intergenic
1035877267 8:3204781-3204803 CAATTTTCCTATTGGAAAGAGGG + Intronic
1036250081 8:7154636-7154658 CACTTTTCCTGGAGTCAAAATGG + Intergenic
1036993279 8:13625246-13625268 CAATTTTCCTAACTGCAAAAGGG - Intergenic
1037553366 8:19996904-19996926 CACTTTTCCCAAAGGCAAGATGG + Intergenic
1037698673 8:21251554-21251576 CTATATTCCAATAGGCAAGAGGG + Intergenic
1038141680 8:24851792-24851814 CGATTTTCATAGTGGGAAGAAGG + Intergenic
1039677310 8:39683781-39683803 TAAATATCCTAAAGGCAAGATGG + Intronic
1040353085 8:46588039-46588061 CACTTTTCCTGGAGTCAAAACGG - Intergenic
1042170089 8:65982911-65982933 TAATTTTTCTAGAAGCAAAATGG + Intergenic
1044142427 8:88672224-88672246 CACTTTTCCTGGAGTCAAAATGG + Intergenic
1045446963 8:102276548-102276570 CAAGCTTCCTAGAAGCAATATGG - Intronic
1046858674 8:119065929-119065951 CAATTTTTCTATGGGGAAGATGG - Intronic
1047188715 8:122658777-122658799 CAGTTGTCCTAGCAGCAAGATGG + Intergenic
1048934260 8:139342118-139342140 CACTTTCCCTTTAGGCAAGAGGG + Intergenic
1050631359 9:7561948-7561970 CATTTTTCCAAGAGGAAAGATGG + Intergenic
1056940398 9:90950785-90950807 CAATTATCTGTGAGGCAAGAAGG + Intergenic
1057130095 9:92648947-92648969 GAATTTTCCTGGAGGCACAAAGG - Intronic
1057409432 9:94804505-94804527 CAATTTTCCCAGTGGGATGAAGG - Intronic
1058609602 9:106761379-106761401 AAATGTTCCTAGAGCCAGGAGGG - Intergenic
1058973095 9:110100950-110100972 GAATGTTCCCAGAGCCAAGATGG + Intronic
1186004617 X:5055546-5055568 CAATTTTGTAAAAGGCAAGATGG - Intergenic
1186093502 X:6075117-6075139 CCACATTCCTATAGGCAAGATGG + Intronic
1186203441 X:7176977-7176999 TTATTTTCATAGAGGCAAAATGG - Intergenic
1187794431 X:22986791-22986813 ATATTTTCCTAAGGGCAAGAAGG - Intergenic
1189363662 X:40371745-40371767 AACTTCTCCAAGAGGCAAGACGG - Intergenic
1189509395 X:41646821-41646843 CACTTTTCCTGGAGTCAAAATGG - Intronic
1191125384 X:56948351-56948373 CACTTTTCCTGGAGTCAAAATGG - Intergenic
1191865474 X:65700248-65700270 CAGTTTTCCTACAGGTAAAATGG - Intronic
1192805389 X:74504318-74504340 CAATATGCCAGGAGGCAAGATGG - Intronic
1195323249 X:103738013-103738035 GAATTTTCCCAGAGGTGAGATGG - Intergenic
1195377857 X:104245127-104245149 TACTTTTCCTAGAGGTAAAATGG + Intergenic
1197401559 X:125998113-125998135 CAATTTTAACTGAGGCAAGAAGG + Intergenic
1197708518 X:129650510-129650532 CAATTTTTCTTGGGGAAAGAGGG - Intronic
1197744148 X:129919773-129919795 CAAGTTTCAAAGAGGCAAAAAGG - Intronic
1198110330 X:133497376-133497398 TATTTTTCCTGGAGGCAGGAGGG - Intergenic
1200861103 Y:7993742-7993764 CACTTTTCCTGGAGTCAAAATGG + Intergenic
1201456923 Y:14178214-14178236 CAATTTTTCCATGGGCAAGAGGG + Intergenic
1202328649 Y:23721270-23721292 CACTTTTCCTGGAGTCAAAATGG - Intergenic
1202542122 Y:25948784-25948806 CACTTTTCCTGGAGTCAAAATGG + Intergenic
1202596068 Y:26541545-26541567 GATTTTTCCTACAGCCAAGAGGG + Intergenic